ID: 1027425972

View in Genome Browser
Species Human (GRCh38)
Location 7:78061826-78061848
Sequence CCAACAGTGTTAGTTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027425966_1027425972 27 Left 1027425966 7:78061776-78061798 CCCCAGAGGAGCAATTGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG 0: 1
1: 0
2: 1
3: 3
4: 82
1027425970_1027425972 -7 Left 1027425970 7:78061810-78061832 CCAGCGAATACACTGACCAACAG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG 0: 1
1: 0
2: 1
3: 3
4: 82
1027425968_1027425972 26 Left 1027425968 7:78061777-78061799 CCCAGAGGAGCAATTGAACAGGT 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG 0: 1
1: 0
2: 1
3: 3
4: 82
1027425969_1027425972 25 Left 1027425969 7:78061778-78061800 CCAGAGGAGCAATTGAACAGGTA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG 0: 1
1: 0
2: 1
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027425972 Original CRISPR CCAACAGTGTTAGTTGTTAC AGG Intronic
908359542 1:63355512-63355534 CCAACAGTGTTATTCATTATTGG + Intergenic
911861333 1:102953279-102953301 CCAGCAGTTTGAGTAGTTACTGG + Intronic
921248293 1:213270840-213270862 TCAACATTATTAGTTGTTAGGGG + Intronic
1064528028 10:16278334-16278356 CCAACAGTTTTAATTATTATTGG + Intergenic
1064814888 10:19249478-19249500 CCAACAGTTTTAGTTGAAAGGGG + Intronic
1066453711 10:35554147-35554169 CCTGCAGTGGTAGTTGTCACAGG - Intronic
1070886825 10:79907735-79907757 CCAATAGTGGTAGTGGTGACGGG + Intergenic
1071606234 10:86993429-86993451 CCAATAGTGATAGTGGTGACGGG + Intergenic
1072571223 10:96658930-96658952 CCTACTGTGTTAGTTTTTGCAGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1088112568 11:106278627-106278649 CCAAAAGTGTTAGCTAATACAGG + Intergenic
1089945149 11:122462532-122462554 GCATCAGTGTTCGTGGTTACTGG - Intergenic
1091432819 12:451306-451328 CCACCAGTGTTAGTGTTTCCAGG + Intergenic
1092644393 12:10553507-10553529 CCAAAACTGTTACCTGTTACTGG - Intergenic
1093238296 12:16639258-16639280 CCCAAAGTGTTAGTATTTACAGG + Intergenic
1095790359 12:46160659-46160681 CCACCAGCGTTAATTCTTACTGG + Intergenic
1097670249 12:62527933-62527955 CCAACACTGTTTATTGATACTGG + Intronic
1097901001 12:64873822-64873844 TCAACATTTTTAGTTGATACTGG + Intronic
1100784511 12:98064890-98064912 TGCACAGTGTGAGTTGTTACTGG + Intergenic
1100870234 12:98903249-98903271 CCAATAGTCTGATTTGTTACTGG + Intronic
1102882475 12:116496527-116496549 CCCAAAGTGCTAGTAGTTACAGG - Intergenic
1106085912 13:26541523-26541545 CAAGCAGTGTTAGTTATTATAGG + Intergenic
1106895007 13:34290443-34290465 TCAACAGAGTAAGCTGTTACAGG - Intergenic
1108604680 13:52025765-52025787 CTCACACTGTTAGTTGTTAGGGG + Intronic
1110100649 13:71597494-71597516 CCAACAATGTTTGTCTTTACTGG - Intronic
1111508128 13:89222085-89222107 ACAACAGTGTTATTTTCTACAGG + Intergenic
1121034558 14:90689987-90690009 CCAAAAGTTTCAGTTGTTTCAGG - Intronic
1122944291 14:104998892-104998914 CCATCAGTGTTATTTGGCACAGG - Intronic
1127020591 15:54743525-54743547 TCAATCTTGTTAGTTGTTACTGG - Intergenic
1129171801 15:73812435-73812457 CAAACAGTGTTTGTTGTACCTGG - Intergenic
1138591700 16:58002738-58002760 CCACCAGTGTTAGAGGTTTCTGG - Intronic
1148561503 17:48609421-48609443 CCATCAGTATTAGTGGTTATAGG - Intronic
1156242811 18:35270001-35270023 CCCACAGTGTTAGCAGATACTGG - Intronic
1163823269 19:19508390-19508412 CCCACAGTGCTAGTTGTGCCTGG + Exonic
1163960285 19:20683488-20683510 CCAACAGTTTTAGTAGAGACGGG + Intronic
1165292635 19:34900485-34900507 CCAACAGTGTTTGAGGTTCCAGG - Intergenic
