ID: 1027429455

View in Genome Browser
Species Human (GRCh38)
Location 7:78095325-78095347
Sequence TGGAATATCCATAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027429455_1027429462 0 Left 1027429455 7:78095325-78095347 CCTTCCCCACTATGGATATTCCA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1027429462 7:78095348-78095370 AACTACAGCCTCTTCAGTAGGGG 0: 1
1: 0
2: 0
3: 14
4: 195
1027429455_1027429460 -2 Left 1027429455 7:78095325-78095347 CCTTCCCCACTATGGATATTCCA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1027429460 7:78095346-78095368 CAAACTACAGCCTCTTCAGTAGG No data
1027429455_1027429464 29 Left 1027429455 7:78095325-78095347 CCTTCCCCACTATGGATATTCCA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1027429464 7:78095377-78095399 TAGTTAGCAAATGCCCCAACAGG No data
1027429455_1027429461 -1 Left 1027429455 7:78095325-78095347 CCTTCCCCACTATGGATATTCCA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1027429461 7:78095347-78095369 AAACTACAGCCTCTTCAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027429455 Original CRISPR TGGAATATCCATAGTGGGGA AGG (reversed) Intronic
900598252 1:3492278-3492300 TGGACCATCCACAGTGTGGATGG - Intronic
902280147 1:15368325-15368347 TGGGAAATCAATAGTGGGCAAGG - Intronic
905664611 1:39755452-39755474 TGGAAGCTCCATAGGGGTGAGGG - Intronic
906309171 1:44740721-44740743 TAGAATATCCACAGTGAGGTGGG - Intronic
906346474 1:45018597-45018619 TGAACTCTCCATAGTGGCGAGGG + Exonic
907936599 1:59047287-59047309 TGGATTGTATATAGTGGGGAAGG + Intergenic
908573748 1:65437718-65437740 TGGAAAAAATATAGTGGGGAAGG + Intronic
908954893 1:69612596-69612618 GGGAATACCCATAATGGTGAAGG + Intronic
910843985 1:91587857-91587879 TGGAATACCTACAGTGGAGAAGG - Intergenic
911691429 1:100839025-100839047 TTGAATATCCATATTTGGTAAGG - Intergenic
914464381 1:147913077-147913099 TGGAATACCCAGAGTCAGGAGGG - Intergenic
914750096 1:150529171-150529193 TGGAATGACCATTGTGGGAACGG + Intergenic
916189389 1:162164446-162164468 TGGGGTATACATAGTGGTGATGG - Intronic
916294245 1:163199512-163199534 TGGAATATATATAATGGGTAAGG - Intronic
916865781 1:168856641-168856663 TGTGATTTCAATAGTGGGGAAGG + Intergenic
917361695 1:174183542-174183564 ATGAATGTCGATAGTGGGGAAGG - Intronic
919821420 1:201475288-201475310 TGGAATGTCCAGGATGGGGATGG + Intergenic
921628885 1:217409776-217409798 GGGTATAACCAGAGTGGGGATGG - Intergenic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1065889960 10:30112579-30112601 TGAAATATCCAGACTGGGCACGG + Intronic
1066404977 10:35109876-35109898 TAAAATATCCATAGTGGGCCAGG + Intergenic
1068956792 10:62825666-62825688 AGGAATTTGCACAGTGGGGAAGG - Intronic
1070371930 10:75790862-75790884 TGCAATATCCTCTGTGGGGAAGG + Intronic
1071234840 10:83633202-83633224 TGGAATAGACATAGTAGGGAGGG + Intergenic
1071562719 10:86656186-86656208 TGGAACATCAACCGTGGGGAGGG - Exonic
1072373100 10:94785933-94785955 TGGCATTTACATAGTGGGCAGGG - Intronic
1074212861 10:111353669-111353691 TGAAATAGCCATGGTGGGAAGGG + Intergenic
1076231523 10:128823508-128823530 GGAAGTATCCATGGTGGGGAAGG + Intergenic
1079673176 11:23193371-23193393 TTGATTATCCATCGTGGGCAGGG - Intergenic
1079953477 11:26833488-26833510 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1080060686 11:27953628-27953650 AGGAAAATCCTTAGAGGGGAAGG - Intergenic
1080332282 11:31153405-31153427 GGGAATTCCCAGAGTGGGGAAGG - Intronic
