ID: 1027411371

View in Genome Browser
Species Human (GRCh38)
Location 7:77922613-77922635
Sequence TCCTTTGGGTATCCTAAGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027411371_1027411378 29 Left 1027411371 7:77922613-77922635 CCCAACTTAGGATACCCAAAGGA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1027411378 7:77922665-77922687 AGTGAGGAAGGTCCTGAAACAGG 0: 1
1: 0
2: 1
3: 12
4: 191
1027411371_1027411376 17 Left 1027411371 7:77922613-77922635 CCCAACTTAGGATACCCAAAGGA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1027411376 7:77922653-77922675 GATGAAGTCTCCAGTGAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 257
1027411371_1027411375 13 Left 1027411371 7:77922613-77922635 CCCAACTTAGGATACCCAAAGGA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1027411375 7:77922649-77922671 CTCTGATGAAGTCTCCAGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027411371 Original CRISPR TCCTTTGGGTATCCTAAGTT GGG (reversed) Exonic
909517233 1:76525202-76525224 TCCTCTGTGTATCTGAAGTTTGG - Intronic
914240386 1:145849182-145849204 TCCTTTGGGTATGTTAACCTAGG - Exonic
915271638 1:154757829-154757851 TCCCTTGAGTATCCAAAGTCAGG - Intronic
915516792 1:156418003-156418025 TCCTTTGGATATCCTGAGGTAGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
918612216 1:186505991-186506013 ACCTTTGGGTATTCTTATTTGGG + Intergenic
921184379 1:212657188-212657210 TCCTTTGCCTCTCCTAAGTGGGG - Intergenic
924165319 1:241275463-241275485 TCCTTTTGGCATCCTATGGTAGG + Intronic
1067694265 10:48523889-48523911 TCCTCTGAGTCTCCTAACTTTGG - Intronic
1068402427 10:56547699-56547721 GACTTTGAGTATCCTGAGTTAGG - Intergenic
1069838458 10:71324430-71324452 TCCCTTGGGTATACTGAGTGGGG + Intronic
1070151673 10:73808921-73808943 TCATTTGGGTATTCTAAGAAAGG - Intronic
1071031882 10:81194585-81194607 ACCTTTGGTTATCCTGGGTTTGG + Intergenic
1074261911 10:111862580-111862602 TCCTTTGCATATCCCAAGTCTGG - Intergenic
1075475882 10:122733276-122733298 TTATTTGGGTGTCCAAAGTTAGG - Intergenic
1080359676 11:31498133-31498155 TCCATTTGGTATTCTAAGGTTGG - Intronic
1084166919 11:67379438-67379460 TCCTTTGGGAAGCCTGAGCTGGG - Intronic
1086385146 11:86299515-86299537 TCATTTGGGTGTCCTTATTTAGG + Intergenic
1089206220 11:116765465-116765487 TCCTGTGGATTTCCTAAGATAGG - Intronic
1090730345 11:129568106-129568128 TCTTTTGGGTATAAAAAGTTAGG - Intergenic
1092203860 12:6603830-6603852 TCTTTTGGGTATCAGAAATTTGG - Intronic
1092950940 12:13502334-13502356 TCCTTTGTGTATTCTAAATTAGG - Intergenic
1094720454 12:33058011-33058033 TCCTTTTGGTATAATAAATTTGG + Intergenic
1096829528 12:54303579-54303601 TACTTTGGGTTTGCTAGGTTGGG + Intronic
1097338853 12:58414948-58414970 TCCTTTTGGCATACTGAGTTTGG + Intergenic
1098297924 12:69022984-69023006 TCCTTTGGGGTCTCTAAGTTAGG + Intergenic
1103923868 12:124413173-124413195 TCCTGTGGGTTTCCTGAGTTGGG - Intronic
1105231643 13:18501780-18501802 TGTTTTGGGAATCCTATGTTTGG + Intergenic
1110987319 13:81986744-81986766 TCCTTTTGGCATAGTAAGTTTGG + Intergenic
1117753019 14:58943311-58943333 TATTTTGGGTACCCAAAGTTTGG + Intergenic
1118785562 14:69042938-69042960 TCGTTATGGTTTCCTAAGTTTGG + Intergenic
1119939490 14:78625325-78625347 TCTTTTGGGTATGGTGAGTTGGG - Intronic
1121200763 14:92115569-92115591 TCCTGTGTGTATCCTACATTTGG + Intergenic
