ID: 1027423177

View in Genome Browser
Species Human (GRCh38)
Location 7:78037074-78037096
Sequence GGCACTGGTTCTTGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423177_1027423183 -8 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423177_1027423186 -1 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data
1027423177_1027423192 22 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423192 7:78037119-78037141 AGCTCTCCTAAAGGCAAGCAGGG No data
1027423177_1027423190 13 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423190 7:78037110-78037132 GGTAAAAGGAGCTCTCCTAAAGG No data
1027423177_1027423193 23 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423193 7:78037120-78037142 GCTCTCCTAAAGGCAAGCAGGGG No data
1027423177_1027423191 21 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423191 7:78037118-78037140 GAGCTCTCCTAAAGGCAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423177 Original CRISPR GGCACTGGTTCTTGCACAGG GGG (reversed) Intronic
901774858 1:11553528-11553550 GGCACTGCTCCTTGCAGAGCAGG + Intergenic
902388671 1:16090306-16090328 TGCACTGGCTCTGGCTCAGGGGG - Intergenic
902518765 1:17004267-17004289 GGCACTGGTTTGGGCACAGACGG - Intronic
902557563 1:17255963-17255985 AGCGCTGGTTCTTGATCAGGAGG - Intronic
905863824 1:41366307-41366329 GGCACGGGCTCGTGCCCAGGAGG - Intronic
906679942 1:47719728-47719750 GTCTCTTGTTCTTGGACAGGTGG + Intergenic
908358437 1:63344729-63344751 GGTACTGGGTTTTCCACAGGAGG + Intergenic
910509581 1:87988678-87988700 GCCAGTGGTTCTTACCCAGGTGG + Intergenic
920624160 1:207579751-207579773 GGCACTGCTTCTTGCAGAGCAGG - Intronic
1062886373 10:1019598-1019620 GGCAATGGTTCTTAGCCAGGGGG + Exonic
1063636500 10:7787828-7787850 GGCACTGCTTCTGGCACATCTGG + Exonic
1064634334 10:17348526-17348548 GAAACTGTGTCTTGCACAGGTGG + Intronic
1068351263 10:55848553-55848575 GGTAATGGGACTTGCACAGGGGG + Intergenic
1068698246 10:59992362-59992384 GGCACTGGAGCTGGCACAGGAGG - Intergenic
1069120159 10:64559943-64559965 AGCACTGTTTCTTGCAAAGAAGG + Intergenic
1069316514 10:67110639-67110661 GTCACAGGTTCTTGCAAAGTAGG - Intronic
1070460966 10:76669745-76669767 GGCACTGGATCTTACACTGTTGG - Intergenic
1074574761 10:114658114-114658136 GGCACTGGTTCTCTCAGATGAGG + Exonic
1075473887 10:122716322-122716344 TGCACTGGTCCCTGCACAGCTGG - Intergenic
1076126248 10:127976348-127976370 GACACTCGTACTTGCAAAGGAGG + Intronic
1076362686 10:129900545-129900567 GGCACTGGGGGTTGCCCAGGAGG - Intronic
1076827888 10:132979133-132979155 GACGCTGGTGCTTGCAGAGGTGG + Intergenic
1077202651 11:1319290-1319312 AGTGCTGGTTCTTGCAGAGGTGG - Intergenic
1079732529 11:23952881-23952903 GGCACTGCTCCTTGCAGAGCAGG - Intergenic
1081616447 11:44594316-44594338 GGCTCTGGAACTTGCACAGATGG - Intronic
1083163594 11:60870336-60870358 GGCACTGCTCCTGGCTCAGGTGG - Exonic
