ID: 1027413014

View in Genome Browser
Species Human (GRCh38)
Location 7:77942577-77942599
Sequence TGTGGGCTGTGATCAACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027413011_1027413014 3 Left 1027413011 7:77942551-77942573 CCTAACAAATTAGGTATATTCAA 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1027413014 7:77942577-77942599 TGTGGGCTGTGATCAACTGATGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027413014 Original CRISPR TGTGGGCTGTGATCAACTGA TGG Intronic
901305695 1:8231265-8231287 TCTGGGCTGTGCACATCTGAGGG - Intergenic
902766025 1:18615926-18615948 TGTGGGTTGAGAGCAATTGAGGG - Intergenic
902923533 1:19680977-19680999 TGTGGACTGGATTCAACTGAGGG + Intergenic
903691203 1:25174924-25174946 TGAGTGCTGTGATTTACTGAGGG + Intergenic
906168013 1:43702198-43702220 TGTGGTCTGTGAACCTCTGAGGG - Intronic
910269035 1:85372939-85372961 TGTGTGCTTTGTTCAACTGTAGG - Intronic
913875972 1:124051044-124051066 TGTTGTCTGTGTTCAACTCACGG + Intergenic
916721075 1:167485132-167485154 TGTGGGTTGTAACCAAGTGAAGG - Intronic
922355727 1:224773622-224773644 TGGCCTCTGTGATCAACTGATGG + Intergenic
922499841 1:226088539-226088561 TGGGTGCTGAGATCATCTGAGGG - Intergenic
923202574 1:231726333-231726355 TGTGGGCAGTGATGAGCTGCAGG + Intronic
1063166081 10:3463678-3463700 TGTGGGCAGATGTCAACTGAGGG + Intergenic
1064594993 10:16935005-16935027 TGTGGACTAGGGTCAACTGAAGG - Intronic
1067079806 10:43206463-43206485 AGAGGGCTGTGAACAACTGATGG + Intronic
1070321187 10:75355882-75355904 TGTGGGCTGGCATCATCAGAAGG + Intergenic
1071121310 10:82282101-82282123 TGGGGGCTGTGTCCAGCTGAAGG + Intronic
1072175761 10:92919742-92919764 TGTGGACTGTTTTCAACTTAAGG - Intronic
1072699400 10:97629617-97629639 TGAGGGCTGGAATCATCTGAAGG - Intronic
1073005768 10:100323092-100323114 TGGCGGTTGTGATAAACTGAGGG + Intronic
1074893494 10:117755098-117755120 TTTGGTCTGTGATTATCTGAAGG - Intergenic
1074945902 10:118280308-118280330 TGTAGGCTGGGCTCAGCTGAGGG + Intergenic
1075547520 10:123366323-123366345 TGTGGAATGTGAGCAACTGAGGG + Intergenic
1075670454 10:124260750-124260772 TGTGGGCTGTGATCCATGGAAGG + Intergenic
1077799186 11:5521537-5521559 TGTTGGCTATGGTAAACTGAGGG - Intronic
1078056915 11:8016619-8016641 TAGGGGCTGTAATCATCTGAAGG + Intergenic
1080052630 11:27872495-27872517 TGTGGGCTACAATCATCTGAAGG - Intergenic
1081715539 11:45247316-45247338 TGTGGGCAGGGATCAGCTGAAGG + Intronic
1081780610 11:45708852-45708874 TGAGGGCTGTGAACAAATGTAGG + Intergenic
1081986942 11:47312028-47312050 TGTGGTCTGTGAACTGCTGAGGG + Intronic
1082759568 11:57114247-57114269 AGGGGGCTGTGACAAACTGAAGG + Intergenic
1083457619 11:62789506-62789528 TGTGAGTTGAGAGCAACTGATGG - Intronic
1085191235 11:74625192-74625214 TGGGGGCTGTGATACAATGAGGG + Intronic
1091037661 11:132248008-132248030 TGTGGGCTGTGACCATTTAATGG - Intronic
1092625222 12:10319731-10319753 TGGGGGCTGTAATCATCTGAAGG - Intergenic
1097922470 12:65090936-65090958 GGAGGGGTGTGATCAACAGAGGG + Intronic
1098008517 12:66024538-66024560 TGTGGGCTGAGACCACTTGAGGG + Intergenic
1100458274 12:94774045-94774067 TCAGGGCTGTGTTCATCTGAAGG + Intergenic
1102471532 12:113162420-113162442 TGTGGTGTGTGATCAAATCAAGG + Intronic
1102992982 12:117327978-117328000 GGTGGGCTGTGACAGACTGAGGG + Intronic
1109717241 13:66233180-66233202 TGTGGGATGTGATTAAATCATGG + Intergenic
1110051863 13:70912482-70912504 TGCTGGCTGTGATCAATTGTTGG - Intergenic
1112414024 13:99189566-99189588 TGCAGGCTGTGCTAAACTGACGG - Intergenic
1113112079 13:106834144-106834166 TTGGGGCTGTGGTCATCTGAAGG + Intergenic
1113278469 13:108761702-108761724 TGAGGGCTGGGATTCACTGAGGG + Intronic
1115780841 14:36766356-36766378 TGTGGGCTGTGATCACAGAAAGG + Intronic
1117313344 14:54550253-54550275 TGAGGGCTGAGCTCAACTGAAGG - Intergenic
1121833713 14:97073644-97073666 TGCGGGCTGTGATAGCCTGATGG + Intergenic
1124442783 15:29699968-29699990 GGTGGGCAGTGCTCATCTGAAGG - Exonic
1124635889 15:31365123-31365145 AGTGGGCTGTCATTCACTGATGG - Intronic
1126695095 15:51319068-51319090 TGTGGGCTGACGACAACTGAGGG - Intronic
1126706203 15:51407794-51407816 TTTTGGCTATGATCATCTGATGG + Exonic
1127793655 15:62420186-62420208 GGTGGGCTGGCATCAACTAATGG + Intronic
1128144203 15:65323327-65323349 TGGGGGCTGGGATCCCCTGAAGG - Intergenic
1132761860 16:1512311-1512333 TGCGGGCTGTGCTCAGATGATGG + Intronic
1133277237 16:4646442-4646464 GGTGGGCTGTGGTCCTCTGAGGG + Intronic
1134126645 16:11620768-11620790 TGGGGACTGTGACAAACTGAAGG + Intronic
1134843216 16:17418023-17418045 AGTGGGCTGTGATCATCTGAAGG - Intronic
1141003425 16:80329902-80329924 AGTGAGCTGAGATCAAGTGATGG - Intergenic
1145924205 17:28633640-28633662 GGTGGGCTGGGGTCAGCTGAGGG + Exonic
1149039009 17:52165239-52165261 TGTGGGCTGTGAGCTAGTCAGGG + Intergenic
1150335747 17:64329488-64329510 TGTGGGCTGAGATGTAATGATGG + Intronic
1150576167 17:66432979-66433001 TGTGAGGTGTGAGCTACTGAAGG + Intronic
1150873651 17:68944399-68944421 TGTGGCCTGTGAGCTACTGGGGG - Intronic
1150985912 17:70196980-70197002 TGTGGGCAGTGATTAACTCCTGG - Intergenic
1151140143 17:71983870-71983892 TGTATGCTGTGATCTACAGATGG + Intergenic
1152419687 17:80185717-80185739 TGTGGGCTGTTCCCAAATGAAGG - Intronic
1156120976 18:33842609-33842631 TGTGGCCTGTGATCCAAAGAGGG + Intergenic
1158107687 18:53904413-53904435 TGGGGGCTGGGATCAACTAGAGG + Intergenic
1159957850 18:74532602-74532624 TGTGGGCTGTGATCCTAGGAGGG - Intergenic
