ID: 1027423173

View in Genome Browser
Species Human (GRCh38)
Location 7:78037048-78037070
Sequence ATCCAGGTGGCAGATCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423173_1027423181 10 Left 1027423173 7:78037048-78037070 CCTGGTAGATCTGCCACCTGGAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1027423181 7:78037081-78037103 TGCAAGAACCAGTGCCCCCAAGG No data
1027423173_1027423186 25 Left 1027423173 7:78037048-78037070 CCTGGTAGATCTGCCACCTGGAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data
1027423173_1027423183 18 Left 1027423173 7:78037048-78037070 CCTGGTAGATCTGCCACCTGGAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423173 Original CRISPR ATCCAGGTGGCAGATCTACC AGG (reversed) Intronic
905340319 1:37273553-37273575 ATCCAGATGCCTGATCTACCTGG + Intergenic
907421406 1:54349906-54349928 CCCCAGGTGGGAGATGTACCAGG - Intronic
918616821 1:186553611-186553633 ATCCAGTTTGCAGAGTTACCAGG - Intergenic
922431191 1:225555503-225555525 ATCCAGGAGGCAGAGTTAGCAGG + Intronic
923468501 1:234269376-234269398 AACCAGGTGGTACATCTTCCAGG + Intronic
1062784162 10:247488-247510 ATCCAGGTGGCAAATGAAACAGG + Intronic
1064638000 10:17388230-17388252 ATCCAGGAGGCAGGACTGCCTGG - Intronic
1065120012 10:22519751-22519773 ATAAAGGTGGAAGATTTACCAGG + Intergenic
1066475007 10:35738404-35738426 ATCCAGGGGGCAGACCAACCAGG - Intergenic
1071147368 10:82590760-82590782 ATCTAGGTGGCACACCAACCTGG - Intronic
1076559757 10:131353926-131353948 AAGCAGGTGGCAGATCTCTCTGG + Intergenic
1076798481 10:132810035-132810057 ATCCAGGTGGCAGCTGTGCCTGG - Intronic
1078162752 11:8855906-8855928 AGACAGCTGCCAGATCTACCTGG + Intronic
1078418798 11:11189606-11189628 TTCCAGGTGCCAGGGCTACCTGG + Intergenic
1078469207 11:11573579-11573601 ATCCAGCTGGCACCTCTTCCTGG - Intronic
1078546891 11:12253285-12253307 AGCGAGGTGGCAGCTCTGCCTGG - Intronic
1084919368 11:72456905-72456927 ATCCAGGTTGCAGCTCTAATTGG + Intergenic
1085519229 11:77128431-77128453 GTGCAGGTGGCAGCTGTACCAGG + Exonic
1085803151 11:79610584-79610606 ATCCAGCTGTCAGCTCTGCCAGG - Intergenic
1088243405 11:107793311-107793333 ATCCAGGTGGCTTATGTGCCGGG - Intronic
1089016288 11:115168058-115168080 ATCCAGTTGGCAGAACTGCATGG + Intergenic
1089771778 11:120808410-120808432 ATTCAGGTGGCACATGTGCCTGG + Intronic
1092884391 12:12912567-12912589 AGCCGGGCGGCAGATCTAGCGGG + Exonic
1096529721 12:52234958-52234980 ATCCAGGAAGCAGGTCTGCCTGG - Intronic
1097514935 12:60593458-60593480 AACCAACTGCCAGATCTACCTGG - Intergenic
1098501257 12:71194866-71194888 ATCAAGCTGGCAGACCTTCCTGG + Intronic
1098882220 12:75928191-75928213 ATCCAGGTGGTACACCAACCTGG + Intergenic
1102002519 12:109566260-109566282 ATCGAGGTGGCACAGCCACCAGG + Intronic
1103271223 12:119675284-119675306 ATCCTGGTGGCAGAACTTCCAGG - Intronic
1103626261 12:122222524-122222546 ACCCAGGAGGCAGAGCTTCCTGG + Intronic
