ID: 1027423178

View in Genome Browser
Species Human (GRCh38)
Location 7:78037075-78037097
Sequence GGGCACTGGTTCTTGCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423178_1027423191 20 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423191 7:78037118-78037140 GAGCTCTCCTAAAGGCAAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 107
1027423178_1027423183 -9 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423178_1027423193 22 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423193 7:78037120-78037142 GCTCTCCTAAAGGCAAGCAGGGG No data
1027423178_1027423186 -2 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423186 7:78037096-78037118 CCCCAAGGCATCCAGGTAAAAGG No data
1027423178_1027423190 12 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423190 7:78037110-78037132 GGTAAAAGGAGCTCTCCTAAAGG No data
1027423178_1027423192 21 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423192 7:78037119-78037141 AGCTCTCCTAAAGGCAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423178 Original CRISPR GGGCACTGGTTCTTGCACAG GGG (reversed) Intronic
902378693 1:16042467-16042489 GGGCTCGGGTTCATGCAGAGCGG + Intergenic
902457449 1:16545423-16545445 GGAGACTGGTCCTTGCGCAGAGG - Intergenic
902474890 1:16677766-16677788 GGAGACTGGTCCTTGCGCAGAGG - Intergenic
902483767 1:16727849-16727871 GGGGACTGGTCCTTGCGCAGAGG + Intergenic
902494716 1:16862485-16862507 GGAGACTGGTCCTTGCGCAGAGG + Intronic
903389285 1:22953041-22953063 GGTCACTGGGTCTTGAACACCGG + Exonic
906897538 1:49792771-49792793 GGGCAATGGTTCTGGCAAAAAGG + Intronic
909486974 1:76185265-76185287 AGGCACTGGGTCTGGCACTGAGG + Intronic
915005364 1:152630289-152630311 GGGCACTGGCTCGACCACAGTGG + Intergenic
915075819 1:153307426-153307448 GGGCAGTGGTTCAGCCACAGTGG - Intronic
916537668 1:165719050-165719072 TAGCACAGGGTCTTGCACAGAGG + Intergenic
1067794263 10:49309296-49309318 GGGCACTGATCCTATCACAGGGG - Intronic
1067917668 10:50418269-50418291 GGGCCCTGGTGCTAGGACAGCGG + Intronic
1068867495 10:61909834-61909856 GGGAAGTGGTTTTTTCACAGGGG + Intronic
1069762455 10:70821512-70821534 GGGCAGTGGTTCTTGACCAGGGG + Intronic
1070977886 10:80619947-80619969 GGGCATTGCTTCTTGAACTGTGG + Intronic
1076569101 10:131420671-131420693 GGGCACTGTTCCTGGCACTGAGG - Intergenic
1078370487 11:10740705-10740727 GGGCTCTGGTTTTTGCCGAGAGG - Intergenic
1080351222 11:31387285-31387307 CCGCACTGGTTCTTGCCCAAAGG - Intronic
1080914258 11:36639356-36639378 GGGCACTGATTCCTGCTCAAAGG + Intronic
1086279676 11:85171485-85171507 GGCCACTGGGGCATGCACAGAGG + Intronic
1092550737 12:9496565-9496587 GGCCACTGCGTCTTCCACAGTGG - Intergenic
1094492187 12:30967829-30967851 TGTCATTGGTTCTTTCACAGAGG - Intronic
1094521079 12:31189803-31189825 GGCCACTGTGTCTTCCACAGTGG + Intergenic
1095384070 12:41629663-41629685 GGGCACTGGTCTTTGCACTCTGG + Intergenic
1096718850 12:53506623-53506645 GGGCAGTGGTTCTTGCCCTTGGG + Intergenic
1097169407 12:57104532-57104554 GGGCACTGAGTCTGTCACAGAGG - Exonic
1097221815 12:57455577-57455599 GGGCACTGGTGCGAGCACAGGGG + Exonic
1097354200 12:58583379-58583401 GGGGAGTTGTTCTTTCACAGTGG + Intronic
1103996693 12:124834598-124834620 GGGCAGTGGTTCTTGAAGTGTGG + Intronic
