ID: 1027409574

View in Genome Browser
Species Human (GRCh38)
Location 7:77900999-77901021
Sequence TCCCGCTTGCCTTCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027409574_1027409585 28 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409585 7:77901050-77901072 GCCAGAGAGTGGTAGTGGGGAGG No data
1027409574_1027409579 4 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409579 7:77901026-77901048 GCACATCACATGGCCAGAGCAGG 0: 57
1: 163
2: 439
3: 851
4: 1587
1027409574_1027409584 25 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409584 7:77901047-77901069 GGAGCCAGAGAGTGGTAGTGGGG No data
1027409574_1027409582 23 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409582 7:77901045-77901067 CAGGAGCCAGAGAGTGGTAGTGG 0: 1
1: 0
2: 4
3: 73
4: 698
1027409574_1027409577 -6 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409577 7:77901016-77901038 GCGGGACCAGGCACATCACATGG 0: 1
1: 11
2: 211
3: 590
4: 1277
1027409574_1027409581 17 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409581 7:77901039-77901061 CCAGAGCAGGAGCCAGAGAGTGG 0: 2
1: 22
2: 114
3: 276
4: 1085
1027409574_1027409583 24 Left 1027409574 7:77900999-77901021 CCCATGGCAGAAGGCAAGCGGGA 0: 1
1: 1
2: 3
3: 43
4: 230
Right 1027409583 7:77901046-77901068 AGGAGCCAGAGAGTGGTAGTGGG 0: 1
1: 0
2: 0
3: 43
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027409574 Original CRISPR TCCCGCTTGCCTTCTGCCAT GGG (reversed) Intronic
900241649 1:1620168-1620190 ACCCGCTGGCCATATGCCATTGG - Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900696396 1:4013908-4013930 GCCCTCCTGCCTTCTGCCATGGG - Intergenic
900696492 1:4014984-4015006 GCCCTCCTGCCTTCTGCCATGGG - Intergenic
901184560 1:7364591-7364613 TCACGCCTGCCTTCTAGCATAGG - Intronic
905798110 1:40826796-40826818 TGCCGCCTGCCGTCTGCCTTGGG + Intronic
906177911 1:43791896-43791918 TACCCCTTGCCTCCTGCCAGAGG - Intronic
906462816 1:46049635-46049657 TCCCTCTTGACTGCTGTCATTGG - Intronic
906562512 1:46769402-46769424 TCTCTCTTGCCTTCTGCCCTAGG - Intronic
907605923 1:55817406-55817428 CGCCCCTTGCCTTCTGCCCTGGG - Intergenic
907962067 1:59293400-59293422 ACCCTCTCACCTTCTGCCATGGG - Intergenic
910427267 1:87130219-87130241 TCCCACTTGCCTTTGGTCATGGG + Intronic
913686253 1:121234841-121234863 GCCCTTCTGCCTTCTGCCATGGG + Intronic
914038104 1:144022463-144022485 GCCCTTCTGCCTTCTGCCATGGG + Intergenic
914151350 1:145045477-145045499 GCCCTTCTGCCTTCTGCCATGGG - Intronic
914414233 1:147463953-147463975 TCCAGCTTGTCTTCTGCAAATGG + Intergenic
914438114 1:147678704-147678726 ACCCCTGTGCCTTCTGCCATGGG - Intergenic
