ID: 1027431178

View in Genome Browser
Species Human (GRCh38)
Location 7:78114379-78114401
Sequence GTGGGCACAGAATTTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027431178_1027431182 -3 Left 1027431178 7:78114379-78114401 CCACTGGGAAATTCTGTGCCCAC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1027431182 7:78114399-78114421 CACGTGACAGTCTTTGTTAAGGG No data
1027431178_1027431181 -4 Left 1027431178 7:78114379-78114401 CCACTGGGAAATTCTGTGCCCAC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1027431181 7:78114398-78114420 CCACGTGACAGTCTTTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027431178 Original CRISPR GTGGGCACAGAATTTCCCAG TGG (reversed) Intronic
902158848 1:14512704-14512726 CTGGGCATAGAATGTGCCAGTGG - Intergenic
902226954 1:15002268-15002290 GAGGGCACAGAATGTCAAAGGGG + Intronic
903458726 1:23506315-23506337 GGGGGCACATGATTGCCCAGTGG - Intergenic
903470143 1:23581306-23581328 CTGGGGACTGATTTTCCCAGAGG + Intergenic
903697448 1:25218309-25218331 GTGGGCACAGCATTTTCCAAAGG + Intergenic
904117187 1:28171580-28171602 CCTGGCACAGAATTCCCCAGAGG - Intronic
905363071 1:37433633-37433655 GTACGCACTGAATTGCCCAGTGG - Intergenic
906394150 1:45446067-45446089 CTTGGCACAGAATTTCACAGTGG + Intronic
907445737 1:54506689-54506711 GGGGGCACAGAGTTCCCCTGAGG + Intergenic
907795147 1:57708623-57708645 TGGGGCACAGAATTTCCCTGTGG + Intronic
907862695 1:58368773-58368795 GTGGACAGAGAAGTTTCCAGTGG - Intronic
908007611 1:59742746-59742768 GTGGGCTCAGAATGTCCTTGAGG - Intronic
910451130 1:87346606-87346628 GTGAGCACAGAAGTTCTCAAAGG - Exonic
914412941 1:147448944-147448966 GGGGGCTCAGAATTTGCCAGTGG + Intergenic
915904900 1:159870661-159870683 GTGGGCTCAGAAGTTAGCAGTGG + Intronic
920148823 1:203886877-203886899 GTGTGCCCAGAATAGCCCAGGGG + Intergenic
920722434 1:208400151-208400173 CTGGCCACAGACTTTGCCAGGGG - Intergenic
924045025 1:240020187-240020209 GTGGGCACAGAATTTCACTTTGG - Intronic
924723868 1:246649215-246649237 ATGGGCACAGAATTTCCATTTGG + Intronic
924769146 1:247063854-247063876 GTGGGCACACAGCTTCCCAGAGG + Intronic
1063007394 10:1986569-1986591 GTGGGAACAGAATTTCCATCTGG + Intergenic
1064127420 10:12675525-12675547 GTGGCCACAGGATTTGCCAAGGG - Intronic
1064335780 10:14440070-14440092 GTGTACACAGAGTGTCCCAGTGG - Intronic
1066629778 10:37447828-37447850 GTTGGCACTGAACTTCCCATTGG - Intergenic
1067717530 10:48700745-48700767 GTGGGCACAGCCTTTGGCAGGGG + Intronic
1072327107 10:94309661-94309683 GTGGGCACTGAGTTTCCATGAGG - Intronic
1073545320 10:104343285-104343307 GTGGGCTCCGACATTCCCAGAGG - Intergenic
1076778468 10:132710908-132710930 GCAGGCACAGCCTTTCCCAGTGG - Intronic
1080030139 11:27651639-27651661 GTGGGCACAGAATCACCTAGAGG + Intergenic
