ID: 1027423183

View in Genome Browser
Species Human (GRCh38)
Location 7:78037089-78037111
Sequence CCAGTGCCCCCAAGGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027423176_1027423183 -7 Left 1027423176 7:78037073-78037095 CCCCCCTGTGCAAGAACCAGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423173_1027423183 18 Left 1027423173 7:78037048-78037070 CCTGGTAGATCTGCCACCTGGAT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423174_1027423183 5 Left 1027423174 7:78037061-78037083 CCACCTGGATAACCCCCCTGTGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423178_1027423183 -9 Left 1027423178 7:78037075-78037097 CCCCTGTGCAAGAACCAGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 155
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423179_1027423183 -10 Left 1027423179 7:78037076-78037098 CCCTGTGCAAGAACCAGTGCCCC 0: 1
1: 0
2: 2
3: 11
4: 141
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423175_1027423183 2 Left 1027423175 7:78037064-78037086 CCTGGATAACCCCCCTGTGCAAG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data
1027423177_1027423183 -8 Left 1027423177 7:78037074-78037096 CCCCCTGTGCAAGAACCAGTGCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027423183 Original CRISPR CCAGTGCCCCCAAGGCATCC AGG Intronic
No off target data available for this crispr