ID: 1027423176

View in Genome Browser
Species Human (GRCh38)
Location 7:78037073-78037095
Sequence GCACTGGTTCTTGCACAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423176_1027423191 22 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423191 7:78037118-78037140 GAGCTCTCCTAAAGGCAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 107
1027423176_1027423193 24 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423193 7:78037120-78037142 GCTCTCCTAAAGGCAAGCAGGGG No data
1027423176_1027423192 23 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423192 7:78037119-78037141 AGCTCTCCTAAAGGCAAGCAGGG No data
1027423176_1027423183 -7 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423176_1027423190 14 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423190 7:78037110-78037132 GGTAAAAGGAGCTCTCCTAAAGG No data
1027423176_1027423186 0 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423176 Original CRISPR GCACTGGTTCTTGCACAGGG GGG (reversed) Intronic
901417393 1:9127371-9127393 GAACAGGTTCTTGCAAAGAGAGG + Intronic
902557562 1:17255962-17255984 GCGCTGGTTCTTGATCAGGAGGG - Intronic
903953651 1:27010975-27010997 TCCCTTGTTCTTGCAGAGGGGGG + Intronic
906734909 1:48116036-48116058 CCATGGGTACTTGCACAGGGAGG + Intergenic
910622591 1:89273304-89273326 CCAGTGGATCTTGCACCGGGCGG + Intergenic
911271697 1:95809502-95809524 AAACTGGTTTTTCCACAGGGAGG + Intergenic
915574493 1:156766826-156766848 TCACTGGTTGCTGCAGAGGGAGG + Intronic
916426438 1:164685622-164685644 ACACTGTTGCTTGTACAGGGAGG - Intronic
916556948 1:165901432-165901454 GCACAGGTGCATGCACAGAGAGG - Intronic
916873016 1:168938091-168938113 GCACTGGTGCTGGCAGAGAGTGG - Intergenic
920624159 1:207579750-207579772 GCACTGCTTCTTGCAGAGCAGGG - Intronic
921049670 1:211502026-211502048 GCATGGGGTCTTACACAGGGAGG - Intergenic
923982313 1:239338877-239338899 GCATTGCTTCTTGGCCAGGGCGG - Intergenic
1065129458 10:22606061-22606083 GCACTGGCTCATGCTCTGGGAGG + Intronic
1067531505 10:47077495-47077517 GAATTTGTTCTTGCACAGTGTGG + Intergenic
1073754351 10:106565168-106565190 GCACTGGTTCTGGGACACAGTGG - Intergenic
1074875547 10:117610515-117610537 GCACTGGGTCTAGCAGAGGAAGG + Intergenic
1076209649 10:128629947-128629969 GCCCTGGTTCCTGGACAGAGTGG - Intergenic
1076676982 10:132152190-132152212 GCACAGGGTCTCCCACAGGGGGG - Intronic
1077231126 11:1458635-1458657 TCACTGGCGCCTGCACAGGGTGG - Intronic
1079079818 11:17406457-17406479 TCCCTGCTTCTTGCACAAGGAGG + Intronic
1081346947 11:41999614-41999636 GCGCTGGATGTTGAACAGGGAGG + Intergenic
1081891455 11:46545772-46545794 GAATTGGTTCATTCACAGGGTGG - Exonic
1083994187 11:66264095-66264117 GCCCTGGTTCTGGCACAGCAGGG - Exonic
1085156769 11:74302727-74302749 GCACAGTTCCTGGCACAGGGTGG + Intronic
1085560642 11:77470467-77470489 GCACAGGGTCTGGCACATGGTGG + Intronic
1089399813 11:118157877-118157899 GCAGTGGGTCTTGCAAAGTGAGG + Intergenic
1090809947 11:130229050-130229072 GGCCTGGGTCTTGCACAGTGGGG + Exonic
1091279735 11:134375027-134375049 GTACTGGTTCCTGCCCAGGTGGG - Exonic