1081310100 11:41560382-41560404 GTGGGTAAAGTATCTCCCAGAGG + Intergenic
1082813930 11:57495995-57496017 GTGGGCAGAGACTCTCCCTGGGG - Intronic
1083863282 11:65438028-65438050 GGGTACACAGAACTTCCCAGTGG - Intergenic
1085407309 11:76270956-76270978 GTGGGCACTGAAATTAGCAGTGG + Intergenic
1090917393 11:131177588-131177610 CTGGGCCCAGCACTTCCCAGAGG - Intergenic
1090966654 11:131603647-131603669 ATGGGCACATAATTTCCTCGTGG - Intronic
1091937703 12:4446299-4446321 GAGGGCACAGACATTCTCAGGGG + Intergenic
1098728218 12:73996932-73996954 GGGGGCAAAGACTTTCTCAGTGG - Intergenic
1101363853 12:104053352-104053374 GTATGCACAGATTTTCCCTGGGG + Intronic
1101813832 12:108130176-108130198 GGGGGCACAGGAATGCCCAGAGG - Intronic
1102029404 12:109731329-109731351 GTGGGCACCCAATGTCCCACAGG - Intronic
1102962156 12:117099684-117099706 GTGGGCATAGCACCTCCCAGGGG - Intergenic
1106913712 13:34489443-34489465 ATGGGCACAGAATTTCACTGGGG - Intergenic
1107653801 13:42571786-42571808 GTGTGCACAGAATTCTTCAGGGG + Intronic
1110672787 13:78201593-78201615 GAGAGCACAGAAAGTCCCAGAGG - Intergenic
1113512748 13:110869014-110869036 GTGGGCATAGAATTGACCAAAGG - Intergenic
1113648350 13:112014901-112014923 GTGGTCACAGAAGTGCCCACTGG + Intergenic
1114754869 14:25247734-25247756 GCGGGCACAGGAGTTTCCAGGGG - Intergenic
1117291085 14:54333560-54333582 TTGGGCACTGAATTTCCTAAGGG - Intergenic
1118757669 14:68856707-68856729 GTGTGTACAGAATTTTCCAGAGG + Intergenic
1119043692 14:71298296-71298318 GTGGGAAGAGTATTGCCCAGAGG - Intergenic
1119739304 14:77003851-77003873 GTGGGCACACAATTGTCCTGGGG + Intergenic
1122158445 14:99765343-99765365 GTGGGCACAGAGTTTCCGCTTGG - Intronic
1122263359 14:100535478-100535500 GTGGGCAGAGGCATTCCCAGAGG - Intergenic
1122846388 14:104502012-104502034 GGGGACACAGAAATTCCAAGTGG - Intronic
1126777974 15:52115804-52115826 GTGGGCACTGAGTTTCTCCGGGG - Exonic
1127760672 15:62136503-62136525 GAGGGCTCTGAATTTCCTAGGGG - Intergenic
1128079406 15:64847277-64847299 GTGGCCACAGGATATCCCTGGGG + Intronic
1128511087 15:68314238-68314260 GTGGGCACAGCCTTTGCCACAGG - Intronic
1129615792 15:77098050-77098072 GTGGGGTGAGAATGTCCCAGGGG + Intergenic
1129625943 15:77199563-77199585 GTGGACACAGAGTTTTCCAGAGG - Intronic
1132729838 16:1355930-1355952 GTGGGCACAGGACTCACCAGGGG + Intronic
1133119324 16:3596513-3596535 GTGGGGACAGACTGTCCCCGGGG + Intronic
1133756230 16:8764572-8764594 GTGGGCTCAGGCTTTTCCAGGGG - Intronic
1134061582 16:11202661-11202683 CTGGGAACAGAAGTGCCCAGGGG + Intergenic
1134450241 16:14358879-14358901 ATGGGCACAGACTTGCCCCGGGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137563132 16:49515838-49515860 GTGGGCACAGAGGTGCCCATGGG + Intronic
1137673129 16:50291035-50291057 GGGGGCAGAGAAGTTCACAGCGG + Intronic
