ID: 1027428074

View in Genome Browser
Species Human (GRCh38)
Location 7:78082066-78082088
Sequence AAGTAACCACAAGGCGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027428074_1027428082 26 Left 1027428074 7:78082066-78082088 CCACTGCCGCCTTGTGGTTACTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1027428082 7:78082115-78082137 AAAACCATGTGGAGGGCAAAAGG No data
1027428074_1027428080 19 Left 1027428074 7:78082066-78082088 CCACTGCCGCCTTGTGGTTACTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1027428080 7:78082108-78082130 TTAACCAAAAACCATGTGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1027428074_1027428083 27 Left 1027428074 7:78082066-78082088 CCACTGCCGCCTTGTGGTTACTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1027428083 7:78082116-78082138 AAACCATGTGGAGGGCAAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 262
1027428074_1027428078 15 Left 1027428074 7:78082066-78082088 CCACTGCCGCCTTGTGGTTACTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1027428078 7:78082104-78082126 CATTTTAACCAAAAACCATGTGG No data
1027428074_1027428079 18 Left 1027428074 7:78082066-78082088 CCACTGCCGCCTTGTGGTTACTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1027428079 7:78082107-78082129 TTTAACCAAAAACCATGTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027428074 Original CRISPR AAGTAACCACAAGGCGGCAG TGG (reversed) Intronic
901007396 1:6178752-6178774 AAGCAAACAGAAGGGGGCAGGGG + Intronic
901337319 1:8462365-8462387 AAGTCAGCACGAGGAGGCAGAGG + Intronic
904916702 1:33975657-33975679 AAGGAACCACCAGGGGGGAGGGG + Intronic
909064638 1:70920285-70920307 AAGTAACCACAAGTCTGGAAGGG - Intronic
911176279 1:94820722-94820744 AGGTAAGCACTTGGCGGCAGGGG + Intronic
916450129 1:164912732-164912754 AAGTAACCCCACGGCTGCAGGGG + Intergenic
916525045 1:165601792-165601814 AAGTGGCCACAAGGTGGCATAGG + Intergenic
916678036 1:167080767-167080789 AAGAAAACACAGGGCAGCAGAGG - Intronic
921043050 1:211452664-211452686 AAAGAACCAGAAGGTGGCAGGGG + Intergenic
921900758 1:220448234-220448256 AAGAAACCAGAATGCTGCAGAGG - Intergenic
923659507 1:235946049-235946071 AAGAAACCACACGGAGGCTGAGG + Intergenic
923939869 1:238809772-238809794 AAGGAACCACTTGGAGGCAGAGG + Intergenic
924352234 1:243127138-243127160 GAGTAACCTCAAGGCTGGAGAGG + Intronic
1065608474 10:27446227-27446249 AACTAACCACAAGATGGCATCGG + Intergenic
1066457549 10:35585211-35585233 AAGGACCCAGAAGGCGGCAGCGG - Intergenic
1070647283 10:78210751-78210773 GATTAACCACAAGGCCCCAGGGG - Intergenic
1072933363 10:99687775-99687797 AAGGAACCAGAAAGTGGCAGAGG - Intronic
1074438851 10:113457336-113457358 AACTAACCACAAGGCTACACAGG - Intergenic
1077992191 11:7422163-7422185 AAGTGAACACAGGGCGGCTGTGG + Intronic
1080860993 11:36150062-36150084 AACTATCCACCAGGCTGCAGGGG + Intronic
1084451373 11:69240876-69240898 AGATCACCACAAGGGGGCAGAGG - Intergenic
1084759137 11:71257312-71257334 AAGGAACCTCAAGGCGGGAGAGG + Intergenic
1084909571 11:72377305-72377327 AAGTAAGAACATGACGGCAGGGG + Intronic
1088532183 11:110822307-110822329 AAGAAACCAAAAGGAGGCATGGG + Intergenic