1092113532 12:5981909-5981931 GCACTGGGTCTTCCGAAGGGTGG + Exonic
1094447708 12:30549661-30549683 GCATTGGTTTATACACAGGGAGG + Intergenic
1094492185 12:30967827-30967849 TCATTGGTTCTTTCACAGAGGGG - Intronic
1094849111 12:34374412-34374434 TCCCTGGTTCATGCACACGGAGG - Intergenic
1096683737 12:53274142-53274164 ACACTGGTTCTTGCCCAGCGCGG - Intronic
1103673107 12:122634477-122634499 TCACTGGTTCTTGCTCTGGGTGG + Intergenic
1107373557 13:39777946-39777968 GCACTGGGCTTTGCACAGAGTGG - Intronic
1111747747 13:92291266-92291288 CCAGTGGATCCTGCACAGGGCGG - Intronic
1113875147 13:113589596-113589618 CCTCTGGTTCCTGAACAGGGTGG + Intronic
1115091091 14:29576634-29576656 GCACTAGGTCTTGCACAGCTAGG + Exonic
1115301864 14:31893813-31893835 GCAGTGGTGCTTGGCCAGGGTGG - Intergenic
1118383999 14:65240085-65240107 GCACTTGTTCTTCCACTGTGGGG + Intergenic
1119983378 14:79107676-79107698 CCAGTGGTTCTTGGATAGGGAGG + Intronic
1120162609 14:81162028-81162050 GCACTGGTTGCTGCAAAGAGTGG - Intergenic
1120830853 14:88996204-88996226 GCACTGGTTTTATCACAGGTGGG - Intergenic
1122712881 14:103673063-103673085 GCCCTGGTTCTGGCACAGTAAGG - Exonic
1123501647 15:20890260-20890282 GTGCTGGTTCTTGCACATGCTGG - Intergenic
1123558903 15:21463959-21463981 GTGCTGGTTCTTGCACATGCTGG - Intergenic
1123595130 15:21901240-21901262 GTGCTGGTTCTTGCACATGCTGG - Intergenic
1127933327 15:63612367-63612389 GCAGTGGTTCTGGCACACGCTGG - Exonic
1127983418 15:64050536-64050558 GCACTGGTTCTTGCAGCCAGAGG + Intronic
1128211984 15:65909357-65909379 GCACTAATTCCTGCAGAGGGAGG - Intronic
1128731145 15:70022147-70022169 GCACTGCTTCTTGCAGAGCAGGG - Intergenic
1129962207 15:79697508-79697530 CCACTGGTTTCAGCACAGGGAGG - Intergenic
1130312245 15:82765834-82765856 GCACTGGGTCTGCCACAGAGTGG + Intronic
1202967249 15_KI270727v1_random:191118-191140 GTGCTGGTTCTTGCACATGCTGG - Intergenic
1136933283 16:34437083-34437105 GCACCGGTTCCTACACAAGGCGG + Intergenic
1136971289 16:34974731-34974753 GCACCGGTTCCTACACAAGGCGG - Intergenic
1138938289 16:61758000-61758022 GCACTGGTTCTGGGACCAGGTGG + Intronic
1140810071 16:78568343-78568365 GCCACGGTTCTTGCACTGGGTGG - Intronic
1142177779 16:88652814-88652836 GCACTGCTTCTGTCACAGGGGGG + Intronic
1144160055 17:12548958-12548980 GCCTTGGTTCTTTCCCAGGGAGG + Intergenic
1144685875 17:17226058-17226080 GCACTGGTCCTCTCTCAGGGCGG - Intronic
1144698905 17:17323903-17323925 GCTCTTGTTGTTGCACAGGCTGG + Intronic
1144971047 17:19110164-19110186 CCCCTGGTTCCTGTACAGGGAGG + Intergenic
1144991349 17:19236327-19236349 CCCCTGGTTCCTGTACAGGGAGG + Intronic
1145970935 17:28956114-28956136 GAACTGGGTCTTGGATAGGGTGG + Intronic
1147155960 17:38544636-38544658 GCCCTGGTTCTTGCCAAGGCTGG + Intronic
1148582081 17:48751266-48751288 GCACTGGTACCTGCAAAGGAGGG - Intergenic
1150592712 17:66577626-66577648 GCTCTGTTTCTAGCCCAGGGAGG + Intronic
1151355396 17:73555145-73555167 GCACTTGGTCTTGCCCTGGGAGG + Intronic
1151752777 17:76050388-76050410 GCCCTGGTTCTTGCTCTGGGCGG - Intronic
1153986654 18:10356986-10357008 GCATTGGTTGCTGCAGAGGGTGG - Intergenic
1155099548 18:22595757-22595779 GCAGTGGTTCATGCTCAGGCAGG + Intergenic
