ID: 1027423175

View in Genome Browser
Species Human (GRCh38)
Location 7:78037064-78037086
Sequence CTTGCACAGGGGGGTTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423175_1027423190 23 Left 1027423175 7:78037064-78037086 CCTGGATAACCCCCCTGTGCAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1027423190 7:78037110-78037132 GGTAAAAGGAGCTCTCCTAAAGG No data
1027423175_1027423186 9 Left 1027423175 7:78037064-78037086 CCTGGATAACCCCCCTGTGCAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data
1027423175_1027423181 -6 Left 1027423175 7:78037064-78037086 CCTGGATAACCCCCCTGTGCAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1027423181 7:78037081-78037103 TGCAAGAACCAGTGCCCCCAAGG No data
1027423175_1027423183 2 Left 1027423175 7:78037064-78037086 CCTGGATAACCCCCCTGTGCAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423175 Original CRISPR CTTGCACAGGGGGGTTATCC AGG (reversed) Intronic
909139432 1:71844893-71844915 CCTGCCCAGGGGGACTATCCAGG + Intronic
915675268 1:157524129-157524151 CTTTCACAGGGAGGTTCTGCAGG + Intronic
915935521 1:160088199-160088221 TTTGCACAGGGGTGTTCTACAGG - Exonic
920500132 1:206480438-206480460 CTTGGACAGGGAGGTGCTCCAGG + Exonic
922790704 1:228309358-228309380 CTTCCACAAGGGGGTTGTGCTGG + Intronic
922947530 1:229529809-229529831 CTGGCACACGGTGGTTCTCCAGG + Intronic
923665314 1:235993640-235993662 CTTACACGGGGGCGTCATCCCGG + Exonic
1063227074 10:4025670-4025692 CTTGCCCAGGAGGGCTAGCCTGG + Intergenic
1067056680 10:43056676-43056698 CTTGCACAGAGGGGGCAGCCAGG - Intergenic
1067158883 10:43806073-43806095 CTTGCACAGGTGGGTCACACTGG - Intergenic
1070389192 10:75953889-75953911 CTTAAAAAGGGGGATTATCCAGG + Intronic
1070671094 10:78377645-78377667 CTTTCACAGGCTGGTTATCTGGG + Intergenic
1071008476 10:80910824-80910846 CTTGAATAGGGAGGTTATCCTGG + Intergenic
1077473857 11:2777324-2777346 TTTGCAGAAGGGGGTGATCCTGG + Intronic
1078416684 11:11171764-11171786 CTTCCTCAGGGAGGTCATCCTGG - Intergenic
1080488318 11:32734465-32734487 CTTGCACAGGGGGATTTGGCAGG + Intronic
1080657284 11:34267783-34267805 CTTGCACACGGGGGTTTTTTGGG + Intronic
1088697455 11:112380531-112380553 CTTGGACTGAGGGGTTTTCCTGG + Intergenic
1089996529 11:122913138-122913160 CCTGCAAAGGGGGCCTATCCAGG + Intronic
1098047843 12:66420322-66420344 CTTGCCCAGAGGGGATATTCTGG + Intronic
1100331161 12:93583511-93583533 CTTGCACATTTGGGTTTTCCTGG + Intergenic
1100437782 12:94587775-94587797 TTTGCACCGTGGGGTTATGCGGG + Intronic
1100845475 12:98653974-98653996 CTTTCACAGGAGGCTTATCCTGG - Intronic
1103359541 12:120345775-120345797 CCTGCAGTGGGGGGTGATCCGGG - Intronic
1104351028 12:128044117-128044139 CTTACATAGGGAGATTATCCAGG + Intergenic
1105299272 13:19117965-19117987 GTTGCATAGGTGAGTTATCCGGG - Intergenic
1106597318 13:31156618-31156640 CTGGCACAGAGTGTTTATCCTGG - Intronic
1107505269 13:41027387-41027409 ATTGCCCAGGGGGCTCATCCTGG + Intronic
1113388108 13:109869921-109869943 CCTGCACAGGGAGGGTCTCCTGG - Intergenic
1115251643 14:31355023-31355045 CTTGCACATTGGAATTATCCAGG - Intronic
1116281935 14:42919133-42919155 CTTTCAGAGGGAGGTTATCATGG + Intergenic
1119696665 14:76718867-76718889 CTTACACAGGGAGGTCAGCCAGG + Intergenic