1160187970 18:76690247-76690269 CCTGAGCTGTGCTCAACTGAAGG - Intergenic
1160662529 19:307745-307767 TGTGGGTTGTGACCCACTGTTGG - Intronic
1163766452 19:19165960-19165982 TCTGGGCTGTGACCAAGTGGAGG - Intronic
1167288782 19:48613436-48613458 TGGGGACTGTGATCATCTGGGGG + Exonic
925346167 2:3173473-3173495 TGTTGGACGTGATAAACTGAGGG - Intergenic
925478831 2:4247910-4247932 CGTGGGCTCTGATCCAATGAGGG + Intergenic
925833918 2:7924259-7924281 TGAGGACTGTGCTCAGCTGAAGG + Intergenic
928258368 2:29744508-29744530 TGGGGGCTGGAATCATCTGAAGG + Intronic
932296818 2:70631188-70631210 TGTGGGCAGGGATCAGCTGTAGG - Intronic
933582658 2:84144866-84144888 GGGGGCCTGTGATCAAGTGAAGG + Intergenic
933933304 2:87177896-87177918 TGAGCCCTGTGCTCAACTGAAGG + Intergenic
935964002 2:108454332-108454354 TGTGAGCAGTGAACTACTGAGGG + Intronic
940241754 2:151570568-151570590 TGAGGGCTGGGATGAAATGAAGG - Exonic
941659377 2:168179878-168179900 TGAAGGCTGTGGGCAACTGAGGG + Intronic
941828917 2:169931923-169931945 TGTGGAATGTGTACAACTGATGG - Intronic
941833488 2:169989531-169989553 TGTAATCTCTGATCAACTGATGG - Intronic
942325023 2:174769187-174769209 CCTGGGGTGTGATCAACTGGAGG + Intergenic
946053722 2:216883873-216883895 TGTGGGCTGGGAGCAAGGGATGG + Intergenic
946111701 2:217425353-217425375 TAGGGGCTGTAATCATCTGAAGG + Intronic
946637353 2:221744310-221744332 TGTGGGCTACCATCATCTGAAGG + Intergenic
946856522 2:223955709-223955731 TGTGAGCTTTGATCAAATTAGGG + Intergenic
946988925 2:225305534-225305556 TGTAGTCTGTGATCATCTGGTGG + Intergenic
947203363 2:227637090-227637112 TGGGGGGTGGGATCACCTGACGG + Intergenic
947822397 2:233081214-233081236 TGTGGGATGTGAGCAGCGGAGGG + Intronic
947987589 2:234462384-234462406 TTTGGGCTGTGATCCTCTTAGGG + Intergenic
948370827 2:237487998-237488020 TGTGAGCTGTGAGCACCTGTGGG + Intronic
1169165586 20:3420706-3420728 CTGGGGCTGTGATCAACTGCAGG - Intergenic
1169219147 20:3811438-3811460 TGTGGGCTGTTGTCAGCAGAAGG - Intergenic
1169638971 20:7726994-7727016 TGTTGACTGTGTTCATCTGATGG + Intergenic
1172919567 20:38469870-38469892 TGGGGGCTGGAATCATCTGAAGG + Intergenic
1174168477 20:48601296-48601318 TGTGAGGTGTGACCACCTGATGG + Intergenic
1175127763 20:56765076-56765098 TGTGGGCTAGAATCAACTCAGGG + Intergenic
1178522043 21:33294607-33294629 TGTGGGTTTTGAGCAGCTGATGG - Intronic
1180007791 21:45031170-45031192 TGTGGATTGTGTTCCACTGAAGG - Intergenic
1182939636 22:34263227-34263249 TGGGGGCTGATATCAACTGATGG - Intergenic
949664572 3:6322286-6322308 TCTGGGCTGTGGTCGACTGGGGG + Intergenic
950107586 3:10398133-10398155 TGTGGGCTCTGAGAGACTGATGG + Intronic
950673594 3:14541238-14541260 TGTGTGCTGGCACCAACTGAGGG + Intronic
951882304 3:27491391-27491413 AGTGAGCTGTGATCACATGATGG - Intergenic