1155501454 18:26491169-26491191 GCACTGGTTGTTGCATTGGCGGG + Intronic
1155659603 18:28231802-28231824 GTACTGGTTCATGCACAGGAGGG + Intergenic
1157590080 18:48831205-48831227 GCACTGGTTCACTCACAGTGTGG - Intronic
1158789131 18:60754499-60754521 GGACTGGTTGTTGCACATTGTGG - Intergenic
1160564532 18:79778839-79778861 ACACTTGTTTTTGCACTGGGGGG - Intergenic
1163208986 19:15826458-15826480 GGAATGATTCTTTCACAGGGAGG - Intergenic
1163362628 19:16856885-16856907 TTAATGGTTCTTGCACATGGTGG + Intronic
1166782414 19:45349478-45349500 GCCCTGGTTCTGGCACAGCAGGG - Exonic
928773372 2:34729302-34729324 GCACTAGCTCATGCACAGTGAGG - Intergenic
928864187 2:35897126-35897148 GCACTGGTTCTTGATATGGGTGG - Intergenic
929821206 2:45275232-45275254 GCATTGCTTCTTGCTCTGGGAGG - Intergenic
929831039 2:45346468-45346490 GCACAGATTCTGGCACATGGTGG + Intergenic
930095228 2:47561510-47561532 GGACTGGACCATGCACAGGGTGG + Intronic
932400689 2:71479115-71479137 CCACTGAGTCTTGCACAGGTTGG + Intronic
933054274 2:77642616-77642638 CCAGTGGTGCATGCACAGGGTGG + Intergenic
935900169 2:107783264-107783286 GCAATGGTTCATCCACAGGTTGG + Intergenic
936135934 2:109893899-109893921 CCACTGGTCCATGCACAGCGAGG + Intergenic
936208763 2:110477586-110477608 CCACTGGTCCATGCACAGCGAGG - Intergenic
937632286 2:124116553-124116575 GCAGTGCTTCATGCACAGGTGGG - Intronic
938926955 2:136052228-136052250 GCAGAAGTTCTTTCACAGGGTGG - Intergenic
946389966 2:219409258-219409280 GCACTGGGTCATTGACAGGGGGG - Intergenic
946416197 2:219541020-219541042 GCACAGGGTCACGCACAGGGTGG + Exonic
948098363 2:235354457-235354479 GCACAGTTTCTGGCACATGGTGG - Intergenic
948352833 2:237354930-237354952 GGACTTTTTCTTCCACAGGGTGG - Exonic
948353269 2:237358092-237358114 GCAATCGTTCTTCCCCAGGGAGG + Intronic
1168891764 20:1299605-1299627 GCACTGCTCCCAGCACAGGGCGG - Intronic
1170122823 20:12928525-12928547 GCACTGCTCCTTGCAGAGGAGGG + Intergenic
1171057410 20:21920910-21920932 GCACACTTTCTTGCACAAGGTGG + Intergenic
1171362492 20:24597802-24597824 GCTCTGATTCTTGCACACCGAGG - Intronic
1172631145 20:36378983-36379005 GCTCTGGTTCTGGGACAGGGAGG + Intronic
1174588639 20:51627732-51627754 GCACTGGTCCTTCCCCAGTGAGG - Intronic
1175652059 20:60733981-60734003 GGACTGACTCTTGCACAGGAGGG + Intergenic
1175977011 20:62715926-62715948 CCTCTGGTTCGTGCACAGGTCGG - Intronic
1178493053 21:33066423-33066445 GTAGTTGTTCTTGGACAGGGAGG - Intergenic
1182013762 22:27022065-27022087 GGACTGGTCCTGGGACAGGGTGG + Intergenic
1182715862 22:32355908-32355930 GCACTGCTTCCTGCACAGCTGGG + Intronic
1184800012 22:46753346-46753368 ACACTGGTTCTTCCAAAGGAGGG - Intergenic
949564848 3:5235150-5235172 GCTCTGGTGCTTCCACAGTGTGG - Intergenic
953480535 3:43247839-43247861 GCCCTGGTTTGTGCAGAGGGTGG - Intergenic
954720305 3:52556010-52556032 TCACAGCTTCTTGCAAAGGGAGG + Intronic
956719965 3:72109042-72109064 GCACTGGTTCTAGGACAGGGTGG - Intergenic
958993077 3:100870169-100870191 GCACTGTTTTTTGCAAAGTGTGG - Intronic
959536487 3:107492214-107492236 CCACTGGTTCTTGCTCATTGTGG + Intergenic
961749585 3:129087383-129087405 CAACTGCTTCTTGCTCAGGGGGG + Intergenic