1138064067 16:53922306-53922328 GCAGGCAGAGAATTTCCCATTGG + Intronic
1139304250 16:65969619-65969641 GTGGGCCAAGATTGTCCCAGGGG + Intergenic
1141705969 16:85664744-85664766 GTGGGCACAGTGATTCACAGAGG + Intronic
1141742620 16:85904111-85904133 TTGGGCTCCGAATCTCCCAGAGG - Intronic
1143273368 17:5692134-5692156 GTGGGCACAGTCTATCTCAGTGG + Intergenic
1144181965 17:12760729-12760751 GTGGGCTCAGAATGTCCTAATGG - Intronic
1146565332 17:33908140-33908162 GCGGGCACAGAATTTCTCAAAGG - Intronic
1146826557 17:36028368-36028390 CTGGGCAGAGAAATTCCCAAGGG + Intergenic
1147166401 17:38595922-38595944 GTGGGCCCAGCCTTTGCCAGGGG - Intronic
1147811186 17:43170966-43170988 GTGGGCGCCGAATTTGCCTGGGG + Intronic
1148392992 17:47286628-47286650 GTGGTCTCAGATGTTCCCAGGGG + Intronic
1148620734 17:49032713-49032735 CTGGGCTCAGAATTTTCTAGAGG + Intronic
1149474032 17:56944210-56944232 GTATGCACAGAATTTGACAGTGG + Intronic
1149600103 17:57887829-57887851 GTGTGAACAGATTTTCTCAGGGG - Intronic
1150124856 17:62629078-62629100 GTGGGCCCAGAATTGCCCCGGGG - Intronic
1150599379 17:66637347-66637369 GAGGGCGCAGAATATGCCAGGGG - Intronic
1150808205 17:68335757-68335779 GTGGGGAGAGACATTCCCAGTGG + Intronic
1151409648 17:73913470-73913492 GTGGAAGCAGAGTTTCCCAGAGG - Intergenic
1151578257 17:74963537-74963559 GTGGGCACAGAAACCCCCATGGG + Intronic
1154137665 18:11794603-11794625 GTGGGCACAGGATTTCCTTTTGG + Intronic
1161810718 19:6469651-6469673 GTGGACAGAGAATTACCCAAGGG + Intronic
1163779039 19:19236139-19236161 GTGGGCACAGAGTTTCCTTCTGG - Intronic
1165863901 19:38924331-38924353 GGGGGCAGAGATTTTCCCAAGGG - Intronic
1166920687 19:46227129-46227151 GTGGGACCAGGATTTCCCAGTGG - Intergenic
926127773 2:10282563-10282585 GTGGGGTCAGACCTTCCCAGGGG - Intergenic
927445362 2:23156169-23156191 GTTTGCACTGACTTTCCCAGAGG - Intergenic
927716991 2:25359522-25359544 GTCCACACAGAATTTCCCAGGGG + Intergenic
931819239 2:65934961-65934983 ATGGGCCCAGAACTCCCCAGAGG - Intergenic
932773154 2:74512983-74513005 GGGGGCAGAGTCTTTCCCAGGGG + Intergenic
935192577 2:100790846-100790868 ATGGGCACAGAATTTCAGAGCGG - Intergenic
935593911 2:104864873-104864895 GCTGTCACAGAATTGCCCAGTGG + Intergenic
941934833 2:170974215-170974237 GAGGGGACAGAATAGCCCAGAGG + Intergenic
946300231 2:218819271-218819293 GTTGGCACAGAATTCATCAGTGG + Intergenic
948458329 2:238117522-238117544 GTGGGAACGGAACCTCCCAGAGG + Intronic
948656127 2:239477667-239477689 GTGGGCACAGACTTCCCGTGTGG - Intergenic
1169524807 20:6412786-6412808 GTGGGCAAAGTTTTCCCCAGGGG + Intergenic
1170881357 20:20298947-20298969 GAAGGCATAGAATTTCCAAGTGG + Intronic
1171416990 20:24988783-24988805 GTGACCACAGAACTTTCCAGTGG - Intronic
1172033169 20:31995606-31995628 GTGGGCAGGGGATTCCCCAGAGG - Intronic