914453672 1:147815886-147815908 GCCCTTCTGCCTTCTGCCATGGG - Intergenic
918005001 1:180533725-180533747 TCCCGCCTGCCTTCTCTCTTAGG + Intergenic
918189756 1:182162846-182162868 ACCCTTCTGCCTTCTGCCATGGG + Intergenic
919737611 1:200962999-200963021 TGCCTCTTGGCTTCTGACATGGG + Intergenic
920473575 1:206253400-206253422 GCCCTTCTGCCTTCTGCCATGGG + Intronic
922506236 1:226127430-226127452 TCCCACTTCCTTTCTGCCCTAGG - Intergenic
1063343587 10:5291807-5291829 TGCCCCCTGCCTTCTGCCATGGG + Intergenic
1064191451 10:13209445-13209467 GCCTGCTTACTTTCTGCCATTGG + Exonic
1067458491 10:46440432-46440454 TCCCTCACCCCTTCTGCCATAGG + Intergenic
1067628707 10:47944203-47944225 TCCCTCACCCCTTCTGCCATAGG - Intergenic
1068456693 10:57264396-57264418 TTTAGCTTGCCTTCTGCCAGGGG - Intergenic
1068558292 10:58482525-58482547 TTCCTCTTGCCTTCTGCCGTGGG + Intergenic
1068631731 10:59304971-59304993 TCCCCTTTGCTTTTTGCCATGGG + Intronic
1069304965 10:66957747-66957769 TTCCCCTTGTCTTCTGCCTTAGG - Intronic
1070203877 10:74235924-74235946 TGCTGTTTGCCTTCTGCCATGGG + Intronic
1071121810 10:82287316-82287338 TCCTGTTTGTTTTCTGCCATGGG + Intronic
1071273373 10:84029505-84029527 TTCCTCTTCCCTTCTGCCAATGG - Intergenic
1071508607 10:86247573-86247595 TCCTTCTAGCCTTCTGCCCTTGG - Intronic
1072476665 10:95767996-95768018 TGCCCTTTGCTTTCTGCCATGGG + Intronic
1072762492 10:98068450-98068472 GCCCTCTTGCCTTCTGCCATGGG - Intergenic
1074609899 10:115011614-115011636 TCCCCTTTGCCTTCTACCATGGG - Intergenic
1074644781 10:115435393-115435415 GCCCTTTGGCCTTCTGCCATGGG + Intronic
1074656396 10:115593104-115593126 GCCCTTCTGCCTTCTGCCATGGG - Intronic
1074800129 10:116991443-116991465 TCCCCTTCGCCTTCTGCCAGGGG - Intronic
1075210186 10:120484459-120484481 GCCCTCTCACCTTCTGCCATGGG - Intronic
1076454347 10:130579051-130579073 TCCTGCTTCCCTCCAGCCATAGG + Intergenic
1076464612 10:130670347-130670369 TGCTGCTTGCCTTCTGCTATGGG + Intergenic
1076493277 10:130878528-130878550 TTCCTCTCACCTTCTGCCATGGG - Intergenic
1078090550 11:8262262-8262284 TGCCGCCGGCGTTCTGCCATTGG - Intronic
1078756600 11:14216607-14216629 TGCCTTCTGCCTTCTGCCATGGG - Intronic
1080397873 11:31906572-31906594 GCCCTCTTGCCTTCCACCATGGG - Intronic
1080577213 11:33610891-33610913 TGCCCTCTGCCTTCTGCCATGGG - Intronic
1080721041 11:34848905-34848927 CCTCTTTTGCCTTCTGCCATTGG + Intergenic
1081424423 11:42909796-42909818 TCCTGAGTGCTTTCTGCCATCGG - Intergenic
1081717512 11:45260895-45260917 CCCCTCTTGCCTTCTGCCCTGGG + Intronic
1084883677 11:72189684-72189706 TCCCCCTTGCCTTATTCCAGGGG - Intronic
1090057934 11:123439275-123439297 TCCTGCTTCCCTTCTCCCACTGG - Intergenic
1094278800 12:28711018-28711040 TGCCTCTTGCCTTTTTCCATGGG + Intergenic
1098358297 12:69631287-69631309 TCCAGCTTGACTTCTCCCTTTGG + Intergenic
1099359620 12:81683878-81683900 TCCCCTTGGCCTTCTGCCATAGG - Intronic
1100962367 12:99976965-99976987 GCCCTTCTGCCTTCTGCCATGGG - Intronic
1101005319 12:100396031-100396053 TCCCTCATCCGTTCTGCCATGGG - Intronic
1101506481 12:105351662-105351684 TCATGCTTGTCCTCTGCCATGGG - Intronic
1102226594 12:111233121-111233143 TCCCACTTGCCTCCTGCCTTGGG - Intronic
1103952263 12:124557767-124557789 TCCCGCTTGCCTTCCTCCCCTGG + Intronic
1105250024 13:18690245-18690267 TCCTGCATGCCTTCTACCACTGG - Intergenic
1107173220 13:37367970-37367992 TCCTGCTTGCCTACTGTGATAGG + Intergenic
1107391089 13:39965030-39965052 GCCCTTCTGCCTTCTGCCATGGG - Intergenic
1108026970 13:46188292-46188314 GCCTTCTTGCCTTCTGCCACGGG - Intronic
1109633052 13:65078407-65078429 GCTCTCTTGCCTGCTGCCATGGG + Intergenic
1110267468 13:73554710-73554732 TCCCTTCTGCCTTCTGCCACAGG - Intergenic
1110437669 13:75493405-75493427 TCTCCCTTGCCTTATGCCCTGGG - Intergenic
1115013365 14:28578053-28578075 TCCCACTAGCCCTCTGGCATGGG - Intergenic
1115242111 14:31260097-31260119 TCCCCCTTGACTTCTGCCTGAGG + Intergenic
1116549859 14:46223269-46223291 TCCAGCTTGTCTTCTGCTTTTGG - Intergenic
1117668222 14:58079331-58079353 GCCCTTCTGCCTTCTGCCATCGG - Intronic
1118388601 14:65277809-65277831 GCCCTTCTGCCTTCTGCCATGGG + Intergenic
1118533041 14:66728444-66728466 TCCCTCCTGGCTGCTGCCATGGG - Intronic
1118586036 14:67354009-67354031 TCACCCTCGCCTTCTGCCATGGG + Intronic
1120754402 14:88228700-88228722 TCACGGTTGCCTTCTGCCTTCGG + Intronic
1122232482 14:100313674-100313696 TCCCTCTGGCCTTCTGCCTCTGG - Intergenic
1123152948 14:106200170-106200192 TACGGGTTGCCTGCTGCCATAGG - Intergenic
1124508845 15:30305193-30305215 CACCTTTTGCCTTCTGCCATGGG - Intergenic
1124734713 15:32233469-32233491 CACCTTTTGCCTTCTGCCATGGG + Intergenic
1126545025 15:49863663-49863685 TTCCAGTTGCCTTCAGCCATGGG + Intronic
1126928242 15:53615790-53615812 TCTGTCTTGCCTTTTGCCATGGG - Exonic
1131130664 15:89898220-89898242 TCCAGCTTGCCTTTCACCATGGG - Exonic
1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG + Intronic
1131361687 15:91797595-91797617 TGCCCCTTGTCTTCCGCCATGGG - Intergenic
1131769606 15:95721653-95721675 ACCCTCTTGCCTACTGCGATGGG - Intergenic
1132307962 15:100831291-100831313 TCCTTCTTGCCCTCTGCCCTGGG - Intergenic
1133100159 16:3474571-3474593 TCCCGCCCTCCTGCTGCCATGGG - Intronic
1137357847 16:47783813-47783835 TCCATCCTGCCTTCTGCCATTGG - Intergenic
1141622198 16:85242274-85242296 TCCTGCTTCCCCTCTGCCAGAGG + Intergenic