1081765652 11:45608311-45608333 TGGTCTGGCCATAGTGGGGAGGG - Intergenic
1082616737 11:55370623-55370645 TGGAATATCCAAAGTGTAGGTGG - Intergenic
1083481785 11:62953166-62953188 TAGAAAATCCATAGTGCTGAAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085879367 11:80447621-80447643 TGGAATATGAATTGTGAGGAAGG - Intergenic
1086444960 11:86861826-86861848 TGTAATATCCAGAGTGGGAGAGG + Intronic
1089269395 11:117291152-117291174 TGAAATATCTAAAGTGGGGAGGG + Intronic
1093296418 12:17397423-17397445 TGGGATGTCGATAGTGGGGGAGG + Intergenic
1094311172 12:29085656-29085678 TGGAATGTTCATAGTTGGGGAGG + Intergenic
1097676511 12:62608412-62608434 TGGAATATCAATAGTGGTTTTGG - Intergenic
1097765237 12:63518847-63518869 TGGGATATTTATAGTGGGGCAGG - Intergenic
1098240746 12:68464338-68464360 TGGAATTTCCTGAGTGAGGAGGG - Intergenic
1101894982 12:108749562-108749584 TGGATGATCCATATTGGAGAAGG + Intergenic
1102764239 12:115417820-115417842 TGATATCTCCCTAGTGGGGATGG - Intergenic
1102902926 12:116652601-116652623 TGAAATGTCCACAGAGGGGATGG + Intergenic
1103152009 12:118648942-118648964 TCAAATATCCATGGTGAGGAGGG + Intergenic
1105667133 13:22572659-22572681 TGGAATATTGATAGTAGGGGAGG + Intergenic
1109413761 13:62008755-62008777 GGGAATATTGATAATGGGGATGG - Intergenic
1109818501 13:67619984-67620006 TGGAATATCTATAATTGAGAGGG + Intergenic
1111797463 13:92941113-92941135 GTGAACATCCTTAGTGGGGAGGG - Intergenic
1115508573 14:34117181-34117203 TTGAATATCCTTATTGGGTAGGG + Intronic
1116765102 14:49060714-49060736 AAGACTATCCATAATGGGGAGGG + Intergenic
1118357982 14:65031170-65031192 TGAAAAAACCATAGAGGGGAAGG + Intronic
1119593592 14:75913282-75913304 AGGAATAGGCATATTGGGGAGGG - Intronic
1119770296 14:77216498-77216520 TGGAACATGCTAAGTGGGGACGG - Intronic
1120365810 14:83567222-83567244 TGGAATATCAACATTGGAGAAGG - Intergenic
1120751842 14:88204822-88204844 TGGGATGTTGATAGTGGGGAAGG - Intronic
1121150536 14:91629582-91629604 TGGGATGTGGATAGTGGGGAAGG + Intronic
1124655525 15:31503906-31503928 GATAATATCCAGAGTGGGGAGGG - Intronic
1129092261 15:73163842-73163864 TGTACTATCTGTAGTGGGGAGGG - Intronic
1131648605 15:94374658-94374680 TGGAACATCCTTTATGGGGAAGG - Intronic
1139823318 16:69737861-69737883 TGTAATAGCCATAGTGGTGGCGG - Intergenic
1146627709 17:34446784-34446806 AGGAATACTCAAAGTGGGGAAGG - Intergenic
1150776326 17:68084538-68084560 TGGAAAATGTGTAGTGGGGATGG - Intergenic
1153248421 18:3096108-3096130 TTGAATGTCCACAGTGGGCACGG + Intronic
1154944425 18:21147661-21147683 TGGAATGTTGATAGTGGGGGAGG - Intergenic
1155208534 18:23581279-23581301 TGGAAGAGCCACACTGGGGACGG + Intronic
1157226877 18:45874220-45874242 TGGAATGTCCAGAGTGGGGAAGG + Intronic
1157746906 18:50143922-50143944 TGGAATATCCATTTTCTGGAGGG + Intronic
1157883377 18:51342958-51342980 TGGAATCTCCAAAGTGGGTGGGG + Intergenic
1158642323 18:59214154-59214176 TGGATTAGCCAGGGTGGGGAAGG + Intergenic
1158875395 18:61729446-61729468 TGGTTTTTCCATGGTGGGGAGGG - Intergenic
1159110017 18:64044537-64044559 TGAAATAGCCAATGTGGGGAGGG + Intergenic
1159944598 18:74434913-74434935 TGGAAGATCCCCAGTGGTGATGG + Exonic
1160721809 19:600866-600888 TGGACTATGGATAGTGGTGACGG - Intronic
1168232219 19:55040089-55040111 TGGGGGATCCATAGTGGTGATGG + Intronic
926204728 2:10828037-10828059 TGGGATGTTGATAGTGGGGAAGG - Intronic