965543934 3:169896553-169896575 GCAGTGGTTCTTACCCAAGGGGG + Intergenic
967261175 3:187643990-187644012 ACACTGGTTCTTGAACAGGATGG + Intergenic
968901349 4:3433446-3433468 GCACTGGGGCTAGGACAGGGTGG - Intronic
968901387 4:3433582-3433604 GCACTGGGGCTAGGACAGGGTGG - Intronic
969158591 4:5235204-5235226 GCACTGCCTGTTGCACATGGTGG + Intronic
977679395 4:99782347-99782369 GCAGTGGCTCTTGCCCAGGCTGG - Intergenic
983413379 4:167425180-167425202 GTAGTGGTTGTTGCTCAGGGTGG - Intergenic
985700481 5:1368962-1368984 GCACTGTTCCTTGCAGAGTGGGG - Intergenic
985716802 5:1467510-1467532 GCACTGGGCCCTGCACAGAGAGG - Intronic
985721668 5:1492856-1492878 GCAGGGGTCCTTGGACAGGGGGG - Intronic
994333545 5:98537259-98537281 GCAATGTTTCTTGCACAGCAGGG - Intergenic
1001434697 5:171691064-171691086 GAACTCGTTCTTGCTGAGGGAGG + Intergenic
1003652319 6:7972611-7972633 GCGCCGTTTCTTGCACTGGGTGG - Intronic
1004377876 6:15106404-15106426 TCACTGGTTCTTGCTCCTGGTGG - Intergenic
1005449627 6:25960301-25960323 GGGCTGGTTCATGCACAGAGTGG - Intergenic
1005862776 6:29914144-29914166 GCCCTGGAACTTGCACAGGATGG + Intergenic
1007924101 6:45637445-45637467 GCACTGCTTTTTGCCCAGGTGGG - Intronic
1010828719 6:80504589-80504611 GCAGTGGTTCTTACACATGGAGG + Intergenic
1010929672 6:81786022-81786044 CTACTGCTTATTGCACAGGGCGG + Intergenic
1018977254 6:168574868-168574890 GTTCTGGTTCATGCAAAGGGCGG - Intronic
1021182258 7:17520386-17520408 GCACAGGGCCTAGCACAGGGTGG - Intergenic
1021478260 7:21087102-21087124 GCACTGGTTTTAGAACTGGGTGG - Intergenic
1027423176 7:78037073-78037095 GCACTGGTTCTTGCACAGGGGGG - Intronic
1029165732 7:98588789-98588811 GCCCTGGTACTAGCAAAGGGAGG + Intergenic
1029653490 7:101909529-101909551 GCCATGGTTCCTGCACAGGAAGG - Intronic
1032479706 7:132236513-132236535 GCACAGGGTCTTGCCCATGGTGG + Intronic
1033381694 7:140826929-140826951 GCACTTGGTCTTGTACAGTGTGG + Intronic
1034462281 7:151204545-151204567 GCAGTGGTTCTCACACAGGTCGG + Exonic
1037037559 8:14186483-14186505 GCCCTGGTTCTTTCATAGGATGG + Intronic
1041456785 8:58069292-58069314 GCACAGGGCCTGGCACAGGGTGG - Intronic
1044146731 8:88725161-88725183 GTGCTGGTTCTGGCCCAGGGTGG + Intergenic
1055316254 9:75037404-75037426 GCACTGTCCCTTGCACAGTGAGG + Intergenic
1056553851 9:87673217-87673239 GCAGTGGTTCTTGCAGAGTGTGG - Intronic
1057688369 9:97259035-97259057 GCACTGTTTCTAGCTCAGAGTGG + Intergenic
1058746551 9:107997179-107997201 GCACTGGTTCTCGCGGCGGGGGG - Intergenic
1061841285 9:133359822-133359844 GCTCTGGTTTTTGTCCAGGGCGG + Intronic
1062678476 9:137762771-137762793 GCACTGGTTGTTGGCCAGTGTGG - Exonic
1187028983 X:15466408-15466430 GCACTGGTGCTTCTGCAGGGTGG - Intronic
1189185154 X:39048658-39048680 GCAATGGATCTTGGACATGGAGG - Intergenic
1197839497 X:130730432-130730454 GCACTAGTTTTTACCCAGGGTGG + Intronic
1200866431 Y:8048548-8048570 GCCATGGCTCTGGCACAGGGTGG - Intergenic
1202254110 Y:22903063-22903085 GCTCTGGCTCTGGCACAGGCTGG + Intergenic
1202407100 Y:24536812-24536834 GCTCTGGCTCTGGCACAGGCTGG + Intergenic
1202463681 Y:25133269-25133291 GCTCTGGCTCTGGCACAGGCTGG - Intergenic