1142104920 16:88297518-88297540 TCCCACTTGCCGTGTGCCGTGGG - Intergenic
1142154902 16:88528454-88528476 GCCCGCTTGCCTGCTGGCAGGGG - Intronic
1142504640 17:355082-355104 CCCTGCTGGCCTTCTGCAATGGG + Intronic
1144422449 17:15110605-15110627 TTCCAATTGCCTTCTGCCATTGG - Intergenic
1145321329 17:21769122-21769144 TTCGGCCTTCCTTCTGCCATGGG - Intergenic
1146291526 17:31610923-31610945 TACCGTTTGCCTTCCCCCATTGG - Intergenic
1146733318 17:35214670-35214692 TCCCCCGAGCCTTCTGCCCTTGG + Intergenic
1147437697 17:40427714-40427736 GTCCTTTTGCCTTCTGCCATGGG + Intergenic
1148998705 17:51734940-51734962 TCCCTTTTGCCTTCCGCCATGGG - Intronic
1149723583 17:58869536-58869558 TCCCCTTCTCCTTCTGCCATGGG + Intronic
1150967173 17:69984593-69984615 GCCCTTTTGCCTTCTGCCATGGG - Intergenic
1151895376 17:76976914-76976936 TCTCTCTCTCCTTCTGCCATGGG - Intergenic
1152167310 17:78718133-78718155 TCCAGCTGGCCTGCTGCCAACGG + Intronic
1152596667 17:81241100-81241122 TCCCACTTCCTTTCTGCCCTAGG - Exonic
1154438803 18:14368651-14368673 TCCTGCATGCCTTCTACCACTGG + Intergenic
1155234393 18:23804883-23804905 TCCCCTTTACCTTCTGCCATGGG + Intronic
1155705991 18:28813449-28813471 TCACTTTTGCCTTCTGCCATTGG - Intergenic
1156461852 18:37325711-37325733 TCCCAGCTGCCTTCAGCCATGGG + Intronic
1160765527 19:805966-805988 TCCCGCTTCCCTTCTGGGACCGG + Intronic
1160982004 19:1820476-1820498 TCACTCTTGCCTCCAGCCATGGG - Intronic
1162497029 19:11029109-11029131 CCCGGCTTGCCTTCTTCCTTGGG + Intronic
1164415251 19:28041733-28041755 GCCCTCTTGCCTTCTGCCACTGG + Intergenic
1164519796 19:28970179-28970201 GCCCTCTTGCCTTCTGCCACAGG + Intergenic
1164936800 19:32221058-32221080 CCTGGCTTGCCTTCTGCCATGGG - Intergenic
1167706438 19:51083958-51083980 TCCCGTCTCCCCTCTGCCATCGG - Intronic
1168654592 19:58118073-58118095 TCCCGCGTGTCTTCTCCCCTTGG - Intronic
927359935 2:22221374-22221396 TGCCTTTTTCCTTCTGCCATAGG - Intergenic
927597701 2:24411654-24411676 TCCCTCTCACCTTCTGTCATGGG + Intergenic
927776369 2:25906988-25907010 GCCCTTCTGCCTTCTGCCATGGG + Intergenic
930766786 2:55092636-55092658 TCCTGCTTGCCCTCTGTCAGAGG + Intronic
931110784 2:59108947-59108969 ACCCTCTTGCCTTGTGCTATGGG + Intergenic
932541989 2:72664752-72664774 TCCAGTTTGGCTTCTCCCATAGG + Intronic
932790367 2:74649641-74649663 GCCCTTCTGCCTTCTGCCATGGG - Intergenic
935097719 2:99961745-99961767 TCCGGGTTGCCTTCTTCTATTGG - Intronic
935699785 2:105801557-105801579 TCCAGCTTTCCTTGTGCCATGGG - Intronic
936392380 2:112087209-112087231 TCCAGCTTTCCTTCTGCCTCAGG + Intronic
937044339 2:118843296-118843318 TCCCCCCTCCCTTCTGCCCTCGG - Intronic
937974458 2:127573904-127573926 GCCCGCTTACCTTCAGCCTTTGG + Exonic