1083994188 11:66264096-66264118 TGCCCTGGTTCTGGCACAGCAGG - Exonic
1085656065 11:78316113-78316135 GACACTGGGACTTGCACGGGGGG + Intronic
1087540159 11:99506455-99506477 GGCACTGGTACCTGGAAAGGTGG - Intronic
1088657865 11:112017942-112017964 GACACTAGTGCTTGAACAGGAGG - Intronic
1091279736 11:134375028-134375050 TGTACTGGTTCCTGCCCAGGTGG - Exonic
1094492186 12:30967828-30967850 GTCATTGGTTCTTTCACAGAGGG - Intronic
1104345394 12:127991908-127991930 GGCACTGATCCTTGCAGAGCAGG - Intergenic
1108377728 13:49828958-49828980 GGTACTGCTTCTTGCAGAGCAGG - Intergenic
1112583562 13:100697044-100697066 GGCACTGCTCCTTGCAGAGCAGG + Intergenic
1112637098 13:101227225-101227247 GGCAAAGGTTCCTGCAGAGGTGG - Intronic
1113483045 13:110635603-110635625 GGCACTGGCCCATGCACAGAGGG - Intronic
1116777433 14:49196921-49196943 GGCCATGGTTTTTGAACAGGGGG + Intergenic
1120813746 14:88831425-88831447 GGTACTGCTCCTTGCAGAGGAGG - Intronic
1120830854 14:88996205-88996227 AGCACTGGTTTTATCACAGGTGG - Intergenic
1122058542 14:99121573-99121595 GGCACAGGTTTTTGCTCTGGCGG - Intergenic
1122087485 14:99317787-99317809 GGCACTGGCTTGTGGACAGGGGG + Intergenic
1127174698 15:56341031-56341053 GGCCCTGATTTTGGCACAGGGGG + Intronic
1128731146 15:70022148-70022170 GGCACTGCTTCTTGCAGAGCAGG - Intergenic
1129421403 15:75430242-75430264 GACACTGCTTCATACACAGGAGG + Exonic
1130577434 15:85105103-85105125 GGCTCTGGTTCTTGTTCAGGTGG + Intronic
1131759115 15:95600783-95600805 GGCACTGGTGCCTGCCAAGGAGG - Intergenic
1131803378 15:96095930-96095952 GGCATTTGTTCTTGCAGAGAAGG + Intergenic
1134105729 16:11484949-11484971 GGCCCTGGTTCTGGCCCTGGGGG + Exonic
1136480598 16:30539306-30539328 GCCCCTGGTTCTTTCCCAGGAGG - Intronic
1141112395 16:81281045-81281067 GGCCCTTGTCCATGCACAGGAGG - Intronic
1142177778 16:88652813-88652835 GGCACTGCTTCTGTCACAGGGGG + Intronic
1146647888 17:34587373-34587395 GGGAATGGTTCTTGCACTTGGGG + Intronic
1146985421 17:37211971-37211993 GGCACAGGTTCTAGAACAGAGGG + Intronic
1147456621 17:40542080-40542102 GGCTCTGGGTCTCTCACAGGCGG + Intergenic
1148582082 17:48751267-48751289 GGCACTGGTACCTGCAAAGGAGG - Intergenic
1148615439 17:48997161-48997183 GGGCCAGGTTCTTGCAAAGGGGG + Intergenic
1152304135 17:79511415-79511437 GGCTCTTGGTCTTGCAGAGGAGG + Intronic
1152539877 17:80969514-80969536 GGCACTGGGGCTTCCGCAGGCGG - Intergenic
1155501453 18:26491168-26491190 CGCACTGGTTGTTGCATTGGCGG + Intronic
1155659602 18:28231801-28231823 CGTACTGGTTCATGCACAGGAGG + Intergenic
1156695594 18:39762352-39762374 GCCACTGGTTTGTGCACACGTGG + Intergenic
1156989532 18:43391756-43391778 GTCAGTGGTGATTGCACAGGTGG + Intergenic
1157183725 18:45520432-45520454 GGCACTGGGTCAGGGACAGGGGG - Intronic
1157604511 18:48917473-48917495 GCCACAGGTGCTTGCAGAGGAGG - Intergenic
1158312175 18:56170817-56170839 GGCACTGGTGCTGGCCCATGAGG - Intergenic