1175129605 20:56779503-56779525 GAGGGCAGAGAACTTTCCAGTGG + Intergenic
1175687322 20:61040983-61041005 GTGGGCTCAGAACCTCTCAGGGG - Intergenic
1176213003 20:63934406-63934428 ATGGGCACAGAATGTCCCTTTGG + Exonic
1179489143 21:41728802-41728824 GGGAGCCCAGCATTTCCCAGAGG - Intergenic
1180049857 21:45326115-45326137 GTGGGCCCAGAGCCTCCCAGGGG - Intergenic
1180195285 21:46190265-46190287 GTGGACACAGAAATGCACAGGGG - Exonic
1184534696 22:45078323-45078345 CTGGAAGCAGAATTTCCCAGGGG + Intergenic
949874978 3:8620640-8620662 GTGGGCACAGGCATCCCCAGGGG + Intronic
950925725 3:16739486-16739508 ATGGGCACAGAATTTCCTTTAGG - Intergenic
951990460 3:28670963-28670985 TTGGGCAAAGCAATTCCCAGAGG - Intergenic
955081758 3:55664321-55664343 GTGAGATCAGAATTTGCCAGTGG - Intronic
956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG + Intergenic
960919141 3:122728982-122729004 GGGAGCACAGTATTACCCAGTGG + Exonic
960970816 3:123138910-123138932 CTGGAACCAGAATTTCCCAGAGG - Intronic
968664513 4:1813725-1813747 ATTGGCACAGAGTTTCCCACGGG - Exonic
969375409 4:6760444-6760466 GTCTGCACAGACTTTCCAAGTGG - Intergenic
972311942 4:37890676-37890698 CTGGGCACAGCGTTTCCCTGGGG - Intergenic
973785505 4:54329025-54329047 GTTCTCACAGAATTTCACAGAGG - Intergenic
977687930 4:99870769-99870791 GTGGGCCAGGATTTTCCCAGAGG - Intergenic
984922130 4:184774529-184774551 GCGGGGACAGCATTTCCCAGCGG + Intronic
985652583 5:1113757-1113779 GTGGGAACAGAAGTGCCCAATGG + Intergenic
986293231 5:6417078-6417100 GTGGGTACAGGATGTCACAGAGG + Intergenic
986396509 5:7336055-7336077 GTGGACACAGAACTTCCCCAAGG + Intergenic
990906294 5:60806924-60806946 CTGCCCACAGAATTTCACAGAGG + Intronic
992091834 5:73324458-73324480 GGGGGAGCAGAAATTCCCAGGGG - Intergenic
993497598 5:88625193-88625215 GTGAGCACAAACTTTACCAGAGG + Intergenic
993532636 5:89043082-89043104 GTGGGCACAGCATTTCCTTGAGG + Intergenic
997571813 5:134934772-134934794 CTGGGAATAGAATTTCTCAGAGG - Intronic
1003847739 6:10190672-10190694 GTAGCCACAGCATTTCTCAGTGG - Intronic
1004854664 6:19736745-19736767 GTGGCCACAGCAGTACCCAGAGG + Intergenic
1007106895 6:39289603-39289625 ATGGGCACAGCATTTACCACAGG - Intergenic
1007797789 6:44364690-44364712 GTGGGGAGAGAATTTCACAAAGG - Intronic
1011394030 6:86887347-86887369 GGAGGCACAGAACTTCACAGAGG + Intergenic
1011431839 6:87295548-87295570 GTGGGTACAGAATATCTGAGGGG + Intronic
1014492396 6:122078491-122078513 GTGCCCACAGACTTTCCAAGGGG - Intergenic
1015044103 6:128758833-128758855 AAGGGGACAGAATTTCCCAGGGG + Intergenic
1016661468 6:146585910-146585932 GTAGTCACATCATTTCCCAGGGG - Intergenic
1016842036 6:148534282-148534304 GTGGGCGCAGAGTTTCCTTGTGG - Intronic
1019150651 6:170003390-170003412 GTGGGCACAGGACTTCACACAGG - Intergenic