1090297894 11:125606011-125606033 CAGCAACCACAAGGGAGCAGGGG + Intronic
1093022741 12:14218505-14218527 AAGGAACCAAAAGGCGCCAATGG + Intergenic
1093659753 12:21741929-21741951 TAGTAACCAAAAGGAAGCAGAGG - Intronic
1094575587 12:31682296-31682318 ATGTGACCACAAGGTGGCAGTGG + Intronic
1113750254 13:112772009-112772031 AAGTGACTGCGAGGCGGCAGCGG + Intronic
1116985900 14:51220035-51220057 AAGGAGCCACTAGGTGGCAGAGG - Intergenic
1120444730 14:84579603-84579625 AAGTCACAACAAGATGGCAGAGG + Intergenic
1121876714 14:97459418-97459440 AGGTGACCACAAGGCCACAGAGG + Intergenic
1123629848 15:22254063-22254085 AAATAACCACAAAGAGGCAAGGG - Intergenic
1124456051 15:29843902-29843924 CAGTAACCACAAGGTGGGAGAGG + Intronic
1131249001 15:90818817-90818839 CAGCAACCACTAGGAGGCAGGGG + Intergenic
1133747751 16:8700209-8700231 AAGTAACCACAAGCTGTGAGAGG - Intronic
1134277974 16:12793346-12793368 AAGTCACCAGAAGGCTGGAGCGG + Intronic
1137644179 16:50059891-50059913 CAGTAACCACGAGGAGGGAGTGG + Intergenic
1141942487 16:87286893-87286915 AACTAAACACAAGGAGGAAGGGG + Intronic
1142317816 16:89359945-89359967 AAGTAAACACATGTCGGCAGTGG + Intronic
1142819451 17:2453623-2453645 AAGTAACCTAAAGGGGGAAGGGG + Intronic
1143874658 17:9982354-9982376 AAGTCACCACCAGGTGGCAGAGG - Intronic
1149130772 17:53298603-53298625 AAGTAACCAAAAGAGAGCAGGGG + Intergenic
1151482950 17:74380825-74380847 AGGTAACCACTAGGCGGGACTGG + Intergenic
1152357872 17:79815356-79815378 AAGCAACCCCAGGGCGGCACGGG - Intergenic
1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG + Intronic
1158413784 18:57231603-57231625 AAATAACCCCAAGGCTCCAGGGG - Intergenic
1163053611 19:14702815-14702837 AACTTACAACATGGCGGCAGGGG + Intronic
1163996701 19:21055994-21056016 AAGAAACCAAAAGTTGGCAGTGG + Intronic
926158170 2:10469536-10469558 AAGTACCCAGAAGTCTGCAGCGG + Intergenic
927899829 2:26811375-26811397 GAGTAACCACAAGGCAGAACTGG + Intergenic
928456868 2:31430285-31430307 AGGAAACCACAAGGCCACAGAGG - Intergenic
930326207 2:49922130-49922152 AAGGATGCACAGGGCGGCAGCGG + Exonic
933255253 2:80073229-80073251 ATATGACCACAAGGTGGCAGTGG + Intronic
935529934 2:104219904-104219926 ACGTAACCACAAAGCAGCTGTGG + Intergenic
936464814 2:112738127-112738149 AAGTAACAAAAGGGGGGCAGGGG - Exonic
939271179 2:139941923-139941945 AAGTAACCACAAAGTGGCATAGG + Intergenic
943051832 2:182922568-182922590 AAGGAACCACAAGTGGGCTGAGG - Intronic
943844678 2:192630100-192630122 CAGTAACCAAAAGACAGCAGGGG - Intergenic
947474089 2:230427066-230427088 AAGTGACCAAAAGACAGCAGAGG - Intronic
947871907 2:233443914-233443936 AAGAAACCCCGAGGCGGCAGGGG - Intronic
1169765867 20:9147398-9147420 AAGCAACCACAAAACTGCAGTGG + Intronic
1170138730 20:13103930-13103952 AAGAAAGCACAAGGCAGCAAGGG - Intronic
1178090677 21:29159941-29159963 GAGTCATGACAAGGCGGCAGGGG - Exonic
1181272407 22:21666873-21666895 GAGAAACAACACGGCGGCAGCGG - Intronic
1182247242 22:28968896-28968918 AAGTAAACACAAGGCTGTTGGGG - Intronic
1184384620 22:44167127-44167149 AGGTCCCCACAAGGGGGCAGGGG - Intronic
949965589 3:9353344-9353366 GAGGAACCACTAGGTGGCAGGGG + Intronic
952904353 3:38129783-38129805 AAGTAACCACAGGCCGGCTGTGG + Intronic