1105212295 13:18264330-18264352 GGGCACTGGGTCTGGCAGTGTGG - Intergenic
1107442392 13:40439851-40439873 GGGCCCTGGATCTTGCATGGTGG - Intergenic
1110508771 13:76323484-76323506 AGACTCTGGTTCTTTCACAGAGG + Intergenic
1113483046 13:110635604-110635626 TGGCACTGGCCCATGCACAGAGG - Intronic
1113818231 13:113190619-113190641 GGAAACTGGTTCCTGCAGAGAGG + Intronic
1116823302 14:49646622-49646644 GGGCACTTGTTCTTAACCAGTGG + Intronic
1117442498 14:55773263-55773285 CAGCACTGGTTCTAGCACATGGG + Intergenic
1121829894 14:97042159-97042181 GGGCACTGGAATTTACACAGTGG - Intergenic
1126890162 15:53196491-53196513 GGGATCTGCTTCTTGCACAATGG + Intergenic
1127174697 15:56341030-56341052 GGGCCCTGATTTTGGCACAGGGG + Intronic
1128335131 15:66780904-66780926 GGGCACTGCTGTCTGCACAGTGG - Intronic
1129269024 15:74409829-74409851 GGGCATGGGTTCTTGGAGAGTGG - Exonic
1129342543 15:74895675-74895697 GGGCAGTGGTTCTCATACAGGGG + Intronic
1129386951 15:75201682-75201704 GGGCACTGGTTCGTGGAGCGTGG + Intronic
1132205503 15:99983629-99983651 GGGCTCTGCTTCCTGCAGAGTGG + Intronic
1133787690 16:8985901-8985923 GGGCAATGGTGCTTGGACACAGG + Intergenic
1135682032 16:24465605-24465627 GGGAACTGGATTTGGCACAGGGG - Intergenic
1136065666 16:27756600-27756622 GGACACTGACTCTTGCACACAGG - Intronic
1137870286 16:51943767-51943789 GGCCACAGGTCCCTGCACAGTGG + Intergenic
1141625618 16:85259617-85259639 TGGCACTGATGCTTCCACAGGGG - Intergenic
1142177777 16:88652812-88652834 GGGCACTGCTTCTGTCACAGGGG + Intronic
1143300069 17:5902414-5902436 GGGAGCTGGGTCTTGCACACTGG + Intronic
1143561977 17:7701827-7701849 GGGCACTGCCACCTGCACAGGGG + Intronic
1143587442 17:7857352-7857374 GGGCTCTGGTTCTGGGACTGAGG - Exonic
1143988478 17:10936171-10936193 GGGCTCTGGTTCTTACAGAAAGG + Intergenic
1146485760 17:33241248-33241270 GGATATTGGTTCTTGAACAGAGG + Intronic
1146647887 17:34587372-34587394 GGGGAATGGTTCTTGCACTTGGG + Intronic
1146985420 17:37211970-37211992 AGGCACAGGTTCTAGAACAGAGG + Intronic
1148615438 17:48997160-48997182 GGGGCCAGGTTCTTGCAAAGGGG + Intergenic
1148747580 17:49927236-49927258 GGGCAATAGCTCCTGCACAGAGG - Intergenic
1152269544 17:79316015-79316037 GGGCACAGATACTTGCAAAGGGG - Intronic
1154002333 18:10492934-10492956 GGGCTCTAGTACTTGCACTGCGG - Intergenic
1154427204 18:14281181-14281203 GGGCACTGGGTGTTGGAAAGTGG + Intergenic
1157183726 18:45520433-45520455 GGGCACTGGGTCAGGGACAGGGG - Intronic
1160564534 18:79778841-79778863 GGACACTTGTTTTTGCACTGGGG - Intergenic
1161845955 19:6712185-6712207 GGGTTCTGGTGTTTGCACAGTGG - Intronic
1163419162 19:17204524-17204546 GGGCACAGGTTCCTGCAGTGTGG + Intronic
1167728323 19:51234469-51234491 GAGCACTGGTCTTTGGACAGAGG - Intronic
925158681 2:1666179-1666201 GAGCCCTGGCTCTGGCACAGAGG + Intronic
925671454 2:6314202-6314224 GGGCACTTGTTCTTGTCCAAGGG + Intergenic
925896006 2:8472805-8472827 GGGAGCTGTTTCTAGCACAGAGG - Intergenic
925919944 2:8631665-8631687 GGGGACAGGTGCGTGCACAGGGG - Intergenic
926960538 2:18353872-18353894 GGGCACTGGTTCTGGGGCACCGG - Intronic
928388932 2:30894157-30894179 GAGCACTGTTTCTTGCCCTGTGG + Intergenic
928995791 2:37289716-37289738 GGGCAGTGGTTCTTGAAGTGTGG + Intronic
929995941 2:46826264-46826286 GGGCACTGGTTCCTGAAGAGGGG - Intronic