938089291 2:128420694-128420716 GCCCTCTTGTCTTCTGTCATGGG + Intergenic
939079230 2:137639617-137639639 TCCCTCTTGCCTGCTTTCATGGG - Intronic
939104145 2:137929468-137929490 TCCTGCATGCCTTCTACCACTGG - Intergenic
939462133 2:142510907-142510929 GCCCTTCTGCCTTCTGCCATAGG - Intergenic
940041188 2:149362666-149362688 TCCCTTCTACCTTCTGCCATGGG - Intronic
941212455 2:162658070-162658092 ACCCTCATTCCTTCTGCCATGGG + Intronic
942017999 2:171836570-171836592 TCCTCCATACCTTCTGCCATGGG + Intronic
943631481 2:190257748-190257770 TCACCCTTGCCTTTTGCCGTGGG - Intronic
944687019 2:202126477-202126499 TCCCCCTTGCCATCTTCCTTGGG + Intronic
948320319 2:237063714-237063736 TCCCTCCAGCCTACTGCCATTGG + Intergenic
1168892879 20:1306112-1306134 TCCCCCCTCCCTTCTCCCATGGG + Exonic
1169550695 20:6698379-6698401 TCCCACTTGCCTTTTTCCCTAGG - Intergenic
1173839246 20:46146390-46146412 TCCCCCTTGCCTGGTGCCAGGGG - Intergenic
1174697280 20:52572861-52572883 ACCCTCTTGCCTTCTGCCAAGGG + Intergenic
1175101320 20:56580573-56580595 TCCAGCCTGCCTTCTGCGAAAGG - Intergenic
1176044865 20:63087349-63087371 TCCCGCGTGCCTTCACCCAGTGG - Intergenic
1176181845 20:63753130-63753152 TACCCCTTGCCTCCTGCCTTTGG - Intronic
1177866462 21:26518485-26518507 TGCCTCCTGCCTTCTGCCTTGGG + Intronic
1177985318 21:27967549-27967571 TCCCTTCTGCCTTCTTCCATGGG - Intergenic
1178214867 21:30583876-30583898 GCCCTTCTGCCTTCTGCCATGGG - Intergenic
1178700126 21:34826313-34826335 TGCCCCTTGCTTTCTGCCTTGGG + Intronic
1179157790 21:38864938-38864960 TCTCTTCTGCCTTCTGCCATGGG + Intergenic
1179165166 21:38929807-38929829 TCACTTCTGCCTTCTGCCATGGG + Intergenic
1182454785 22:30443382-30443404 TCCCTCTTCCCTTCTCCCAGGGG + Intergenic
1182660709 22:31923244-31923266 TCTCACTGGCCTCCTGCCATGGG + Intergenic
1183246573 22:36698409-36698431 ACACGCTTGCCTTCTAGCATGGG - Intronic
1183719329 22:39553220-39553242 TGAAGCTTGCATTCTGCCATTGG + Intergenic
949253716 3:2019726-2019748 TCCCCTTTGCCTTCTGACATGGG + Intergenic
949400448 3:3660088-3660110 TCCCTTCTGCCTTCTGCCATGGG - Intergenic
949965886 3:9355869-9355891 TCCCTTCTGCCTTCTGCCGTGGG - Intronic
950636607 3:14319892-14319914 TCCCGCTTGCCTCCTGCAGAGGG + Intergenic
952519573 3:34143080-34143102 TCCCCTTTGCCTTCTGCCATGGG + Intergenic
953000633 3:38929835-38929857 GCCCTTCTGCCTTCTGCCATGGG + Intronic
953144369 3:40260854-40260876 ACCCTTCTGCCTTCTGCCATGGG - Intergenic
954541981 3:51399458-51399480 TCCCGCTGGCCTCCTGCCTCTGG - Intronic
955150204 3:56359742-56359764 TCCCCGTTGCCTTCCCCCATGGG - Intronic
955643155 3:61108662-61108684 GCCCGCTTGCCTTGTGACACAGG - Intronic
