ID: 1027429838

View in Genome Browser
Species Human (GRCh38)
Location 7:78100175-78100197
Sequence ACTCTGAGAGGAGCACCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027429838 Original CRISPR ACTCTGAGAGGAGCACCAGT GGG (reversed) Intronic
901921590 1:12541047-12541069 ACTCTGAGAGGAGCCACTGGTGG + Intergenic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
903695182 1:25201154-25201176 ACTGTCAGAGGAGCTGCAGTGGG - Intergenic
904300024 1:29548244-29548266 ACTCTGTGAGGAGCAAGTGTGGG + Intergenic
905922999 1:41731456-41731478 ACTCAGAGATGAGAACCATTTGG - Intronic
909316945 1:74233775-74233797 ACTCTGAGAGGAGAAAGAGCTGG + Intronic
910353231 1:86324027-86324049 AATCTGAAAGGGGCACCACTAGG + Intergenic
911875700 1:103160458-103160480 ACCCAGAGAGTAGCAACAGTGGG + Intergenic
915105822 1:153534649-153534671 ACTCAGAGAGGACCCCCAGAGGG + Exonic
915513807 1:156401250-156401272 ACCCTGAGGGGAGGTCCAGTTGG - Intergenic
918123009 1:181556468-181556490 ACTCAGAGAGGGGCCCCTGTGGG + Intronic
921450361 1:215298202-215298224 AATCTGTGAGGAGAACCAGAAGG + Intergenic
923115954 1:230938195-230938217 ATTCTGACAGGAGCCCCAGAAGG - Intronic
1066245115 10:33575377-33575399 ACTCGGAGAGGAGCTGCTGTGGG + Intergenic
1066457249 10:35583047-35583069 ACTTTGAAAGGCCCACCAGTTGG + Intergenic
1067192542 10:44083369-44083391 ACTTTGAGTGGGGCATCAGTGGG - Intergenic
1067369715 10:45672362-45672384 ACTCGGAGATCAGCACCCGTCGG + Intronic
1068414925 10:56708235-56708257 ACTCTGAGAGGCTCAGAAGTAGG - Intergenic
1068662137 10:59633385-59633407 ACTCAGACACTAGCACCAGTGGG - Intergenic
1068930243 10:62581938-62581960 ACCCGGAGATGAGCACCAGCAGG - Intronic
1070723629 10:78773421-78773443 ACCCAGAGAGGAGCCCCAGTTGG - Intergenic
1073631881 10:105157433-105157455 ACTCAGAGTGCAGCACCAATTGG + Intronic
1074755561 10:116621741-116621763 ACTCTGAGAAGAGGACACGTGGG - Intronic
1075872616 10:125781786-125781808 ACTCTCAGAGCAGAACCAGTTGG - Intergenic
1077496295 11:2888050-2888072 GCTCTGAGAGGAGGCCCAATGGG + Exonic
1077695357 11:4388341-4388363 GCTCTGAGATGAGCTCCTGTAGG + Exonic
1078549522 11:12270535-12270557 ACCCAGAGAGGAGCAGCAGCAGG - Intergenic
1079837543 11:25352130-25352152 ACTCTGAGAAATGCATCAGTAGG + Intergenic
1086260191 11:84930689-84930711 ACACTGAGAGGAGCAAAAGAAGG - Intronic
1086497559 11:87420224-87420246 GCTCTGCAAGGAGCACCAGGAGG + Intergenic
1088942991 11:114479562-114479584 ACACTGGGAGGAACAGCAGTTGG + Intergenic
1090892384 11:130935741-130935763 AATTTGAAAGGAGCACCATTAGG - Intergenic
1096777403 12:53972754-53972776 TCTCTGTGAGCAGCACCAGGAGG - Intergenic
1096841986 12:54385366-54385388 ACTCTGAGAGGAGGAGGAGAAGG - Intronic
1101022570 12:100568042-100568064 ACTCAGAGATTAGCAACAGTAGG - Intergenic
1104323193 12:127771523-127771545 ACTCTGAGAAGGGAAACAGTGGG + Intergenic
1105021009 12:132816948-132816970 ACTCTGAGAGGAGCAGCCCATGG + Intronic