926818288 2:16823292-16823314 TGGAGTTTATATAGTGGGGAAGG + Intergenic
927802276 2:26112109-26112131 TGGCGTATCCAGAGAGGGGATGG - Intronic
927815926 2:26217358-26217380 TGGAATCTCCAAAAAGGGGAGGG + Intronic
929114012 2:38429140-38429162 GGGAATAGCCAGGGTGGGGATGG + Intergenic
930923507 2:56787306-56787328 TGGAATCTCCATAGGTGGGGGGG + Intergenic
931319073 2:61158661-61158683 AGGGATTTACATAGTGGGGAAGG + Intronic
933469620 2:82705002-82705024 TGGAATATTCACACTGGGGAAGG + Intergenic
937713011 2:124999181-124999203 TGGAATATCTGTTGTAGGGATGG + Intergenic
938992678 2:136645405-136645427 GCAAAAATCCATAGTGGGGAGGG - Intergenic
943821826 2:192333221-192333243 TGGATTCTCCTTAGTGGGCAGGG + Intergenic
944199679 2:197092581-197092603 TGGAATCTCCATATAGGGAAAGG - Intronic
945160621 2:206886495-206886517 GGGAAGATCTATACTGGGGAGGG + Intergenic
945242602 2:207689807-207689829 TAGAATATCAATAGTGTGGCCGG - Intergenic
945674131 2:212834348-212834370 TGGGATATTGATAGTGGGGGAGG - Intergenic
946916462 2:224528014-224528036 TGGATTATCTATAGTTGTGAGGG - Intronic
947772702 2:232683412-232683434 TGGATTATACATAGGAGGGAGGG - Intergenic
948409717 2:237749710-237749732 GGGAACATACTTAGTGGGGAGGG - Intronic
1171895059 20:30750900-30750922 TCTAATATCCATATTGGGGGAGG + Intergenic
1174079247 20:47959311-47959333 TGAAATATCTATAGTGGGCCGGG - Intergenic
1177585579 21:23090104-23090126 TGGCATATCCACAATGGAGATGG - Intergenic
1179247057 21:39643088-39643110 TGGGATAGACACAGTGGGGAGGG + Intronic
1179489711 21:41733459-41733481 AGGCATATCCAGAGTGGGGCTGG - Intergenic
1181462836 22:23095463-23095485 TGGAGTGTCACTAGTGGGGAGGG + Exonic
1184730527 22:46368866-46368888 TGGAATCCCCAGAGTGGAGATGG - Intronic
949902424 3:8827967-8827989 TGGAACATCCATAGTGCAGATGG + Intronic
951745097 3:25969678-25969700 TGGAATATCTATTCTGGTGATGG + Intergenic
952285984 3:31970234-31970256 TGGAATTTTCCTTGTGGGGAGGG - Intronic
953378679 3:42449935-42449957 TGGCTTTTCCATAGAGGGGAGGG - Intergenic
956555522 3:70518357-70518379 TGGAATATCTATACTGAGGCAGG + Intergenic
957974043 3:87420357-87420379 TGGAATGTTCACAGTGGGCAAGG + Intergenic
959442123 3:106390095-106390117 TGGAATGTCCAGAGTGGCCAGGG + Intergenic
960080385 3:113534192-113534214 TGGAATTTCCCTAGAGGGTAGGG - Intronic
960600540 3:119453661-119453683 TGGAAGAAGCATATTGGGGATGG + Intronic
961346288 3:126265542-126265564 TGAAAGACCCAAAGTGGGGAGGG - Intergenic
961379271 3:126486754-126486776 TGGAGTAGCCACGGTGGGGATGG + Intronic
962051394 3:131819431-131819453 TGTAAAATGCATACTGGGGAAGG - Intronic
962248848 3:133822386-133822408 TGGAATCTCCCTAGTGGGTATGG + Intronic
963140178 3:141940453-141940475 TGGAAAATGCACAGTGGTGAAGG - Intergenic
966058636 3:175728440-175728462 TGCAGTATCCATAGAGGAGAGGG - Intronic
966227201 3:177610597-177610619 TGGAATTTCCTTGGTGGAGAGGG + Intergenic
966365818 3:179186137-179186159 TGGAATCTCCAAAGTGGTAAGGG - Intronic
970743999 4:19273399-19273421 TGGGCTATCCACAGTGTGGAGGG - Intergenic
973256821 4:48122005-48122027 TGGCTTATCCATGGTGGTGATGG - Intronic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
978411322 4:108429227-108429249 TGGAATATGCATAGAAGAGAAGG - Intergenic
978702862 4:111670268-111670290 TGGAAGCTCCAGAGTGGGAAAGG + Intergenic
980618701 4:135268628-135268650 GGAAATAACCATAGTGGGGGGGG + Intergenic
983624556 4:169789762-169789784 TGTAATATCCATGGGGGGAAAGG - Intergenic