956869894 3:73406564-73406586 TCACGCTGGTCTTCTGCCCTTGG + Intronic
959674011 3:109013907-109013929 CCTCCCTTGCTTTCTGCCATGGG + Intronic
959808339 3:110586617-110586639 GCCCTTTTACCTTCTGCCATGGG - Intergenic
960231955 3:115238765-115238787 GCCCTTTTGCTTTCTGCCATGGG - Intergenic
960467386 3:118013941-118013963 CCACTCTTGCCTTCTGTCATAGG - Intergenic
960849829 3:122041375-122041397 GCCCTTCTGCCTTCTGCCATGGG + Intergenic
960913710 3:122676186-122676208 TCCTCTCTGCCTTCTGCCATAGG - Intergenic
962008594 3:131371905-131371927 CCCCGCTTCCCTTCTGACTTGGG + Intergenic
962315195 3:134354897-134354919 TCCAGCCTGCCTCCTGCCACTGG - Intergenic
962738082 3:138343649-138343671 TTCTGCCTGCCTTCTGCCATGGG - Intergenic
963053539 3:141163424-141163446 GCCCTTCTGCCTTCTGCCATAGG + Intergenic
963690421 3:148493432-148493454 GCTCTCTTGCCTTCTGCCATGGG + Intergenic
965838110 3:172873506-172873528 TCACTTCTGCCTTCTGCCATGGG - Intergenic
966323051 3:178722436-178722458 ACCCTCTTGCCTTCCACCATGGG - Intronic
967253042 3:187562757-187562779 TCCCCTTTGCCTTCTGTCATGGG - Intergenic
968441651 4:627467-627489 TGCTGCTTGCTTACTGCCATTGG - Intronic
968804669 4:2764315-2764337 TCGCGCTCGCCTTCTGCCTGAGG - Intergenic
971256837 4:25022215-25022237 TTCCTCTTCCCTCCTGCCATTGG - Intronic
971435397 4:26617176-26617198 GCCCTCTCACCTTCTGCCATGGG - Intronic
971490120 4:27203301-27203323 ACCCTCATCCCTTCTGCCATGGG + Intergenic
973970072 4:56204427-56204449 GCCCACCTGCCTTCTACCATGGG - Intronic
974438768 4:61890484-61890506 GCCCTTCTGCCTTCTGCCATGGG - Intronic
976084279 4:81391473-81391495 TCCTTCTTGCCTTCTGCATTTGG - Intergenic
976608638 4:87006858-87006880 TGCCGCTTGCCGCCTGCCTTTGG + Intronic
978391272 4:108228071-108228093 TCCCCTTCGCCTTCTGCCAAGGG - Intergenic
980461449 4:133120157-133120179 TCCCCTTTGCCTTCTAGCATAGG - Intergenic
981229731 4:142338835-142338857 TCCATCTTGCCTTCTGCCACTGG + Intronic
982122253 4:152154453-152154475 TCACGCTTTCATACTGCCATAGG - Intergenic
982331315 4:154184853-154184875 TCCCTCTCTCCTGCTGCCATGGG - Intergenic
982407468 4:155036370-155036392 TCCTGCTTGCTTTCTGCCAGAGG + Intergenic
982442026 4:155447674-155447696 CCCCACTTGGCTTTTGCCATGGG - Intergenic
982895468 4:160917051-160917073 TCCCAGATGACTTCTGCCATTGG + Intergenic
983639264 4:169929333-169929355 TCCCACTAGACTTCTGCCAGAGG - Intergenic
983652024 4:170045074-170045096 GCCCTTCTGCCTTCTGCCATGGG + Intergenic
983820694 4:172190561-172190583 TCTCGGTTTACTTCTGCCATTGG - Intronic
984069533 4:175094001-175094023 TCCCGCTTACCTTCCCCTATAGG - Intergenic
984575827 4:181447012-181447034 TCCCTCATTTCTTCTGCCATAGG - Intergenic
984767400 4:183410110-183410132 TCAAGCTTGCATTCTTCCATGGG + Intergenic
