ID: 1027414836 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:77963879-77963901 |
| Sequence | CCTCATCTGTAAAATGAGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027414832_1027414836 | 6 | Left | 1027414832 | 7:77963850-77963872 | CCTTGGGCAAGTTATTTAACCTC | 0: 40 1: 354 2: 1411 3: 3913 4: 7594 |
||
| Right | 1027414836 | 7:77963879-77963901 | CCTCATCTGTAAAATGAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027414836 | Original CRISPR | CCTCATCTGTAAAATGAGAT AGG | Intergenic | ||
| No off target data available for this crispr | |||||