933287849 2:80403653-80403675 GGGCACAGTTTCTTGAAAAGTGG - Intronic
934301327 2:91778071-91778093 GGGCACTGGGTCTGGCAGTGTGG + Intergenic
935852970 2:107243190-107243212 GGACAATGGTGCTAGCACAGTGG - Intergenic
937776564 2:125783896-125783918 GCTCAGTGGTTCTTGCCCAGGGG - Intergenic
939582589 2:143968129-143968151 TGGCACTTCATCTTGCACAGAGG - Intronic
939901456 2:147855267-147855289 TGGCACAGTTTCTGGCACAGAGG + Intronic
940460414 2:153957605-153957627 GTGCACTGATTCTGGCCCAGGGG + Intronic
945788167 2:214270966-214270988 GGGCACTGTTTTCTGCGCAGTGG - Intronic
1169269392 20:4187610-4187632 GGGCACGGGATCCAGCACAGAGG - Exonic
1171021474 20:21588129-21588151 GGGCAATGGTTCTCAAACAGGGG + Intergenic
1172645785 20:36468429-36468451 GGGGACTAGTGCTTACACAGTGG + Intronic
1173119691 20:40277392-40277414 TGACACTGGTTCTTGGACTGAGG - Intergenic
1175075681 20:56370756-56370778 GGGCACAGGATCTGGCCCAGGGG - Intronic
1176694754 21:9961320-9961342 GTGCAGTGGTTCTTGCAATGAGG - Intergenic
1178019953 21:28396361-28396383 GGGCACATGTCCCTGCACAGAGG + Intergenic
1178162735 21:29938664-29938686 GGGAACTGGATCTTGCTCAGTGG + Intronic
1178488657 21:33034103-33034125 GTGCACAGGCTCTCGCACAGGGG + Intergenic
1179225921 21:39453080-39453102 GGGTACTGTTTCTGGCAGAGTGG - Intronic
1180815111 22:18784648-18784670 GGGCACTGGGTCTGGCAGTGTGG - Intergenic
1181201301 22:21218985-21219007 GGGCACTGGGTCTGGCAGTGTGG - Intronic
1181700447 22:24617978-24618000 GGGCACTGGGTCTGGCAGTGTGG + Intronic
1184562308 22:45270206-45270228 GGTGACTGGTTCAGGCACAGAGG + Intergenic
1185128565 22:49025030-49025052 GAGCCCTGGCTCTTCCACAGGGG + Intergenic
1203225613 22_KI270731v1_random:76445-76467 GGGCACTGGGTCTGGCAGTGTGG + Intergenic
1203265217 22_KI270734v1_random:10339-10361 GGGCACTGGGTCTGGCAGTGTGG - Intergenic
959322840 3:104900804-104900826 GGGCCCTAGTTCATCCACAGAGG + Intergenic
960237623 3:115302338-115302360 GGGTAATGGTTCCTGCACAGTGG - Intergenic
960886888 3:122405084-122405106 GGGCACTGGTTCTCAACCAGGGG - Intronic
961444709 3:126973816-126973838 GGGCACTGGTTCTGCCCAAGAGG + Intergenic
961462126 3:127057362-127057384 GGACATTGGTTCCTGCACTGAGG - Intergenic
962986078 3:140537256-140537278 GGGAACTGGCTCTAGCACTGTGG + Intronic
966497696 3:180599856-180599878 GGGCACTGGATCTTTGACATGGG - Intergenic
969539998 4:7782320-7782342 GGTCACTGACTCCTGCACAGGGG - Intronic
975885601 4:78960986-78961008 GCACAGTGGTTTTTGCACAGTGG - Intergenic
976599882 4:86928342-86928364 GGGCAATGGCTCTGGCCCAGTGG - Intronic
980367378 4:131821537-131821559 GTGCAGTGGTTCTTGCAATGAGG - Intergenic
984669051 4:182461774-182461796 TGGCACTGGTTGATGCTCAGCGG + Intronic
984760999 4:183362881-183362903 GGGCACAGGTGCTTCCATAGTGG - Intergenic
985806191 5:2045123-2045145 GGGCAGTGCTTCTTAGACAGTGG - Intergenic
986356058 5:6927488-6927510 GGGCAGAGGTTCTTCCTCAGTGG - Intergenic
986977383 5:13409973-13409995 AGGGGCTGGTTCTGGCACAGGGG - Intergenic
987299148 5:16581267-16581289 GGGCAGTGGAGCATGCACAGGGG - Intronic
988513668 5:31887023-31887045 TGGCACTGGTTCTTGCACCCAGG - Intronic
990955066 5:61332471-61332493 GGGCTCTGGGTCTTGCCCGGCGG - Exonic
991170025 5:63614014-63614036 GGCCATTGGTTCTTGCCAAGAGG + Intergenic
