ID: 1027418074

View in Genome Browser
Species Human (GRCh38)
Location 7:77993449-77993471
Sequence CTCTGTAAGCAGAGGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027418074_1027418076 14 Left 1027418074 7:77993449-77993471 CCAGCATACCTCTGCTTACAGAG No data
Right 1027418076 7:77993486-77993508 AAGATAACACAAATTTGAAGTGG No data
1027418074_1027418077 30 Left 1027418074 7:77993449-77993471 CCAGCATACCTCTGCTTACAGAG No data
Right 1027418077 7:77993502-77993524 GAAGTGGATGAGAAAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027418074 Original CRISPR CTCTGTAAGCAGAGGTATGC TGG (reversed) Intergenic
No off target data available for this crispr