952116574 3:30188938-30188960 TGGGGGCTGGAATCATCTGAAGG - Intergenic
952234802 3:31468087-31468109 TGGGGACTGTGCTGAACTGAAGG + Intergenic
953287738 3:41629258-41629280 TGGGGGTTGTGATCACCTGAAGG + Intronic
956352973 3:68358656-68358678 TGAGGGCTGTGAGCAGCTGCAGG - Intronic
956699218 3:71944092-71944114 TAGGGGCTGGGATCATCTGAAGG + Intergenic
959132261 3:102371264-102371286 TGGGGACTTAGATCAACTGAAGG + Intronic
961390850 3:126551551-126551573 TTTGTGCTGTGGTCAGCTGAGGG + Intronic
963454881 3:145533257-145533279 TGTGGGCTGAGAACACCTGTTGG - Intergenic
964433601 3:156630089-156630111 TGTGGACTGGGGTCAGCTGAGGG - Intergenic
965206110 3:165720439-165720461 TGAGGTCTGTGAACAACTGGAGG + Intergenic
968277795 3:197454236-197454258 AGTGTGCTGTGATCAGCTCAGGG - Intergenic
971144466 4:23961847-23961869 TGTGGGCTGCCATCACCTTATGG - Intergenic
972406379 4:38750692-38750714 TGGAGGATGGGATCAACTGAAGG + Intergenic
975681892 4:76885619-76885641 TGTTGGGTGGGATCCACTGAAGG + Intergenic
976162439 4:82217717-82217739 AGTGTTCTGTGATCAACTCAAGG + Intergenic
976709957 4:88059445-88059467 GGTGGCCTGAGATCAACTGAAGG - Intronic
979324590 4:119363899-119363921 TGTGGGTGGTGATCAACTAGTGG + Intergenic
981741897 4:148011356-148011378 TGTGGGCTGGAATCATCTGGAGG + Intronic
982615097 4:157631607-157631629 TGTGGGCTGTGATCTGGTAAGGG - Intergenic
982867760 4:160539661-160539683 TGTGGGAGGTGATACACTGATGG + Intergenic
984321195 4:178198611-178198633 TAGAGGCTGTGATCACCTGAGGG + Intergenic
984504811 4:180603659-180603681 TGTTGGCTTTAATGAACTGAGGG - Intergenic
989110990 5:37906558-37906580 GGAGGGCTGAAATCAACTGATGG - Intergenic
992509060 5:77415737-77415759 TGGGGTCTGTCACCAACTGAAGG - Intronic
993630183 5:90277150-90277172 TGTGGTATGTGGTCAACTGGTGG + Intergenic
995385555 5:111585018-111585040 TGTGGGCTTTGATTAATAGAAGG - Intergenic
995437712 5:112156725-112156747 TTGGATCTGTGATCAACTGAAGG - Intronic
999544571 5:152613064-152613086 TGAGGGCTGGAATCATCTGAAGG + Intergenic
1000659337 5:163919113-163919135 CTTGGGCTGGGATCAGCTGATGG + Intergenic
1001782335 5:174380731-174380753 TCTGGGCTGTGACCAATTTAGGG + Intergenic
1002920960 6:1573026-1573048 TGTGGGCTGAGATGACTTGATGG - Intergenic
1003008002 6:2399320-2399342 TGGGGGCTGTGGTCATCTGAAGG + Intergenic
1005497638 6:26402378-26402400 TGTGGGCTGTGATTTTCAGAGGG + Exonic
1007719132 6:43875119-43875141 TGAGGGCTGTGACCAGCTGAGGG + Intergenic
1009641545 6:66343491-66343513 TGTAGGCTGATGTCAACTGAAGG + Intergenic
1012603494 6:101128482-101128504 TTTGGGCTGTGTTCAGCTGGTGG + Intergenic
1014383174 6:120769355-120769377 TGGGGGCTGGAATCATCTGAAGG + Intergenic
1014769529 6:125445197-125445219 TGTGGGCAGTGCTCAGCTGTGGG + Intergenic