1019690579 7:2408787-2408809 GTGGGAACAGGATTTCCCCCAGG + Intronic
1019995973 7:4724819-4724841 GTGGGCAGAGAGCTACCCAGAGG - Intronic
1023205374 7:37743269-37743291 GTGGTCACAGAAATTCACAGAGG - Intronic
1024555548 7:50600132-50600154 GTGGGCCCAGAATGTTCTAGGGG - Intronic
1027431178 7:78114379-78114401 GTGGGCACAGAATTTCCCAGTGG - Intronic
1028677214 7:93479007-93479029 GAGGGCAGAGAATTTGCCTGAGG - Intronic
1029696901 7:102219496-102219518 AAGGGCACAGACCTTCCCAGGGG + Intronic
1030950470 7:115785012-115785034 GTGGGCACAGAGGAACCCAGAGG - Intergenic
1033077458 7:138262906-138262928 GTGGGGAAAGAAATCCCCAGAGG + Intergenic
1034982807 7:155489571-155489593 GTGGGCACCCAGTTTCCCTGAGG - Intronic
1036133089 8:6134454-6134476 GGAGCTACAGAATTTCCCAGTGG + Intergenic
1038011613 8:23480797-23480819 ATGGGCACAGAACGTCCCATTGG - Intergenic
1041030400 8:53730589-53730611 GTGGGCACAGATCTCCTCAGAGG - Intronic
1041373511 8:57189705-57189727 CTGGCCTCAGAATTCCCCAGGGG + Intergenic
1041444050 8:57930945-57930967 GTAGGGATAGAATTTCCCACAGG + Intergenic
1043471457 8:80566981-80567003 GAAGTCACAGAATTTGCCAGAGG + Intergenic
1043755334 8:83996518-83996540 ATGGGCACAGAATTTCCATTTGG + Intergenic
1044002681 8:86903560-86903582 TGGGGGACAGAATATCCCAGAGG + Intronic
1046733386 8:117750171-117750193 GCTGGAACAGAATTTCCCAAAGG - Intergenic
1047350638 8:124070344-124070366 GTGGCCTCAGATTTTCCCAAGGG + Intronic
1047520555 8:125592483-125592505 ACAGGCTCAGAATTTCCCAGGGG - Intergenic
1048343568 8:133559081-133559103 GTGGCCACAGCCTGTCCCAGTGG - Intronic
1049127765 8:140807880-140807902 GAGGACTCAGAATTACCCAGTGG + Intronic
1049728982 8:144166331-144166353 GAGAGCACAGATTTGCCCAGAGG + Intronic
1050636536 9:7618732-7618754 GTGGGGACAAACTTTGCCAGAGG - Intergenic
1052405317 9:28052472-28052494 TTGGGAACATCATTTCCCAGAGG + Intronic
1055561265 9:77523831-77523853 GTAGATACAGAATTTCCCAAGGG - Intronic
1056843433 9:90017500-90017522 GTGGGCAGAGATTCTCCCAGTGG + Intergenic
1057909007 9:99003926-99003948 GGGGGCACAGAAGTTTCCTGGGG + Intronic
1058408954 9:104708950-104708972 ATGAGCACAGAATTTTCAAGTGG + Intergenic
1060822501 9:126669614-126669636 GTGTGCACAGACATACCCAGAGG - Intronic
1062607217 9:137353666-137353688 CTGGGCCCTGCATTTCCCAGCGG - Intronic
1187942645 X:24396968-24396990 GTAAGAAAAGAATTTCCCAGTGG - Intergenic
1190739269 X:53278656-53278678 ATGGGCACAGGGATTCCCAGAGG - Intronic
1193498002 X:82237804-82237826 GTGGGGAAAGAATTTCAAAGGGG + Intergenic
1193790506 X:85810221-85810243 GTGGGAAGAGATTTTTCCAGAGG + Intergenic
1197962524 X:132022768-132022790 GTGGCCACAGATCTGCCCAGAGG + Intergenic
1199604637 X:149567650-149567672 GTATGCAGAGGATTTCCCAGAGG + Intergenic
1201486931 Y:14504964-14504986 GAGGACACAGAATATCTCAGAGG + Intergenic