1103833940 12:123803822-123803844 ACCCAGAAGTCAGATCTACCTGG - Exonic
1113715493 13:112503260-112503282 TTCCATGTGGCAAATCTTCCTGG - Intronic
1115019535 14:28659494-28659516 ATGCAGGTGGTAGAGCTACTGGG - Intergenic
1119428781 14:74552296-74552318 AGGCAGGTGGCAGAACTTCCCGG + Exonic
1120749696 14:88186304-88186326 GTCCAGGTGGCAGAAGTACTAGG - Intronic
1121466986 14:94122196-94122218 ATTCAGGCTGCAGATCTACTGGG - Intergenic
1122396435 14:101435992-101436014 ATCCAGGTGGCAGTTGATCCGGG - Intergenic
1122721160 14:103723402-103723424 GTCCAGCTGGCAGCTCTGCCAGG - Intronic
1122847751 14:104510095-104510117 AGACAGGTGGCAGCTCCACCTGG + Intronic
1124389297 15:29239460-29239482 AGCCAGGTGTCAGATCTCCCAGG + Intronic
1125893446 15:43282565-43282587 ATCCTGGTGGGAGATCTTTCCGG + Exonic
1130974239 15:88760737-88760759 ATCCAAGAAGCAGATCTAGCAGG + Intergenic
1131842343 15:96450583-96450605 AGGCAGGTGGCAGTTCTAGCTGG + Intergenic
1136012306 16:27371812-27371834 AGGCAGGTGGCAGATGTCCCAGG - Intergenic
1137946225 16:52735461-52735483 ATCCAGGGGCTAGGTCTACCCGG - Intergenic
1140305921 16:73802581-73802603 ATACAGGTCGCAGCTCTGCCTGG + Intergenic
1144539248 17:16123084-16123106 ATCCAGGTGGCCGTTCCAGCAGG - Intronic
1148357395 17:46984560-46984582 CTCCGGGTGGCAGCTCTTCCTGG - Intronic
1151202585 17:72479506-72479528 ATGGAGGTGGGAGATCTCCCTGG - Intergenic
1158015465 18:52777748-52777770 ATCTAGGAGGCAGATCTCCAGGG + Intronic
1159181354 18:64909835-64909857 ATCAAGGCAGCAGATCTAGCAGG + Intergenic
1161583676 19:5093900-5093922 ACCCAGGTGGCAGACACACCAGG - Intronic
1162287537 19:9750539-9750561 ATCCAGTTGGCAGGTGTACGTGG - Intergenic
1162463578 19:10827977-10827999 AGCCAGGTGGAAGATGTAACAGG + Intronic
1164989339 19:32673354-32673376 ATCCAGGGGGCAGATCCAGGAGG - Intronic
1166121081 19:40687137-40687159 AACCAGGTGGCTGATCTCCCTGG - Intronic
1167074590 19:47240697-47240719 GTCCAGGTGGTTGATCTCCCAGG + Intergenic
1168615854 19:57836414-57836436 ATCCAGGTGGCAAATCACACTGG - Intronic
1168620928 19:57879035-57879057 ATCCAGGTGGCAAATCACACTGG + Intronic
926681697 2:15669068-15669090 GTCTGGGTGGCAGACCTACCTGG + Intergenic
930018599 2:46987218-46987240 AACCAGGTGGCCGAACTGCCTGG - Intronic
931639216 2:64367073-64367095 TTCCATGTGACAGATCTATCAGG - Intergenic
941497538 2:166224702-166224724 GTCCAGGTGGCAGGTCAAGCAGG + Intronic
946854099 2:223935920-223935942 ACCCAGGTGGGAAATGTACCAGG + Intronic
947744844 2:232502228-232502250 AGCAAGGAGGCAGATCTGCCAGG + Intergenic
1169490783 20:6069807-6069829 ATCCATGTAGCAGATCTAAATGG - Intergenic
1171033791 20:21700527-21700549 GTCCATGTGGCATATCTCCCAGG - Intergenic
1176203086 20:63872778-63872800 ATCCAGGAGGCAGAGCTTGCGGG - Intronic
1183276664 22:36902579-36902601 CTCCAGGTGGCTGAGCTAACGGG - Intergenic
1183543658 22:38444120-38444142 ATCCAGCTCTCAGATCTTCCTGG + Intronic
951335694 3:21418937-21418959 ATCCACCTGGCTGAACTACCAGG + Exonic
954226940 3:49188280-49188302 ATCCAGATGGCAGATCAAGTAGG + Intronic
956469428 3:69550771-69550793 TCCCAGGAGGCAAATCTACCCGG + Intergenic
965361255 3:167741298-167741320 ATCCTGGTGTGAGATATACCTGG - Intronic
967065444 3:185911192-185911214 ATCCAGGTGGCATGGCTTCCAGG + Intergenic
967578184 3:191122419-191122441 ATCCAGGTGGCAGAGGTTGCAGG - Intergenic
979178202 4:117691830-117691852 TTCCTGGTGGCAGATCCACAGGG + Intergenic
985579612 5:689842-689864 ATCCAGGTGGCAGATCATCTGGG + Intronic
985594458 5:781901-781923 ATCCAGGTGGCAGATCATCTGGG + Intergenic
986460227 5:7962839-7962861 TTCTAGGTGGCAGATCTCACCGG + Intergenic
997864899 5:137452887-137452909 ATCAAAGCGGCAGAGCTACCTGG + Intronic
1002634496 5:180600405-180600427 ATCCAGCAGGCAGAGCTCCCGGG - Intergenic
1003169259 6:3708252-3708274 ATCCAGGTGGGACATCTCCAAGG + Intergenic
1003483041 6:6550580-6550602 CTCCAGGTGGCGGACCTAACCGG + Intergenic
1010902348 6:81442698-81442720 ATCCTGAAGGCAGGTCTACCTGG - Intergenic
1012921619 6:105225898-105225920 AATCAGCTTGCAGATCTACCAGG - Intergenic
1017872991 6:158502418-158502440 CTCAAGGTGGCAGAGCTACCCGG - Exonic
1027423173 7:78037048-78037070 ATCCAGGTGGCAGATCTACCAGG - Intronic
1028288937 7:89041304-89041326 ATACAGGTAGCAGGCCTACCAGG - Intronic
1032453582 7:132055112-132055134 AGCCTGGTGGCAGACGTACCTGG + Intergenic
1033619714 7:143051282-143051304 ATCCAAGTGGCTGCTCTCCCAGG - Intergenic
1033670837 7:143491239-143491261 GCCCAGGTCTCAGATCTACCTGG + Intergenic
1036584150 8:10107508-10107530 ATCCAGGTGGAAGATGAAACAGG - Intronic
1040046925 8:42974315-42974337 ATCCAGGAGGCAGAGGTTCCAGG - Intronic
1042192621 8:66203119-66203141 ACCCATGTGGCAGATCCACTTGG - Intergenic
1042623776 8:70734635-70734657 CTCAAGATGGCAGCTCTACCAGG - Exonic
1045893075 8:107181296-107181318 TTCAAGGTGTCACATCTACCAGG + Intergenic
1054318379 9:63624137-63624159 ATCCAGGAGGCAGAGCTTGCAGG + Intergenic
1060269448 9:122130577-122130599 ATCCAGATGGCAGGGCTGCCAGG + Intergenic
1062558155 9:137126200-137126222 ATCTAGGTGGCAGATCAACAAGG - Intergenic
1193677139 X:84468401-84468423 ATCCAGGTCCCAAATCTAACTGG + Intronic
1197159226 X:123305078-123305100 ATCCAGGTGCTAGCTCTACTTGG - Intronic
1197574624 X:128196220-128196242 ATCCAGCTAGTAGATCTACATGG - Intergenic
1200174412 X:154102719-154102741 ACCCAGGAGGCAGAGCAACCTGG + Intergenic
1200825780 Y:7639033-7639055 ATCCAGGGGGCAGATTGGCCAGG + Intergenic
1200881637 Y:8219214-8219236 ATCCAGGGGGCAGATTGGCCAGG + Intergenic
1202105769 Y:21363359-21363381 ATCCAGGGGGCAGATTGGCCAGG + Intergenic
1202234275 Y:22692049-22692071 ATCCAGGGGGCAGATTGGCCAGG - Intergenic
1202308884 Y:23504117-23504139 ATCCAGGGGGCAGATTGGCCAGG + Intergenic
1202561917 Y:26166471-26166493 ATCCAGGGGGCAGATTGGCCAGG - Intergenic