1158867408 18:61651176-61651198 GTCACTGTTTCCTGCTCAGGTGG + Intergenic
1160564533 18:79778840-79778862 GACACTTGTTTTTGCACTGGGGG - Intergenic
1161312166 19:3600699-3600721 GGCACTGGTTCAGGCACACCTGG + Exonic
1162299993 19:9839023-9839045 GGCAATGGATTTTGCACAGTAGG + Intronic
1163534054 19:17866875-17866897 GACCCTGGTTCTTTCTCAGGAGG + Intergenic
1163860906 19:19742443-19742465 GGCACTGCCTCTAGCCCAGGAGG + Intergenic
1166782415 19:45349479-45349501 TGCCCTGGTTCTGGCACAGCAGG - Exonic
925671455 2:6314203-6314225 GGCACTTGTTCTTGTCCAAGGGG + Intergenic
926490311 2:13517790-13517812 GGCACAGGTTTTTGCAGATGAGG - Intergenic
932811619 2:74831114-74831136 GGCACTGGTCTTTGCAGAGCAGG - Intergenic
933049191 2:77581066-77581088 GGTACTGCTTCTTGCAGAGCAGG + Intronic
937096987 2:119241964-119241986 GGCCCAGGCTCTTGCCCAGGGGG - Intronic
937632287 2:124116554-124116576 TGCAGTGCTTCATGCACAGGTGG - Intronic
943427885 2:187759165-187759187 GGAACTTTGTCTTGCACAGGTGG - Intergenic
944819617 2:203416931-203416953 AAGACTGGTTCTTCCACAGGTGG - Exonic
948859951 2:240747982-240748004 GGCACCGGCCCTTGCACTGGTGG - Intronic
1168894381 20:1313375-1313397 CGCGCTCGTCCTTGCACAGGTGG + Exonic
1170122822 20:12928524-12928546 GGCACTGCTCCTTGCAGAGGAGG + Intergenic
1170303027 20:14907303-14907325 GGCACTGCTCCTTGCAGAGCAGG - Intronic
1171175307 20:23047872-23047894 CGCCCTGCTTCTTGCGCAGGTGG + Exonic
1172265703 20:33611314-33611336 GACTCTTGTTCTTGCACTGGTGG + Exonic
1175652058 20:60733980-60734002 AGGACTGACTCTTGCACAGGAGG + Intergenic
1181365868 22:22376742-22376764 GGCACTGGTGTTAGCACATGTGG - Intergenic
1182715861 22:32355907-32355929 TGCACTGCTTCCTGCACAGCTGG + Intronic
1184800013 22:46753347-46753369 GACACTGGTTCTTCCAAAGGAGG - Intergenic
1185157272 22:49201594-49201616 GACACTAGTACTTGGACAGGTGG - Intergenic
949712268 3:6885242-6885264 GGTACTGCTTCTTGCAGAGCAGG + Intronic
953251243 3:41247231-41247253 GGCAGTGTTTCTGGCAGAGGTGG - Intronic
954289913 3:49644194-49644216 GGCCCTGCCTCTTGCACATGGGG + Intronic
957471084 3:80657918-80657940 TCCACTGCTTCTTGCAGAGGAGG - Intergenic
960237622 3:115302337-115302359 GGTAATGGTTCCTGCACAGTGGG - Intergenic
970122690 4:12774676-12774698 GGAACTGCTTCTTGAACAGCTGG - Intergenic
980572981 4:134647133-134647155 GACACTGAGTCATGCACAGGCGG + Intergenic
984669052 4:182461775-182461797 GGCACTGGTTGATGCTCAGCGGG + Intronic
985581042 5:695275-695297 GGCACAGGATCTTGCTCAGCAGG + Intergenic
985595667 5:786607-786629 GGCACAGGATCTTGCTCAGCAGG + Intergenic
986209512 5:5657468-5657490 GGCACTGCTCCTCGCACAGCAGG - Intergenic
987197740 5:15544137-15544159 GGCACTGCTCCTTGCAGAGCAGG - Intronic
989216369 5:38908280-38908302 GGCACTGGTACTGGCAGTGGTGG - Intronic
991256711 5:64622203-64622225 TGCACTGGCTCTAGCATAGGAGG - Intergenic
993065743 5:83095485-83095507 GGCACTTGTTCTGACATAGGAGG - Intronic