1108164415 13:47677181-47677203 ACACTGAGAGTAGCAACATTAGG + Intergenic
1111247128 13:85554273-85554295 TCTCTGAGGGGAGCATCAGGTGG - Intergenic
1112802997 13:103132938-103132960 ACTCTGAGTGCAGGACCTGTTGG - Intergenic
1113341341 13:109429161-109429183 CCTCTGAGAGGAGCTCCTGCAGG + Intergenic
1114915134 14:27254236-27254258 ACTGTCAGAGGAGTATCAGTGGG + Intergenic
1115731961 14:36279796-36279818 ACTCTGAAAGGACCACCTGTTGG - Intergenic
1117951086 14:61083170-61083192 AGCCAGAGAGCAGCACCAGTGGG + Intronic
1119428734 14:74552135-74552157 ACCCTGGGAGGAGTGCCAGTTGG - Intronic
1121588008 14:95077099-95077121 ACACTGAAAGGAGCATCAGCTGG - Intergenic
1124587819 15:31025668-31025690 ACTCTCAGGGGAGCCCCAGGAGG + Intronic
1128710973 15:69871726-69871748 AAACTGAGAGGAGCCCCAGATGG - Intergenic
1129938008 15:79466788-79466810 ACCCAGAGACCAGCACCAGTAGG + Intronic
1129968593 15:79758084-79758106 ACTCTGAGAGCAGCAGCGGAAGG + Intergenic
1130651270 15:85763428-85763450 ACTCTGAGAGGTGAGACAGTTGG - Intronic
1131067109 15:89441572-89441594 AGCCTGAGGGGAGCACCTGTGGG + Intergenic
1131979106 15:97978635-97978657 ACTCTCAGAGGAACAGCTGTTGG - Intergenic
1140420283 16:74813533-74813555 ATTCTGAGAGGAGCGCCACAGGG - Intergenic
1142520289 17:499675-499697 ACTCTGGGCTGAGCCCCAGTAGG - Intergenic
1143344261 17:6238500-6238522 GCTCTGCGAGCAGCACCCGTGGG + Intergenic
1145052939 17:19678254-19678276 GCTCTGAGAAGGGGACCAGTGGG - Intergenic
1149417939 17:56479820-56479842 ACTCTGCAGGGAGCAGCAGTAGG - Intronic
1150721769 17:67619684-67619706 GCTCTCAGAGGAGCACCTGATGG - Intronic
1151415381 17:73958838-73958860 ACTCTGTCAGGAGCAGGAGTGGG - Intergenic
1152247922 17:79195441-79195463 ACTCTAAGAAGAGACCCAGTTGG - Intronic
1152445352 17:80339659-80339681 ACTCTGATAAGAGCATCAGCGGG - Exonic
1155169325 18:23255507-23255529 ACTCTGAGCTGAGAATCAGTAGG + Intronic
1155323864 18:24646672-24646694 ACCCGGAGAGGAGCAGCAATGGG + Intergenic
1156029312 18:32693756-32693778 GCCCTGAGAGGAACAGCAGTTGG - Intronic
1156544272 18:37947891-37947913 TATCTGAGAGGAGAATCAGTGGG + Intergenic
1157896929 18:51478355-51478377 GATCAGAGAGGAGCAGCAGTTGG + Intergenic
1157983458 18:52409942-52409964 ACACTGAGAGAACCACCAGAGGG - Intronic
1159636727 18:70813548-70813570 AATCAGAGAGTAGAACCAGTGGG + Intergenic
1160006302 18:75071583-75071605 AGCCAGAGAGGAGCACCAGAGGG + Intergenic
1160657637 19:281690-281712 GCTCTTAGTGGAGGACCAGTGGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161626288 19:5328870-5328892 ACTCTCAGAGCAGGACCAGGGGG + Intronic
1166148364 19:40852426-40852448 ACCCTGAGAGGGGCCCCAGATGG + Intronic
1166152506 19:40884211-40884233 ACCCTGAGAGGGGCCCCAGATGG + Intronic
1166177677 19:41086434-41086456 ACCCTGAGAGGGGCTCCAGATGG - Intergenic
926958781 2:18331920-18331942 ACTCAGAGAAGACCAGCAGTGGG + Intronic
927405284 2:22759307-22759329 ACTCTGACATGAACACTAGTTGG + Intergenic
928759273 2:34562159-34562181 ACTCTGAGAGTAACAAGAGTGGG + Intergenic
