ID: 1027414836

View in Genome Browser
Species Human (GRCh38)
Location 7:77963879-77963901
Sequence CCTCATCTGTAAAATGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027414832_1027414836 6 Left 1027414832 7:77963850-77963872 CCTTGGGCAAGTTATTTAACCTC 0: 40
1: 354
2: 1411
3: 3913
4: 7594
Right 1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027414836 Original CRISPR CCTCATCTGTAAAATGAGAT AGG Intergenic
No off target data available for this crispr