1125621508 15:41066899-41066921 TTCTTTCGATATCCTAATTTAGG - Intronic
1125865326 15:43042138-43042160 TCATTTGGGAATTCTATGTTTGG - Intronic
1126483765 15:49156150-49156172 TTCTATGGATATCCTAAATTAGG + Intronic
1128559559 15:68655701-68655723 TCCTTTGGGTCTCAAGAGTTTGG - Intronic
1137803227 16:51279891-51279913 TCCTAGGGTTATTCTAAGTTGGG + Intergenic
1139859400 16:70009007-70009029 TCATTTGGGAATCTTAAGATCGG - Intergenic
1140092315 16:71848820-71848842 TCCTTTCTGTAGCCTAATTTGGG - Intronic
1142673329 17:1497689-1497711 TCCTTTGGGTATTCTCCCTTGGG - Intronic
1150251486 17:63707193-63707215 TCCCTTGGGAATCATGAGTTGGG + Intronic
1158014018 18:52762938-52762960 ATCTCTGGGTAACCTAAGTTAGG - Intronic
1158279988 18:55813978-55814000 TCCTTTGGGGGCCCTCAGTTTGG - Intergenic
1158407200 18:57170375-57170397 TGCTCTGGGAATCCTAAGTGTGG + Intergenic
1160237806 18:77099697-77099719 TCCTTTGAGGGTCCTAAGTATGG + Intronic
1163240006 19:16055969-16055991 TCCTTAGGGTTTTCTAAGTATGG + Intergenic
1164485299 19:28650702-28650724 TGCTTTGGGAAAGCTAAGTTTGG - Intergenic
1166096590 19:40543093-40543115 TCCCATGGGCTTCCTAAGTTGGG - Intronic
1168278063 19:55287869-55287891 TCCTTTGGGTCACCAGAGTTTGG - Intronic
925540930 2:4967358-4967380 GCCTGTGGGTTTCATAAGTTTGG - Intergenic
928109524 2:28495390-28495412 TCCTTTGGGTAAACTAAGTCAGG - Intronic
928441228 2:31293840-31293862 TCCTTTGTGGAACCTAAGATTGG - Intergenic
929058827 2:37902864-37902886 TGCTTGGGGTATCCTAATTTTGG - Intergenic
931301038 2:60978478-60978500 ACCTTTGGGTTTCCTCTGTTTGG - Intronic
932171106 2:69557202-69557224 TTCTTTTGTTATCCTAAGATAGG - Intronic
932609567 2:73188658-73188680 TCCTATGGGTATTGGAAGTTTGG + Intergenic
934915786 2:98300098-98300120 TCCTTTGGGTATCACAATTTTGG - Exonic
935850942 2:107217880-107217902 TCCCTTGGTTAGCCTAACTTGGG - Intergenic
936811253 2:116405823-116405845 TTCTTTGCATATTCTAAGTTTGG + Intergenic
939016205 2:136906260-136906282 TGCTTTGGGTATTTAAAGTTAGG - Intronic
942707352 2:178791200-178791222 GCCTTTGATTATCCTAAGTAGGG + Intronic
943440436 2:187921460-187921482 GCCTTTGGTTAACTTAAGTTTGG - Intergenic
1170507672 20:17045120-17045142 TCCTGTTGGTGTCCTAATTTCGG - Intergenic
1175081101 20:56420870-56420892 CCCTTTGGGTATCCCAAATAAGG + Intronic
1178566816 21:33694272-33694294 CACTTTGGGTAGCCAAAGTTTGG - Intronic
1181954851 22:26580724-26580746 TCCTTTGGGGATCCTTCCTTAGG - Intronic
949253365 3:2015112-2015134 TAGTTTGGGTGTCCCAAGTTTGG - Intergenic
950866485 3:16193750-16193772 TCCTTTAGGTGTCCGAAGTTTGG + Intronic
953208257 3:40851245-40851267 TGCCTTGGGGAGCCTAAGTTAGG + Intergenic
953590908 3:44252810-44252832 TCATTTGGGTCTCCTTAGCTTGG + Intronic
961082199 3:124035783-124035805 TCCTGTGGGATTCCTATGTTGGG + Intergenic
962965123 3:140346306-140346328 TCTTTTGGGTATTCTCATTTAGG + Intronic
964833461 3:160911176-160911198 TCCTTTGGATCTCTTACGTTTGG + Intronic
965895914 3:173575409-173575431 TACTTTTGGTATTCTAAATTAGG + Intronic
966989154 3:185211000-185211022 TCCAGTGGGTATGCTTAGTTTGG - Intronic
970528603 4:16958652-16958674 TACTTTAGGCATCCTAACTTGGG + Intergenic
973222165 4:47739359-47739381 TCCTTTTGGACTCCTCAGTTTGG - Intronic
974344633 4:60662844-60662866 TTCTTTGTGAATGCTAAGTTAGG + Intergenic
976624856 4:87168526-87168548 TCCTAGGGTTATCCTGAGTTGGG + Intronic
980725340 4:136751776-136751798 TCCTTTAGGTATTGTAAGTGAGG - Intergenic
980919408 4:139067713-139067735 TCCAATGGGTCTCCTGAGTTAGG - Exonic
984239052 4:177195340-177195362 TCCCTAGAGTATTCTAAGTTAGG + Intergenic
985003395 4:185507887-185507909 TCCTTTGGGGATCAAAAATTAGG - Intronic
986684503 5:10264336-10264358 TACTTTAGATTTCCTAAGTTAGG + Intronic
987932511 5:24420009-24420031 TCCCTAGGGTATTCTGAGTTTGG + Intergenic
991469931 5:66957015-66957037 TCTTTTGGGTATGTTAAATTAGG + Intronic
992388314 5:76307079-76307101 TTCTTTGGGTTTACTATGTTTGG + Intronic
992598525 5:78370989-78371011 TCCTTTGGCTATTCTTAGATTGG + Intronic
994970686 5:106732514-106732536 TCCTTTGCTTATGCTTAGTTTGG - Intergenic
997719864 5:136069671-136069693 TCCTTTGGATAGTTTAAGTTTGG + Intergenic
1001954161 5:175837019-175837041 TCCTTTGGGATACCCAAGTTAGG - Intronic
1002946967 6:1771299-1771321 TTCTTTCAGCATCCTAAGTTAGG - Intronic
1006318702 6:33306207-33306229 GACTTGGGGTATGCTAAGTTAGG - Intronic
1006437579 6:34034178-34034200 TCCTTTGGACATGCTAAGTTTGG - Intronic
1007451482 6:41942821-41942843 TCCTTAGTGTCTCCTAAGTCAGG - Intronic
1008472036 6:51895206-51895228 TCCTTTGGGAAGCCAAAGTGGGG + Intronic
1009440577 6:63673392-63673414 TCCTATGGTTATCCTGAGTTGGG - Intronic
1010498301 6:76563112-76563134 GACTTTGGGTATCCTATTTTAGG + Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1016443416 6:144108419-144108441 TCCTTAGGGGCTTCTAAGTTAGG - Intergenic
1017481508 6:154860878-154860900 TCCTTTGGGTATTCTAATACAGG - Exonic
1017676162 6:156816426-156816448 TCCATTGGGTGTCAGAAGTTGGG + Intronic
1022202365 7:28128969-28128991 TCCTTTAGGAAACTTAAGTTTGG + Intronic
1022802188 7:33787252-33787274 ACATTTGGGTTTCCTAAGCTTGG + Intergenic
1023331113 7:39117893-39117915 CCCTTTGGGTTTCCTATGCTGGG - Intronic
1023527863 7:41123621-41123643 TGCTAAGGGTATCCTAAGTTTGG + Intergenic
1027411371 7:77922613-77922635 TCCTTTGGGTATCCTAAGTTGGG - Exonic
1032500897 7:132398900-132398922 TCCTGTGGGTGTCCTGAGGTGGG - Intronic
1033685414 7:143635919-143635941 CCCTTTGGGTGCACTAAGTTAGG - Intronic
1033688584 7:143715137-143715159 CCCTTTGGGTGCACTAAGTTAGG - Intronic
1033699200 7:143821701-143821723 CCCTTTGGGTGCACTAAGTTAGG + Intergenic
1034787333 7:153937174-153937196 TCCTCTGGCTATCCTAAGGGTGG - Intronic
1038022564 8:23562445-23562467 CCCGGTGGGTATTCTAAGTTGGG + Intronic
1041996292 8:64062895-64062917 TACTTTGGATCTCCTATGTTGGG - Intergenic
1044645912 8:94442775-94442797 TCCTTTTGGTATAATGAGTTTGG - Intronic
1047794181 8:128237152-128237174 TCCTTGAGTTTTCCTAAGTTGGG - Intergenic
1061604897 9:131701739-131701761 GGCTTTGTGTCTCCTAAGTTAGG - Intronic
1185839911 X:3379349-3379371 GCCTTTGTGTAACCTAATTTTGG + Intergenic
1186128959 X:6445778-6445800 TCCCTTTGGTATGCTGAGTTTGG - Intergenic
1186916465 X:14227733-14227755 TCCTGTGAGTTTCCTAATTTTGG - Intergenic
1187965360 X:24606278-24606300 TCATTTGGGTGGCCTAAGTTTGG - Intronic
1192807233 X:74521623-74521645 TCCTTTGGGAATCCTGTGCTAGG - Intronic
1193261620 X:79413615-79413637 TCCATTAACTATCCTAAGTTGGG + Intergenic
1194680161 X:96842529-96842551 TCCTATGGAAATGCTAAGTTAGG - Intronic
1199459360 X:148067695-148067717 TCCTTTGGGTAGTCTTATTTGGG + Intergenic
1199521350 X:148740094-148740116 TCATTGGGTTATCCAAAGTTAGG - Intronic
1199599059 X:149530372-149530394 TCCTTTTGGTATCCATGGTTTGG - Intronic
1201611313 Y:15845952-15845974 TCCCTTTGGTATGCTAAGTTTGG - Intergenic