994980789 5:106873920-106873942 GGGCACGTGTTCCTGCCCAGAGG - Intergenic
995096458 5:108240745-108240767 TAGCACTGGGTCTTGCCCAGGGG - Intronic
998417242 5:141955068-141955090 GGGCCCTGATTCTTTCTCAGGGG + Exonic
999644740 5:153706623-153706645 TAGCACTGGTTCTAGCACATGGG + Intronic
1004494643 6:16152361-16152383 GGGCAGTGGTTCTGGTTCAGGGG + Intergenic
1006718310 6:36134170-36134192 GGGCACTGGTTCTTTCATCTTGG - Intronic
1010824338 6:80454313-80454335 CAGCACTGGTTCTTCCACAAAGG + Intergenic
1011243604 6:85298998-85299020 GAGCAGTGGTTCATGAACAGTGG - Intergenic
1018396273 6:163380208-163380230 GGGCACTGGTGGGGGCACAGGGG - Intergenic
1018684409 6:166292522-166292544 GGGAACCGTTTCTTGCCCAGAGG - Intergenic
1019537076 7:1534705-1534727 GGTCACTTGTTCTTGCCCAAGGG - Intronic
1019710500 7:2516211-2516233 GGGCACTGCTACTGGCCCAGAGG + Intronic
1020394320 7:7696738-7696760 GGGCACTGATTCTTGCCAACTGG + Intronic
1023978965 7:45054819-45054841 GGGCACTGGGTGTTGGCCAGGGG + Intronic
1024247902 7:47484358-47484380 GGGCACTTGTTCTTTCAATGTGG + Intronic
1024996464 7:55276432-55276454 GGGCACTGGAACTCTCACAGGGG - Intergenic
1027369935 7:77497703-77497725 GTGCTCTAGTTCTTACACAGTGG - Intergenic
1027423178 7:78037075-78037097 GGGCACTGGTTCTTGCACAGGGG - Intronic
1027779385 7:82503564-82503586 GGGCACTTCTTATTGCCCAGTGG - Intergenic
1028518941 7:91707681-91707703 GGGCTCAGGCTCTTGCACAGAGG + Intronic
1029635707 7:101782338-101782360 TAGCCCTGTTTCTTGCACAGTGG + Intergenic
1035066148 7:156106258-156106280 GGGCACCGGTCCTTGCAGAAAGG + Intergenic
1035568468 8:657624-657646 GGCCACTGGATTTTGTACAGGGG + Intronic
1040552118 8:48445672-48445694 TGGCCCTGGTTCGTTCACAGTGG + Intergenic
1045051935 8:98335297-98335319 GGGCACTGTTAATTCCACAGAGG - Intergenic
1047198194 8:122740650-122740672 GGGCAGTGGGTCTTGCACAGGGG - Intergenic
1048357483 8:133665337-133665359 GGGCACTGGGCCGGGCACAGTGG + Intergenic
1049047768 8:140166173-140166195 GGGCATGCGTTATTGCACAGGGG - Intronic
1049276614 8:141723270-141723292 AGGCACTGCTTCTGGCAAAGAGG - Intergenic
1049423401 8:142526660-142526682 GGGCTCTGGGTCTTGCACTCCGG - Intronic
1051286406 9:15501911-15501933 GGGTACTGGTCCTTGGCCAGGGG - Intronic
1053631723 9:39947258-39947280 GTGCAGTGGTTCTTGCAATGAGG - Intergenic
1053774037 9:41516271-41516293 GTGCAGTGGTTCTTGCAATGAGG + Intergenic
1054212164 9:62303440-62303462 GTGCAGTGGTTCTTGCAATGAGG + Intergenic
1057315282 9:93964486-93964508 GGGCACAAGGCCTTGCACAGAGG - Intergenic
1058702254 9:107610998-107611020 GGGCTCTGGGCCATGCACAGTGG - Intergenic
1059881754 9:118698156-118698178 GTCAACTGGTTCTTGAACAGAGG + Intergenic
1061194943 9:129102509-129102531 TAGTACTGGTTCATGCACAGTGG + Exonic
1062438666 9:136558865-136558887 GGGAACTGGGTCGTGGACAGAGG + Intergenic
1185814624 X:3143541-3143563 GGGAAGTGTGTCTTGCACAGAGG + Intergenic
1190482390 X:50890073-50890095 GGGCACTGGTGGTTGCAAATGGG - Intergenic
1190835082 X:54093257-54093279 GGTCAATTTTTCTTGCACAGTGG - Intronic
1192045998 X:67674793-67674815 GGGTACTGGTTCTGCCACAGTGG - Intronic
1200699868 Y:6392901-6392923 GGGTCCTGATTCTTGCACAAAGG - Intergenic
1201034243 Y:9771797-9771819 GGGTCCTGATTCTTGCACAAAGG + Intergenic
1201285409 Y:12374946-12374968 AGCCAGTGGATCTTGCACAGGGG + Intergenic