ID: 1027418692

View in Genome Browser
Species Human (GRCh38)
Location 7:77998875-77998897
Sequence ACAGAAGCAAAGAGGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027418687_1027418692 -4 Left 1027418687 7:77998856-77998878 CCACAATTGTGGTTTATGCACAG No data
Right 1027418692 7:77998875-77998897 ACAGAAGCAAAGAGGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027418692 Original CRISPR ACAGAAGCAAAGAGGGGCAA GGG Intergenic
No off target data available for this crispr