ID: 1027413383

View in Genome Browser
Species Human (GRCh38)
Location 7:77946876-77946898
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027413378_1027413383 11 Left 1027413378 7:77946842-77946864 CCAGGGACAGTGACTCATGGTTA 0: 1
1: 0
2: 6
3: 219
4: 3099
Right 1027413383 7:77946876-77946898 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027413383 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr