ID: 1027423174

View in Genome Browser
Species Human (GRCh38)
Location 7:78037061-78037083
Sequence GCACAGGGGGGTTATCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423174_1027423181 -3 Left 1027423174 7:78037061-78037083 CCACCTGGATAACCCCCCTGTGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1027423181 7:78037081-78037103 TGCAAGAACCAGTGCCCCCAAGG No data
1027423174_1027423186 12 Left 1027423174 7:78037061-78037083 CCACCTGGATAACCCCCCTGTGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data
1027423174_1027423183 5 Left 1027423174 7:78037061-78037083 CCACCTGGATAACCCCCCTGTGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423174_1027423190 26 Left 1027423174 7:78037061-78037083 CCACCTGGATAACCCCCCTGTGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1027423190 7:78037110-78037132 GGTAAAAGGAGCTCTCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423174 Original CRISPR GCACAGGGGGGTTATCCAGG TGG (reversed) Intronic
900679877 1:3910894-3910916 GCCAAGGGTGGTTCTCCAGGCGG - Intergenic
901857091 1:12051563-12051585 GCCCAGGGTGGTTAACCAGCTGG + Intergenic
903089864 1:20903716-20903738 GCACAGGGGAGGTAACCAAGGGG + Intronic
903260525 1:22129425-22129447 GGACAGGAGGATGATCCAGGTGG - Intronic
913392846 1:118333718-118333740 GGACAGGGGGGATTTTCAGGAGG - Intergenic
915490113 1:156246065-156246087 GCTCAGAGGGGGTACCCAGGCGG - Exonic
920419022 1:205817726-205817748 TCCCAGGGTGGGTATCCAGGGGG - Intergenic
920548732 1:206840212-206840234 CCCCAGGAGGGTTATCTAGGAGG - Intronic
1064401782 10:15027338-15027360 GTACAAGGAGGTTATTCAGGAGG - Intergenic
1065828509 10:29593947-29593969 GCACAGTGGAGTTTTCAAGGCGG + Intronic
1069839508 10:71330362-71330384 GCACAGAGAGGTTACCCAGCTGG - Intronic
1070265940 10:74903330-74903352 GCAGAGGGAGACTATCCAGGTGG + Intronic
1070389193 10:75953892-75953914 AAAAAGGGGGATTATCCAGGTGG + Intronic
1074256660 10:111809753-111809775 GCACAAGGTGGGCATCCAGGTGG - Intergenic
1074336621 10:112582831-112582853 GCACAGTGGTGGTCTCCAGGTGG - Intronic
1076101863 10:127788052-127788074 GCACAGGGGAGACATACAGGTGG - Intergenic
1078348276 11:10570870-10570892 AGATAGGGAGGTTATCCAGGTGG - Intronic
1081622369 11:44626145-44626167 GGGCAGAGGGGTTGTCCAGGTGG + Intergenic
1083276285 11:61598888-61598910 GCACAGGTGGGTACTGCAGGGGG - Intergenic
1084797841 11:71519899-71519921 CCACAGGATGGTTCTCCAGGCGG - Intronic
1084803555 11:71563731-71563753 CCACAGGACGGTTCTCCAGGCGG - Intronic
1089302708 11:117508175-117508197 TCCCAGGGGAGTTTTCCAGGAGG - Intronic
1090083817 11:123633480-123633502 GCACAGGGGAGAAATCCAGTTGG + Exonic
1091266803 11:134277187-134277209 ACACAGGCGGGTCTTCCAGGCGG - Intronic
1096656927 12:53097823-53097845 GTGCAGGCGGGTTGTCCAGGGGG + Exonic
1099804700 12:87504103-87504125 ACATAGGGAGGTTATTCAGGTGG - Intergenic
1101730082 12:107419609-107419631 GCACAGAGGGGTTAAGCAGCTGG - Intronic
1102726188 12:115066936-115066958 GCAGAGGGGGGTTGTCAAAGGGG - Intergenic
1103488420 12:121297571-121297593 GCACAGTGCTGTTATCCAGCTGG - Exonic
1103918622 12:124388417-124388439 GCACAGGGGGTCTCTCCAAGTGG - Intronic
1104351029 12:128044120-128044142 ACATAGGGAGATTATCCAGGTGG + Intergenic
1104838881 12:131810841-131810863 GCACAGGGGCGGTGTCCTGGAGG + Intergenic
1112441112 13:99425898-99425920 GCCCAGTGGGGTTTTTCAGGGGG + Intergenic
1114348730 14:21826116-21826138 GCACCTGGAGGTTATCAAGGAGG + Intergenic
1114363648 14:22003611-22003633 GCACCGAGGGCTTCTCCAGGTGG - Intergenic
1117516509 14:56507329-56507351 AGAGAGGGGGATTATCCAGGTGG - Intronic
1119696668 14:76718870-76718892 ACACAGGGAGGTCAGCCAGGGGG + Intergenic
1120430167 14:84403356-84403378 GCAGGTGGGGGTTATACAGGTGG - Intergenic
1121602815 14:95218671-95218693 GCCCAGGGGAGTGAGCCAGGTGG - Intronic
1122407307 14:101508266-101508288 GGACAGGGAGGTGAACCAGGAGG - Intergenic
1129674976 15:77627612-77627634 GCACAGGGGGGCTGTGCAGGAGG + Intronic
1130136554 15:81186334-81186356 ACACAGGGAGTTTAACCAGGTGG + Intronic
1132666242 16:1082521-1082543 GCACAGGGGGGTTAGCTGTGGGG + Intergenic
1134889946 16:17831801-17831823 GCACAGGTGGGGTTTCCAGATGG + Intergenic
1140406750 16:74716560-74716582 GCACAGGGGGGAAGACCAGGCGG + Exonic
1142433628 16:90043763-90043785 GCCCAGTGGGATTCTCCAGGGGG + Exonic
1143517163 17:7425648-7425670 GCAGAGGGGGGTGGCCCAGGTGG + Exonic
1143863528 17:9908080-9908102 GGACAGGGGTGCGATCCAGGAGG - Intergenic
1144059296 17:11568085-11568107 GCTCAGGGTGGTTTTCCTGGAGG + Intergenic
1144328265 17:14202707-14202729 GCAGAGGGGGGTTACTCAGGTGG - Intronic
1147957172 17:44142379-44142401 GGAAAGGGGGGTTTCCCAGGAGG - Intronic
1148790788 17:50171545-50171567 GCACAAGCGGCTTATCAAGGGGG - Intronic
1151213366 17:72561049-72561071 GCTCAGGGCGGGTTTCCAGGAGG + Intergenic
1151823821 17:76512586-76512608 GCACAGGGGTGTGATCTAGGGGG - Intergenic
1152334153 17:79690766-79690788 GCACAGCAGGGCTCTCCAGGTGG - Intergenic
1152918121 17:83052336-83052358 CCACCGGGGTGTCATCCAGGAGG + Intergenic
1153491681 18:5655944-5655966 GCTCAGGGGGAATCTCCAGGAGG - Intergenic
1158787663 18:60735167-60735189 GCTCAAGGGAGTTATCCTGGAGG + Intergenic
1160529776 18:79556512-79556534 TCCCAGGGGGGTTCTCCTGGAGG - Intergenic
1160971487 19:1769651-1769673 GCACAGAGGGGGCATCCAGGCGG + Intronic
1161393600 19:4033520-4033542 GCACACGGGGCACATCCAGGTGG - Exonic
1162442185 19:10699757-10699779 GGGCAGGGGTGTTTTCCAGGCGG + Intergenic
1166015126 19:39973961-39973983 GCACATGGGAGGTGTCCAGGAGG + Intronic
1166110496 19:40619873-40619895 GCCCAGGGGGGTTTTGGAGGAGG + Intronic
1166871034 19:45871378-45871400 GTACAGTGGAGTTTTCCAGGGGG - Intronic
1167857684 19:52256061-52256083 TCAAGGGGGGGTTATTCAGGTGG - Intergenic
925306551 2:2851101-2851123 GCATAGGGGGGTTGTGAAGGCGG + Intergenic
925712187 2:6752189-6752211 ACTCAGGGGGGTTAGGCAGGAGG + Intergenic
939172825 2:138715597-138715619 GGACAGGTGGGTTTCCCAGGAGG + Intronic
939556727 2:143684249-143684271 GCACAAGGTGGTTATCAGGGTGG - Intronic
944696062 2:202201480-202201502 GCACTGGGAGGGCATCCAGGAGG + Intergenic
946071008 2:217034441-217034463 GCCCAGGGGCGTTATCCTAGTGG - Intergenic
947349051 2:229223602-229223624 GCACAGGGTGGTTAGCGATGTGG + Intronic
948346922 2:237306444-237306466 GGACAGGGGGGTTAGAGAGGAGG - Intergenic
948704145 2:239778888-239778910 GCACAGTGGAGTGAGCCAGGAGG + Intronic
1169791476 20:9414641-9414663 GCACAGAGGGTTTTCCCAGGAGG - Intronic
1174110078 20:48192986-48193008 GAGCAGGGGTGTTGTCCAGGAGG - Intergenic
1175725571 20:61316027-61316049 GCACTGAGGGGCTCTCCAGGGGG + Intronic
1175773067 20:61635801-61635823 GCACAGTGGGGAAATCCTGGGGG - Intronic
1182923031 22:34097638-34097660 GAACAGGAAGGTTAGCCAGGGGG + Intergenic
1183367494 22:37414923-37414945 GCACTGGGAGGTGCTCCAGGTGG - Intronic
1185332810 22:50259236-50259258 GAACAGAGGGGGTGTCCAGGGGG + Intronic
956189960 3:66598976-66598998 GGATAGGGTGATTATCCAGGTGG + Intergenic
962414235 3:135167946-135167968 CCACAGGGGGGTTCTTCTGGGGG + Intronic
968074424 3:195808795-195808817 GCACAGTGGGGTTTCCCAGAGGG + Intronic
969892206 4:10270197-10270219 GCACAGGGGTGTTAGCATGGTGG + Intergenic
984123109 4:175770711-175770733 GCACAGTGAGGTCATCCATGAGG - Intronic
984603948 4:181762376-181762398 GGGCAGGGGGGAAATCCAGGTGG - Intergenic
985881461 5:2641791-2641813 GCCCAGGTGGGTGGTCCAGGGGG - Intergenic
989513270 5:42313170-42313192 GCAAAAGGAGTTTATCCAGGTGG - Intergenic
990214555 5:53515608-53515630 AAACAGGGAGATTATCCAGGTGG - Intergenic
991262037 5:64677778-64677800 GCACAGGTGTGTTTTCCAGCGGG + Intergenic
993884306 5:93398117-93398139 GCACAGTGGAGTGATCTAGGAGG + Intergenic
994491118 5:100444984-100445006 GCTCAGCTGAGTTATCCAGGTGG - Intergenic
998157161 5:139793525-139793547 GGACAGGGGGCAGATCCAGGGGG + Intergenic
1004001186 6:11598635-11598657 CCACAGGGGGGTTTTGCAGTGGG + Intergenic
1007170039 6:39856380-39856402 GCAGAGGGTGGTTGTCCCGGAGG - Exonic
1012858206 6:104528016-104528038 GCAAAGGGAGGTTATGCAGGAGG + Intergenic
1013703031 6:112796753-112796775 GCACAAGGGGGTTCTCTATGAGG + Intergenic
1014672181 6:124319012-124319034 GCAGTGGTGGATTATCCAGGTGG + Intronic
1017447857 6:154524458-154524480 GAAGAGGGGGGATATCCATGAGG - Intergenic
1020040281 7:4996361-4996383 GCACAGGTGCTATATCCAGGTGG - Intronic
1023755240 7:43409984-43410006 CCAGAGGGAGGTGATCCAGGCGG + Intronic
1024790639 7:52961491-52961513 GCACAGTGGGGTTTTGCAGTAGG - Intergenic
1027423174 7:78037061-78037083 GCACAGGGGGGTTATCCAGGTGG - Intronic
1034830276 7:154302862-154302884 ACCCAGGGGTGATATCCAGGAGG - Intronic
1040462637 8:47663404-47663426 TCACAGAGGGCCTATCCAGGAGG + Intronic
1044543815 8:93436843-93436865 GGACAGTGGAGTTAGCCAGGGGG - Intergenic
1057792081 9:98131044-98131066 GCACAGAGAGGTTATCCTGCAGG + Exonic
1060204743 9:121675830-121675852 GGACAGGAGGGTGCTCCAGGTGG + Intronic
1060561551 9:124549130-124549152 GCACAGGAGGGTTATCTGGTGGG + Intronic
1061138524 9:128750651-128750673 GCGCCGGCAGGTTATCCAGGTGG - Exonic
1061881996 9:133573288-133573310 GCTCAGCGGGGTTTTCCAAGGGG + Intronic
1187499071 X:19823604-19823626 AAACAGGGAGGTGATCCAGGTGG - Intronic
1192247658 X:69387054-69387076 GCAGAGGGAGGTGATCCAAGAGG - Intergenic