930148983 2:48038886-48038908 CCTGTGATAGGAGCACCAGAAGG - Intergenic
930274302 2:49293705-49293727 ACTCAGAGAGGTGCTCCAGGTGG - Intergenic
930684795 2:54296370-54296392 ACTCTGAGGGGACCAATAGTTGG + Intronic
932543098 2:72677569-72677591 ACTCTGAGTTGAGCTTCAGTGGG + Intronic
934102535 2:88666684-88666706 CCCCTGAGAGGAGCAGCAGTTGG - Intergenic
934970089 2:98756202-98756224 ACTCTGAAAGGAGCAGATGTAGG + Intergenic
940360472 2:152791017-152791039 ACGTTGAGAGGAGCGCCAGCAGG + Intergenic
943127700 2:183816258-183816280 TCTCACAGAGGAGCAGCAGTTGG - Intergenic
947653881 2:231810050-231810072 ACTCTCAGAGGAACAGCAGCAGG - Intergenic
1169621444 20:7511147-7511169 ACTCTGAGAGTAGCACTGGGAGG - Intergenic
1171236276 20:23527695-23527717 ACTCTGGGACTTGCACCAGTGGG + Intergenic
1174480677 20:50829092-50829114 ACTGTTAGAGAAACACCAGTGGG - Intronic
1175100405 20:56575173-56575195 AATCTGAGAGGAGGGACAGTGGG - Intergenic
1175646453 20:60676905-60676927 AGGCTGAGAGGGGCCCCAGTGGG - Intergenic
1177108561 21:16993970-16993992 GCTCTGAGTGGAGCTGCAGTGGG - Intergenic
1178160577 21:29908420-29908442 GCTCTAAGAAGAGCACCAGCAGG - Intronic
1178282251 21:31293586-31293608 AGTCTGTCAGGAGCACCTGTTGG - Intronic
1178621959 21:34185133-34185155 CCTCAGAAAGGAGCACCACTGGG + Intergenic
1178706871 21:34883040-34883062 ACTGTGAGGGGAACAGCAGTAGG - Intronic
1178860983 21:36289511-36289533 AGGCAGTGAGGAGCACCAGTGGG - Intronic
1179134769 21:38669793-38669815 ACTCAGAGAGGTGGACCAGTGGG - Intergenic
1182472196 22:30555465-30555487 ACTCTTGAAGGAGCACCAGGTGG + Exonic
1185110685 22:48898610-48898632 GCTCTCAGAGCAGCACCAGGTGG + Intergenic
960523639 3:118683923-118683945 TGTCTGAGAGGAGCACCAGGTGG - Intergenic
961916317 3:130378756-130378778 TCTCTGAGAGGATCACATGTGGG - Intronic
963683641 3:148411149-148411171 AATCTGAGATGAGCAGCATTTGG + Intergenic
964818093 3:160739074-160739096 ACTCTGAAAGGAGACCCAGAAGG + Intergenic
967219411 3:187236238-187236260 AGTCTGGGTGGAGCACCACTCGG + Exonic
968287266 3:197516197-197516219 ACTTTGAGAGGAGCAGGATTAGG - Intronic
975099052 4:70491357-70491379 TCTCAGAGAGAAGCACCAGCAGG - Intergenic
977416675 4:96742707-96742729 AATTTGAGCGCAGCACCAGTGGG - Intergenic
981747965 4:148069109-148069131 ACTAGGAGAGGAGCCCCAGATGG + Intronic
984710528 4:182880512-182880534 ACTCTCGGAGGAGCAGCAGCAGG - Intergenic
986599062 5:9452915-9452937 ACTCTGAGAGGTGCCTCAGAGGG + Intronic
987846733 5:23296300-23296322 ACTCTTAGGGGACCACAAGTGGG - Intergenic
996478684 5:123949359-123949381 AATTTGAGAGCAGCACCAGCAGG + Intergenic
996888666 5:128389898-128389920 ACTCTGAGAGGATCTTCAGAAGG - Intronic
997486204 5:134232921-134232943 ACTCTTAGAGGAGGACTTGTTGG + Intergenic
998697182 5:144653483-144653505 CATCTGAGAGGAGCAGCATTTGG + Intergenic
998799556 5:145855735-145855757 AGTCTTAGTGGAGTACCAGTTGG + Intergenic
999636371 5:153627255-153627277 ATTCTCAGAGCAGCACCATTGGG + Intronic