983938912 4:173522101-173522123 TGGAAAATTTAGAGTGGGGAGGG + Intergenic
988149072 5:27352378-27352400 TGGAATAGTAATAGTGGGGTTGG + Intergenic
991683985 5:69165374-69165396 TGGGGTGTCAATAGTGGGGAAGG + Intergenic
996431912 5:123390235-123390257 AGGAATATCCAAACTGGGAAAGG - Intronic
996598623 5:125234496-125234518 TGGAGTAACCATGGTGGGAAAGG - Intergenic
997682697 5:135767209-135767231 TGTAATATCCAAAGTGGGAGAGG + Intergenic
997683175 5:135770451-135770473 TCTAATATCCATAGGCGGGAAGG + Intergenic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997686173 5:135789141-135789163 CGTAATATCCAGGGTGGGGAGGG + Intergenic
998587660 5:143444469-143444491 TGTAATATCAATACTGGCGATGG - Intergenic
999417996 5:151416718-151416740 TGGATTATCCTGAGTGTGGATGG - Intergenic
1000280838 5:159780581-159780603 TGGAAAATCCATAGAGGAGCTGG + Intergenic
1000319121 5:160119549-160119571 TGGAATATCAAAAGTGCGGGAGG - Intergenic
1003529674 6:6927479-6927501 AGCAATCTCCGTAGTGGGGAGGG + Intergenic
1005227903 6:23664324-23664346 TGGGATGTCAATAGTGGGGGAGG - Intergenic
1007800183 6:44385634-44385656 TGGAATTCACATAGTGGAGATGG + Intergenic
1009227613 6:61033156-61033178 TGTAATATCCATAGGTGGGAGGG - Intergenic
1021355182 7:19645240-19645262 TCTAATATCCATATTGAGGATGG - Intergenic
1022099616 7:27161378-27161400 TGGAATATCCTAATTGGGGCTGG + Intergenic
1022271584 7:28812878-28812900 TGGAATATCCAAGGTCTGGATGG + Intronic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1026922879 7:74169458-74169480 TGGAATATCCACTCTGGGGAAGG + Intergenic
1027429455 7:78095325-78095347 TGGAATATCCATAGTGGGGAAGG - Intronic
1027782077 7:82532163-82532185 TAGAATCTCCAGAGAGGGGACGG - Intergenic
1029051822 7:97697593-97697615 TGGAATTTCCTTAGTTGGGAGGG - Intergenic
1034886001 7:154799334-154799356 TGGAATATTCCTAGAGGAGAGGG - Intronic
1043826342 8:84933822-84933844 TGCTATATCCCTAATGGGGAGGG - Intergenic
1044615810 8:94139601-94139623 AGGAAGAACCATAGTGGGCAGGG + Intronic
1045580297 8:103471275-103471297 TGTAATATCCATGTTGGTGAGGG + Intergenic
1050899993 9:10935241-10935263 TGGATTCTCCAAAGAGGGGATGG - Intergenic
1053341293 9:37336472-37336494 TGGAATAAGCAGAGTTGGGATGG + Intronic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1055793524 9:79949306-79949328 TTGAATGTAGATAGTGGGGATGG + Intergenic
1055931997 9:81568628-81568650 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1057564076 9:96152982-96153004 TTGACTCTCCATAGTGGGCAAGG - Intergenic
1186794746 X:13034220-13034242 GGGGATATGGATAGTGGGGAAGG + Intergenic
1187027653 X:15452686-15452708 TGGAACATGCATAATGGGTATGG - Intronic
1189087207 X:38038085-38038107 AGGTACATCCATATTGGGGAGGG + Intronic
1191963115 X:66725591-66725613 TGGGATTTCTATATTGGGGATGG + Intergenic
1192555701 X:72087419-72087441 TTGGAAATCCATAGTGGTGATGG + Intergenic
1193759964 X:85452617-85452639 TTAAATCTCCAGAGTGGGGAGGG + Intergenic
1194195919 X:90892730-90892752 TGGAATATGCATGGAGGGAAAGG - Intergenic
1194703922 X:97151311-97151333 TGTAATATGAATAGTGAGGATGG + Intronic
1194887368 X:99333518-99333540 TGGAACTTCAAAAGTGGGGAAGG - Intergenic
1197294315 X:124698933-124698955 TAGAACAGCCAGAGTGGGGAGGG - Intronic
1197918510 X:131562359-131562381 ACAAATATCCATAGTGGGAAAGG + Intergenic
1200541767 Y:4466923-4466945 TGGAATATGCATGGAGGGAAAGG - Intergenic
1201236931 Y:11920962-11920984 TGGAATTTTTTTAGTGGGGAAGG - Intergenic