955179454 3:56653472-56653494 AAGTAGCCAGGGGGCGGCAGGGG + Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958591730 3:96167871-96167893 AAGTAACCTCAAAACAGCAGTGG + Intergenic
961088906 3:124093075-124093097 AAGAAACCACAAGGCAGTTGGGG + Intronic
963848378 3:150182450-150182472 GAGGAACCACAAGGTGGAAGGGG + Intergenic
967378541 3:188832070-188832092 ATGTAAACACCAGGAGGCAGGGG - Intronic
970531226 4:16987478-16987500 AAAAAACCCCAAGGAGGCAGAGG - Intergenic
972665893 4:41165339-41165361 AACTACCCACAAGGAGTCAGAGG + Intronic
975782902 4:77858442-77858464 AAGTAAGCACAAGGGGGAAAGGG + Intergenic
977080570 4:92522268-92522290 AAGGAACAATAAGGAGGCAGGGG + Intronic
979249710 4:118553386-118553408 GAGTAACCTCAAGGCTGGAGAGG - Intergenic
983631563 4:169854446-169854468 CAGTAATGAGAAGGCGGCAGGGG + Intergenic
987503621 5:18744013-18744035 AAGTAACCAAAAGGCGCCAATGG - Intergenic
995247426 5:109950386-109950408 AGGTAACCAAGAGGTGGCAGAGG + Intergenic
995773100 5:115693698-115693720 AAGTAACCAGAAGAGAGCAGAGG - Intergenic
998083007 5:139292588-139292610 AATTCACCAAAAGGCGGCGGTGG + Intronic
999229251 5:150052108-150052130 GAGCAACCCCAAGGCGGTAGAGG - Exonic
1000073369 5:157762154-157762176 CAGTTACCACTAGGTGGCAGTGG + Intergenic
1003512487 6:6792931-6792953 AAGAAACCACATGGCCCCAGAGG - Intergenic
1007597127 6:43058164-43058186 AAGTAAGAACTGGGCGGCAGGGG + Exonic
1009828628 6:68900412-68900434 AAGTAGCCACAAGGAGGCCTGGG + Intronic
1010280287 6:74015455-74015477 AAGTGAGCCCAAGGAGGCAGTGG + Intergenic
1012986418 6:105881027-105881049 AGGTGAACACAAGGCGGCAGGGG + Intergenic
1015448827 6:133340646-133340668 AAGAAGCCAAGAGGCGGCAGAGG + Intronic
1016761858 6:147746702-147746724 AAGGAACCAAAAGTGGGCAGAGG + Intergenic
1021385210 7:20020799-20020821 AAGTAAACAAAGGGTGGCAGGGG + Intergenic
1027167790 7:75847920-75847942 AAGAATCCAGAAGGCAGCAGAGG + Intronic
1027428074 7:78082066-78082088 AAGTAACCACAAGGCGGCAGTGG - Intronic
1027467428 7:78533369-78533391 AAGTAAGGACAAGGAGGCACTGG + Intronic
1033385877 7:140874607-140874629 ACGTAACCCCATGGTGGCAGCGG + Intronic
1034086118 7:148324245-148324267 AAGAACCCACAAAGTGGCAGAGG + Intronic
1038543560 8:28408778-28408800 AAGCAACCAAAAGGCAGCATGGG + Intronic
1039547029 8:38417736-38417758 AGGTAACCCCAAGCAGGCAGCGG + Intronic
1046434620 8:114170984-114171006 CAGTCACCCCAAGGTGGCAGTGG - Intergenic
1057246227 9:93456679-93456701 TAGTAACCTCAAGACGGAAGTGG + Intronic
1057786404 9:98090980-98091002 AAGTAACCATCAGGAGACAGAGG - Intronic
1186747121 X:12581713-12581735 AAGGAATCACAAGCAGGCAGTGG - Intronic
1188189428 X:27156680-27156702 AAGCAACCACAAAGCAGTAGTGG + Intergenic
1189272925 X:39764470-39764492 AAGCAAACAGAAGGCGGAAGAGG - Intergenic
1192340975 X:70263163-70263185 AAATAGCCACTGGGCGGCAGTGG - Intergenic
1192825891 X:74695897-74695919 CAGGAACCACAAGGGGTCAGGGG + Intergenic
1193706573 X:84827337-84827359 TAGTAACCAAAAGACAGCAGGGG - Intergenic
1197295180 X:124710228-124710250 AAGTAACCACAGGGCAGGAGTGG - Intronic
1197678810 X:129360394-129360416 ATATGACCACAAGGTGGCAGTGG - Intergenic
1201334973 Y:12870916-12870938 AAGTTACCACAACTAGGCAGAGG + Intergenic