999903660 5:156115239-156115261 ACCCTGAGAGGAGGACTATTAGG + Intronic
1005346029 6:24891711-24891733 CCTCTGAGAGGGGAACCAATGGG - Intronic
1006212936 6:32412733-32412755 ACTCTGAGAGGGACATCTGTGGG - Intergenic
1006287928 6:33112362-33112384 ACTCTGAGAAAAGAACCAATGGG - Intergenic
1009435070 6:63608302-63608324 ACTCTGAAAGGTGGAGCAGTTGG - Intergenic
1015325003 6:131915046-131915068 ACACTGAGAGGAGCATCATATGG + Intergenic
1018889031 6:167967911-167967933 ACAGTGAGAGGAGCAGCATTAGG + Intronic
1019332854 7:469415-469437 ACTCTGAGAGGTGCCCACGTGGG - Intergenic
1019632584 7:2057769-2057791 ACTCTTAGAAAAGCACAAGTTGG + Intronic
1020365628 7:7377976-7377998 ACTCTGAGAGAGGCAGGAGTGGG + Intronic
1021840484 7:24718113-24718135 ACTGTGGCAGGAGCACCAGCAGG + Intronic
1022262763 7:28722355-28722377 TCTCTGAGAGGGTCACCAGTCGG + Intronic
1022536050 7:31099228-31099250 AGACTGAGAGGAGCACCTTTGGG - Intronic
1027251188 7:76399841-76399863 ACTAGGAGAGGGGAACCAGTGGG + Intronic
1027429838 7:78100175-78100197 ACTCTGAGAGGAGCACCAGTGGG - Intronic
1031958996 7:127972160-127972182 TCTTTGAGGGGAGCACCAGGAGG - Intronic
1036194198 8:6699682-6699704 ATTCTGTGAGAAGCACCTGTGGG + Intergenic
1037915308 8:22769317-22769339 ACTCTGAGATAAGCCCCAGAGGG - Intronic
1038597034 8:28896800-28896822 ACTCTGAGAAACGCACCATTAGG - Intronic
1039405631 8:37310028-37310050 CCTCTGAGGGGAGGACAAGTGGG - Intergenic
1041608277 8:59811656-59811678 ACTTTGAAAGGAGTACAAGTGGG - Intergenic
1048915761 8:139181514-139181536 CATCTGAGAGGAGCAGCATTTGG - Intergenic
1049566596 8:143343473-143343495 ACTCTGAGCACAGCACCAGCTGG + Intronic
1050713998 9:8499816-8499838 ACTTTGCGAGGAGGACCACTAGG + Exonic
1053416633 9:37950942-37950964 ACTCTGAGACAGGCACCAGGAGG - Intronic
1053437746 9:38088118-38088140 ACTCGGAGAGGTGCACCACCTGG - Intergenic
1055284004 9:74708734-74708756 ACTCAGAGAGGAGCATCTATGGG + Intergenic
1055654944 9:78442262-78442284 AATTTGAGCGCAGCACCAGTGGG - Intergenic
1058419630 9:104821419-104821441 GCTCTGAGATGAGCACCATCCGG - Exonic
1060685627 9:125608731-125608753 ACTCTGAGAGGAGCCCAAACCGG + Intronic
1061935338 9:133854486-133854508 ACTCAGTGAGGAGTAGCAGTGGG - Intronic
1186195296 X:7105470-7105492 ACTCTTTCAGGAGCACCAGGAGG + Intronic
1187614069 X:20973918-20973940 ACTATGAGAGTAGTATCAGTGGG - Intergenic
1188083357 X:25873317-25873339 ATTCTGAGAGGTGCAGCATTAGG - Intergenic
1188172348 X:26943202-26943224 ACTCTGAAAGTAGAACAAGTAGG + Intergenic
1189279073 X:39808628-39808650 ACTCTGAGAGGAGCATAGGAAGG - Intergenic
1193600455 X:83503895-83503917 ACTATAAGAGGAGCTGCAGTGGG + Intergenic
1196547402 X:116978413-116978435 AATCAGAGAAGAGCAGCAGTAGG + Intergenic
1197158195 X:123293094-123293116 ACTCAGTGAGGTGCACCAGAAGG + Intronic
1199004970 X:142685172-142685194 ACTCTGAGATGATAAACAGTTGG + Intergenic
1199173347 X:144757276-144757298 TCTCTGAGAGGAGCCCCAAGGGG - Intergenic