925095692 2:1198859-1198881 CCAACCTTGTTACTTGTTATTGG - Intronic
928951082 2:36813505-36813527 CCAACACTGTTGGGTGCTACAGG - Intronic
933113430 2:78434237-78434259 CCAACAGTATTATTTTTTAAAGG - Intergenic
939977119 2:148731154-148731176 CAGTCAGTGTTGGTTGTTACTGG + Intronic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
1174228358 20:49023463-49023485 CCACTAGTGTTAGTTATCACAGG + Intronic
1174669649 20:52294451-52294473 CCAACATTGTCAGTTGTTGAGGG + Intergenic
1178162232 21:29931702-29931724 CCAGGAGTGTTCATTGTTACTGG + Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1183449087 22:37881165-37881187 AGAACAGTGTTAGTTTTCACTGG + Intronic
950218259 3:11175025-11175047 CCATCAGTGTTTGGTGATACAGG + Intronic
951352230 3:21620069-21620091 CCTACAGTGTTAATTCTTACAGG - Intronic
954996261 3:54884728-54884750 CAAAGATTGCTAGTTGTTACAGG - Intronic
956035131 3:65082364-65082386 CCAACATTGATTGTTTTTACAGG + Intergenic
956874421 3:73447816-73447838 TCAACAGGGTCAGGTGTTACAGG - Intronic
957348338 3:78991032-78991054 CCAACCATGTTAATTATTACAGG + Intronic
957622262 3:82608848-82608870 TAAAGAGTGTTACTTGTTACTGG - Intergenic
963936910 3:151063215-151063237 CCAACAGTTTTATATGTTGCTGG - Intergenic
964638758 3:158885947-158885969 CCCACAGTGTTAGCTGCCACTGG - Intergenic
965778478 3:172258351-172258373 CCAGCAGTGTTCCTTATTACCGG + Intronic
968615892 4:1577648-1577670 CCAACATTGTTAATTGTTACCGG - Intergenic
971732841 4:30407390-30407412 TCACCAGTGTTAGTAGTTTCAGG - Intergenic
997893265 5:137694012-137694034 CCAACAGTCCTAGTTTTTCCAGG + Intronic
998801308 5:145872511-145872533 CCAACAGTTCTGGTTGGTACCGG + Intronic
1000789289 5:165585714-165585736 CCAGCACTGTTGGCTGTTACAGG - Intergenic
1004963796 6:20823955-20823977 CCACCAGTGGTGGTTGTGACTGG - Intronic
1018040062 6:159914080-159914102 CCAACAGTTTTAATTATTTCTGG + Exonic
1019657740 7:2205765-2205787 TCAACATTGTTAGTTATTAGGGG - Intronic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1028718806 7:94004958-94004980 CCAAGACTTTTAGTTGTTATGGG + Intergenic
1030756683 7:113294745-113294767 CCCACAGTGGTAGTGGTTGCAGG - Intergenic
1031463160 7:122076972-122076994 CCAACAGAATGAGTTGTAACAGG + Intronic
1038915822 8:32021385-32021407 CCACCAGAGTGGGTTGTTACAGG - Intronic
1041367417 8:57123237-57123259 CTAGAAGTGTTAGCTGTTACAGG - Intergenic
1045321221 8:101082983-101083005 CCAACAGTGTATCTTGGTACGGG - Intergenic
1045982404 8:108206154-108206176 CCAACCGTGTTAGATGCTACTGG + Intronic
1046790052 8:118311882-118311904 CCAACAGTGTCAATTATTGCTGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1051219107 9:14830080-14830102 CTAACAGTGTAAGTAGTTCCTGG + Intronic
1052008072 9:23374489-23374511 CCAACATGGTCAGTTGTTAAGGG + Intergenic
1056179928 9:84072832-84072854 CCAACAGTGTGATTTATGACTGG + Intergenic
1186824376 X:13324037-13324059 CCAACAGTGGTAGTTGATGTGGG + Intergenic
1187215619 X:17273151-17273173 ACCACAGTAATAGTTGTTACCGG - Intergenic
1188106285 X:26151571-26151593 CCAAAAGTGTTACCTGTAACAGG + Intergenic
1188647394 X:32587412-32587434 CCAACAGTGATAATTTTTAAAGG - Intronic
1191684802 X:63879071-63879093 CCAGCAGTGTTGTTGGTTACAGG - Intergenic
1192286008 X:69736719-69736741 CCAGCAGTTTTAGTTGTATCAGG + Intronic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1194807284 X:98344950-98344972 CCAACAGTGTCAGTGGCTGCAGG + Intergenic
1195418696 X:104648705-104648727 TCAAAAGTGTTATGTGTTACAGG - Intronic
1195722680 X:107881296-107881318 TCAACAGTCTTATTTGTAACAGG - Intronic