1120991470 14:90381224-90381246 CTGGGACAGAGGGGTTTTCCAGG + Intergenic
1121462052 14:94088141-94088163 CTTGCACAGGGGAGTCAGCTTGG - Intronic
1123720339 15:23055520-23055542 CTGGCGGAGGGGGGTTATCTTGG + Intergenic
1130870845 15:87970975-87970997 AATGCACAGTGGGGTTATTCTGG + Intronic
1141486426 16:84343279-84343301 CAGGCAGAGGTGGGTTATCCAGG + Intergenic
1142744021 17:1946139-1946161 CTGGGACAGAGGGGTTTTCCAGG + Intronic
1156498954 18:37544900-37544922 CTTGGACAGGGAGCTGATCCTGG + Intronic
1158787662 18:60735164-60735186 ATTGCTCAAGGGAGTTATCCTGG + Intergenic
1158963534 18:62605308-62605330 CTTGGGCAGGGGGTTTAACCTGG - Intergenic
1161895019 19:7073772-7073794 CTTGCCCAGGGAATTTATCCTGG - Intronic
1165636820 19:37347267-37347289 CCTGCACAGGGAGGTGATGCTGG + Exonic
925238181 2:2297375-2297397 CCTGCACAGGGGCGTAAGCCAGG + Intronic
934082710 2:88483157-88483179 CTTGCAATGGGAGATTATCCTGG - Intergenic
934654211 2:96108888-96108910 CTTGCCCAGGGGGATGGTCCTGG - Intergenic
938040155 2:128069104-128069126 CTTAGACGGGGGGATTATCCTGG + Intergenic
942619675 2:177833899-177833921 CCTGCACAGGGGGCTTACCTGGG + Intronic
946067949 2:217006267-217006289 CTAGCACAGAGGAGTTATCCAGG - Intergenic
948737878 2:240021620-240021642 CTTGCACAGTGCCCTTATCCAGG + Intronic
1175717356 20:61264005-61264027 CTTGCAACGGGAGATTATCCTGG - Intronic
950084787 3:10249391-10249413 CTTGCTCGCGGAGGTTATCCTGG + Exonic
954306285 3:49727202-49727224 CATGCACGGTGGGGTCATCCCGG + Exonic
954558113 3:51534103-51534125 CTTTCACAGGGCAGTTATCTGGG + Intergenic
961325233 3:126105529-126105551 CTTGCAGAGGGGGGTCGTGCTGG - Intronic
962280686 3:134049593-134049615 CTTCCACAAGGGGATGATCCAGG - Intronic
966278499 3:178203986-178204008 CTAGCACAGGGAGCTTAGCCTGG - Intergenic
970176694 4:13346552-13346574 CTAACGCAGGGGGATTATCCTGG + Intergenic
971125573 4:23750365-23750387 CTTGCACAGGTGGCTAATCCTGG + Intergenic
988536648 5:32074471-32074493 CTTGCAGTGGGGGCTTACCCTGG - Exonic
992542729 5:77780493-77780515 CTGGAAAAGGGGGGTCATCCAGG - Intronic
996389143 5:122941174-122941196 TCTGAAAAGGGGGGTTATCCTGG - Intronic
999911699 5:156209122-156209144 TTTGCTCATGGGTGTTATCCTGG - Intronic
1004029189 6:11849462-11849484 CTTGTTCAGGGTGGATATCCGGG - Intergenic
1006130301 6:31865067-31865089 CTGGCACAGGGTGGTCGTCCTGG - Exonic
1012986069 6:105877742-105877764 CTGGCACAGGGAGGTGATCTAGG + Intergenic
1027423175 7:78037064-78037086 CTTGCACAGGGGGGTTATCCAGG - Intronic
1028105224 7:86868733-86868755 CTTGCACTGGGGAGTTAACAGGG + Intergenic
1033500781 7:141946834-141946856 CTTGCAGATGGGGGTCTTCCTGG + Exonic
1037700825 8:21272458-21272480 CTTGGACAGGAGGGGTCTCCTGG - Intergenic
1037826116 8:22161642-22161664 CTCTCACAGGGGGCTTATCTGGG + Exonic
1044840366 8:96331973-96331995 CTTCCACATGGGAGTGATCCTGG - Intronic
1050913238 9:11100881-11100903 CTTGCACAGGGGGCTTGCCTGGG - Intergenic
1053470382 9:38342043-38342065 TTTAAACAAGGGGGTTATCCTGG - Intergenic
1055079478 9:72255044-72255066 TTTGCCCAGGAAGGTTATCCGGG + Intronic
1061294838 9:129671417-129671439 CTGGCACAGGGGGCTTAGACCGG + Intronic
1187470234 X:19563136-19563158 CTTGCACAGGGCGGTCCTGCTGG - Intronic