994333546 5:98537260-98537282 GGCAATGTTTCTTGCACAGCAGG - Intergenic
995152372 5:108864125-108864147 TTCACTGGCTCTTGCACATGAGG - Intronic
999642179 5:153682741-153682763 TGCAATGGGTCTTGCAGAGGTGG - Intronic
1002087690 5:176786000-176786022 GCCACTGAATCTTGCACCGGAGG + Intergenic
1004788587 6:18997830-18997852 GCCCCAAGTTCTTGCACAGGGGG + Intergenic
1007924102 6:45637446-45637468 CGCACTGCTTTTTGCCCAGGTGG - Intronic
1008587135 6:52960381-52960403 GTCACGGGTTCTTGGGCAGGGGG - Intergenic
1010824339 6:80454314-80454336 AGCACTGGTTCTTCCACAAAGGG + Intergenic
1011545391 6:88477315-88477337 GGCACTGCTCCTTGCAGAGCAGG + Intergenic
1014226697 6:118856471-118856493 GGCATTAGTTCTTGCAGATGCGG - Exonic
1016239151 6:141908269-141908291 GGCACTGTTCCTTGCAAAGCAGG + Intergenic
1018396272 6:163380207-163380229 GGCACTGGTGGGGGCACAGGGGG - Intergenic
1019391263 7:787879-787901 GGAACTGCTTGGTGCACAGGTGG - Intergenic
1019537075 7:1534704-1534726 GTCACTTGTTCTTGCCCAAGGGG - Intronic
1022686849 7:32605207-32605229 GGCACAGGATCTGGCACATGAGG + Intergenic
1027423177 7:78037074-78037096 GGCACTGGTTCTTGCACAGGGGG - Intronic
1029635708 7:101782339-101782361 AGCCCTGTTTCTTGCACAGTGGG + Intergenic
1030312509 7:108082674-108082696 GGCACTGGTTCTTTGACCTGTGG + Intronic
1033833619 7:145282802-145282824 GGGACTTTTTCTTGCACAGTAGG - Intergenic
1035394232 7:158524974-158524996 GGCAGTGATGCTGGCACAGGTGG - Intronic
1037459302 8:19093442-19093464 GGCCCTGGTTCCTGGAGAGGAGG - Intergenic
1040725273 8:50375316-50375338 GGCAATGGGACATGCACAGGAGG + Intronic
1041462816 8:58130636-58130658 GGCACTGTTACTAGCACTGGAGG - Intronic
1042932660 8:74029229-74029251 GACACTGGTGCTTCCCCAGGTGG - Intergenic
1044472988 8:92593405-92593427 TGCAATGGTACTTACACAGGAGG + Intergenic
1048715955 8:137270055-137270077 GGCTCTGGGTTTTTCACAGGTGG - Intergenic
1049045486 8:140148017-140148039 GGCACTGGCTCTGGCCCCGGGGG + Intronic
1049779816 8:144423776-144423798 GGCACTAGCCCTTGCACAGAAGG - Exonic
1051286405 9:15501910-15501932 GGTACTGGTCCTTGGCCAGGGGG - Intronic
1059199871 9:112404563-112404585 GGCAGTGGTTCTTGGATGGGAGG + Intronic
1061621190 9:131812358-131812380 GGCACAGATCCTGGCACAGGGGG + Intergenic
1062538324 9:137030542-137030564 GGCACTGGAGCATGCAGAGGAGG - Exonic
1062565929 9:137163982-137164004 GGCACTGGCTCTGGCTCTGGTGG + Intronic
1186604127 X:11071158-11071180 GGTACTGCTTCTTGCAGAGCAGG - Intergenic
1189309414 X:40009265-40009287 GCCACTGGCTCGTGCACAGGCGG + Intergenic
1189468857 X:41298744-41298766 AACACGGGTTCTTGCACAAGTGG - Intergenic
1190482389 X:50890072-50890094 GGCACTGGTGGTTGCAAATGGGG - Intergenic
1192045997 X:67674792-67674814 GGTACTGGTTCTGCCACAGTGGG - Intronic
1199668106 X:150118184-150118206 GACAATGGTTATTGAACAGGGGG + Intergenic
1201631122 Y:16072922-16072944 GTCACAGGTTCTTGGGCAGGGGG + Intergenic