1015363138 6:132364779-132364801 TGTTAGCTGTCATCAAATGAAGG - Intronic
1015456927 6:133436807-133436829 CTTGGGTTGTGAACAACTGATGG + Intronic
1015850517 6:137567313-137567335 AGTGTGTTGTGATCACCTGAAGG - Intergenic
1024276291 7:47679716-47679738 TGTGGGCTGTGGATACCTGAGGG + Intergenic
1024362723 7:48485757-48485779 TGTGGGCTGTGCATAACAGATGG + Intronic
1024874526 7:54006799-54006821 TGTGGCCTGTGATGAAGTTATGG + Intergenic
1026896733 7:74013777-74013799 TGGGGGCTGTGCTCACCTGGAGG - Intergenic
1027047659 7:75001767-75001789 TGAGAGCTGTGGTCTACTGAGGG + Intronic
1027413014 7:77942577-77942599 TGTGGGCTGTGATCAACTGATGG + Intronic
1029385335 7:100239872-100239894 TGAGCGCTGTGGTCTACTGAGGG - Intronic
1035933495 8:3810536-3810558 TGTGGTCTGTAATCAACCGAGGG + Intronic
1038610606 8:29057196-29057218 GGTGTGCTGTGATCAAATGAAGG + Intronic
1039562274 8:38522209-38522231 TGTGGGGTGTCAGGAACTGATGG + Intronic
1041621159 8:59970946-59970968 TGTGGCCTCAAATCAACTGAAGG + Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049398002 8:142410862-142410884 TGTGGGCTGAAAGCAACTGTGGG + Intergenic
1051622477 9:19065912-19065934 TTTTGGCTGTGATCAAAGGATGG - Intronic
1053163414 9:35829033-35829055 TGGGGGCTGTGAGGATCTGAGGG + Intronic
1053592700 9:39530589-39530611 TGTGGGCTGTTTTCATCTGGAGG - Intergenic
1053850436 9:42285312-42285334 TGTGGGCTGTTTTCATCTGGAGG - Intergenic
1054573602 9:66834687-66834709 TGTGGGCTGTTTTCATCTGGAGG + Intergenic
1055045102 9:71915547-71915569 TTTAGGCTTTGATCAACTGCAGG - Intronic
1055082164 9:72278100-72278122 CAGGGGCTGTGATCATCTGAAGG + Intergenic
1056203918 9:84302279-84302301 TGTTGTCTGGGATCACCTGATGG - Exonic
1056491388 9:87111010-87111032 TGGTGGCTGTGACCTACTGATGG + Intergenic
1057845461 9:98519136-98519158 CCTGGGCTGTGAGCAACTGAAGG + Intronic
1057852204 9:98574474-98574496 TGGGGGCTGGCATCATCTGAAGG - Intronic
1060449251 9:123721603-123721625 TGTGGGAGGTGATCAAATCATGG + Intronic
1060940323 9:127539737-127539759 AGGGGGCTGTGATCAGCTGCTGG - Intronic
1061191570 9:129085481-129085503 TGTGGGCTGAGGTCATCTGGTGG + Intronic
1062077455 9:134598637-134598659 CATGGGCTGTGATCCACCGAGGG - Intergenic
1186370398 X:8940666-8940688 TGTGGCTTGTGATCCACTGGAGG - Intergenic
1186491703 X:9978955-9978977 TTTGGGTTGTAATCAACTAAGGG - Intergenic
1187962876 X:24583373-24583395 TGGGGGCTGTGGTCATCTGAAGG - Intronic
1189223039 X:39389071-39389093 TGGGGGCTGGAATCATCTGAGGG - Intergenic
1189340529 X:40201391-40201413 TGGGTGCTGGGATCATCTGAGGG + Intergenic
1189368209 X:40406337-40406359 TGGGGGCTGGAATCATCTGAAGG - Intergenic
1196220418 X:113107926-113107948 TGTGGCCTGAGAACAACTGGAGG - Intergenic
1200761539 Y:7043467-7043489 AGTGAGCTGTGATCACCCGAGGG + Intronic