987472141 5:18345320-18345342 ACTCTCTTGCCTTCTGCCATGGG - Intergenic
988637285 5:32998412-32998434 TCCCTTTGGTCTTCTGCCATGGG + Intergenic
988872749 5:35409177-35409199 TCCTTCTCTCCTTCTGCCATGGG - Intergenic
993591154 5:89796656-89796678 TTCCTTCTGCCTTCTGCCATGGG + Intergenic
994849439 5:105035719-105035741 TCCCTCTTGGCTTCTTTCATGGG + Intergenic
995631358 5:114136332-114136354 GCCTGTCTGCCTTCTGCCATGGG + Intergenic
995803702 5:116027900-116027922 GCCCTCTTGCCTTGTACCATGGG - Intronic
996349224 5:122519959-122519981 GCCCTTTAGCCTTCTGCCATGGG - Intergenic
999371778 5:151060052-151060074 GCCCTGTTGCCTTCTGCCAGGGG - Intronic
1000724580 5:164753539-164753561 TCCCTCTTGCCTCTTGCCCTAGG + Intergenic
1001879246 5:175228972-175228994 TCTCCTTTGCCTTCTGCCATGGG - Intergenic
1002837601 6:878297-878319 TCCTGCTTGTCTCCTGCCGTTGG - Intergenic
1003529037 6:6922427-6922449 TACCACCTGCCTTCTGCCATGGG - Intergenic
1004039884 6:11965109-11965131 ACCCTCTTGCCTTCCACCATAGG - Intergenic
1004230192 6:13826095-13826117 GCTCTCCTGCCTTCTGCCATGGG - Intergenic
1004882521 6:20022968-20022990 CCCGCTTTGCCTTCTGCCATGGG + Intergenic
1005229464 6:23683810-23683832 GCCCTTTTGCCTTCTACCATGGG - Intergenic
1008170585 6:48200971-48200993 TACCGCTAGGCTTCTGGCATAGG - Intergenic
1010549191 6:77200554-77200576 TCCTCCTTGCCTTCCACCATGGG + Intergenic
1011074706 6:83426062-83426084 ACCATCTTGCCTTCCGCCATGGG + Intronic
1011210604 6:84952239-84952261 TGCCTTCTGCCTTCTGCCATGGG - Intergenic
1012859236 6:104539881-104539903 TCCCTTCTGCTTTCTGCCATGGG - Intergenic
1013862271 6:114650073-114650095 GCCCTTCTGCCTTCTGCCATGGG - Intergenic
1014053895 6:116990285-116990307 GCCCTTTTGCCTTCTGCCATAGG + Intergenic
1014349221 6:120318217-120318239 GCCCTTTTGCCTTCTGCCACGGG - Intergenic
1017694590 6:157001802-157001824 TCCCCTTTGCCACCTGCCATAGG - Intronic
1017768301 6:157624969-157624991 GCCCTCCTGCCTTCTGCCATGGG - Intronic
1022886301 7:34649246-34649268 TTCCCCTTTCCTTCTTCCATTGG + Intergenic
1024813977 7:53245911-53245933 TCCCCTTCGCCTTCTGCCGTGGG + Intergenic
1027409574 7:77900999-77901021 TCCCGCTTGCCTTCTGCCATGGG - Intronic
1031116609 7:117675891-117675913 GCCCTTTTGCCTTCTGCCATGGG + Intronic
1031232804 7:119131352-119131374 TCTCTTCTGCCTTCTGCCATGGG - Intergenic
1031912927 7:127536511-127536533 TCCCATTTGCTTTCAGCCATTGG + Intergenic
1033763425 7:144461664-144461686 TCTGCCTTGCCTTCTGCCATGGG + Intronic
1034190952 7:149213247-149213269 CCCCGCTTTCCCTCTGCCCTGGG - Intronic
1035126649 7:156612573-156612595 TCTCTCTTGCCTTCTGCCAGTGG + Intergenic
1036761017 8:11508608-11508630 TCCCGCATTCCCTCTGCCTTCGG + Intronic
