ID: 1027431166

View in Genome Browser
Species Human (GRCh38)
Location 7:78114251-78114273
Sequence CTGATCAGTGAAAGTATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027431164_1027431166 28 Left 1027431164 7:78114200-78114222 CCTCTAAGCAAGTCTTCAGGGCA 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1027431166 7:78114251-78114273 CTGATCAGTGAAAGTATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027431166 Original CRISPR CTGATCAGTGAAAGTATCTT AGG Intronic
No off target data available for this crispr