1037215282 8:16443763-16443785 GCCCTTCTGCCTTCTGCCATGGG + Intronic
1038356972 8:26838655-26838677 TCTCCCTTGCTTTGTGCCATTGG - Intronic
1038895519 8:31777707-31777729 TTCCTTTTTCCTTCTGCCATGGG - Intronic
1040542653 8:48373847-48373869 GCTCACTTGCTTTCTGCCATAGG - Intergenic
1040860236 8:51991261-51991283 TCCCCTTCTCCTTCTGCCATGGG + Intergenic
1042593041 8:70416731-70416753 TCTCTTTTCCCTTCTGCCATGGG - Intergenic
1044561045 8:93612608-93612630 CCCCTTTTGCCTTCTGCCATGGG - Intergenic
1047714844 8:127586107-127586129 TCCCTCTTGCCTCCTGCCACTGG + Intergenic
1048653005 8:136501600-136501622 TCCCCTTTGCCTTCCACCATGGG + Intergenic
1049150373 8:141031322-141031344 ACCCTCTTGCCTTCCACCATGGG - Intergenic
1049447044 8:142635958-142635980 TGCCCTCTGCCTTCTGCCATGGG + Intergenic
1049542754 8:143215871-143215893 TCACCCTTAACTTCTGCCATGGG + Intergenic
1050769297 9:9176745-9176767 ACCTTCTTCCCTTCTGCCATGGG + Intronic
1051312859 9:15795155-15795177 GCCCTTCTGCCTTCTGCCATGGG - Intronic
1052648930 9:31274260-31274282 TGCCTTTTACCTTCTGCCATGGG + Intergenic
1053459240 9:38255811-38255833 TTCACTTTGCCTTCTGCCATGGG - Intergenic
1056535728 9:87525801-87525823 TCCCTCTTGCCTTCTGCCTGGGG + Intronic
1059161777 9:112041582-112041604 TCCCCCTCGCCTCCTCCCATGGG - Intronic
1059370739 9:113831531-113831553 TTCCTTCTGCCTTCTGCCATGGG + Intergenic
1060989135 9:127838338-127838360 TCCCTCTGGCCCTCTGCCAATGG - Intronic
1061275173 9:129565950-129565972 TCACTCTTGTCTTCTGCCAAAGG + Intergenic
1185775191 X:2797423-2797445 TCCCGCTTGCACTCTGCCCTGGG + Intronic
1186905130 X:14102551-14102573 TCCCTCTTGCCTTCTGGGGTTGG + Intergenic
1187944644 X:24414437-24414459 TCCCTCTCACCTTCTGCCGTGGG + Intergenic
1187944991 X:24417161-24417183 GCCCTCTTGTCTTCTGCTATGGG + Intergenic
1188936742 X:36185220-36185242 TCCCTCACCCCTTCTGCCATGGG - Intergenic
1189390678 X:40573944-40573966 TCCCTCTTGCCTTCTGCCATGGG + Intergenic
1189582133 X:42417777-42417799 TTCCTCTTGCCTTCTGCCATGGG - Intergenic
1194190066 X:90824597-90824619 TCCTGCCTGCTTTCTCCCATGGG - Intergenic
1194217428 X:91148133-91148155 CCCCGCAACCCTTCTGCCATTGG - Intergenic
1195273443 X:103255007-103255029 CCCCGCTTGCTTTCTGCTCTCGG + Intronic
1196048209 X:111278321-111278343 TCCAGCATGCCTTCTGCCTCTGG - Intergenic
1198415450 X:136415260-136415282 TCCAGATTGCCTTCAGCCCTTGG - Intronic
1198607279 X:138355790-138355812 TCCCCTTCACCTTCTGCCATGGG - Intergenic
1200536665 Y:4406716-4406738 TCCTGCCTGCTTTCTCCCATGGG - Intergenic
1200553941 Y:4611925-4611947 CCCCGCAACCCTTCTGCCATTGG - Intergenic
1201295174 Y:12456063-12456085 TCCCAGTTGCATTCTGCCCTGGG - Intergenic