ID: 1027435519

View in Genome Browser
Species Human (GRCh38)
Location 7:78160113-78160135
Sequence ACTGGTCTGCAGGCTGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027435512_1027435519 9 Left 1027435512 7:78160081-78160103 CCCTCATTCTCTTTGCGGTGAAT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG 0: 1
1: 0
2: 4
3: 32
4: 456
1027435513_1027435519 8 Left 1027435513 7:78160082-78160104 CCTCATTCTCTTTGCGGTGAATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG 0: 1
1: 0
2: 4
3: 32
4: 456
1027435510_1027435519 15 Left 1027435510 7:78160075-78160097 CCGAAGCCCTCATTCTCTTTGCG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG 0: 1
1: 0
2: 4
3: 32
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027435519 Original CRISPR ACTGGTCTGCAGGCTGTGGG AGG Exonic
900375029 1:2350107-2350129 TCTGCACTGCAAGCTGTGGGTGG + Intronic
900391183 1:2434667-2434689 GCTCCTCTGCTGGCTGTGGGGGG - Intronic
900512387 1:3066826-3066848 GCTGGGCTGCAGGGTGAGGGTGG + Intergenic
901195206 1:7436514-7436536 TGTGGTCTGCAGGCAGAGGGCGG - Intronic
901250360 1:7772964-7772986 ACTGGGATGCAGGGAGTGGGTGG - Intronic
901624852 1:10618086-10618108 CCCTGACTGCAGGCTGTGGGTGG - Intronic
901791565 1:11655928-11655950 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
901793798 1:11668772-11668794 CCTGGTCTGCAGCCTCTGGCGGG + Exonic
902441101 1:16430569-16430591 GCTGGGCTGGAGGCTGTGAGGGG + Intronic
902590525 1:17470951-17470973 GCTGCTCTGGAGGCTGTGGTGGG - Intergenic
902727569 1:18347269-18347291 TCTGCCCTGCAGGCTGTAGGGGG - Intronic
903176955 1:21587146-21587168 GCTGGACTGCAGCCAGTGGGTGG - Intergenic
903220000 1:21864256-21864278 CTGGGTCTGCTGGCTGTGGGTGG - Intronic
903519611 1:23936721-23936743 AAAGGTCATCAGGCTGTGGGAGG + Intergenic
903596967 1:24502675-24502697 CCTGGTCCCCAGCCTGTGGGGGG - Intronic
903688169 1:25147963-25147985 ATTGCTCTGGATGCTGTGGGGGG + Intergenic
904106071 1:28085338-28085360 GCTATTCTGGAGGCTGTGGGAGG + Intronic
904246868 1:29194174-29194196 ACTGGTCTGCGGGAGGTTGGAGG + Exonic
904454074 1:30636429-30636451 ACAGGGCTGGAGACTGTGGGGGG + Intergenic
904810394 1:33159918-33159940 AGTGGTCCGCAGGCTCTTGGTGG + Exonic
905339788 1:37270649-37270671 ACTGGGCTAGAGGCTGGGGGTGG + Intergenic
905567575 1:38978027-38978049 ACTGATCAGCAGGATGTGGGTGG - Intergenic
907284606 1:53371623-53371645 CCTGGTGCCCAGGCTGTGGGGGG - Intergenic
907308043 1:53524532-53524554 GCTGGTGGGCAGTCTGTGGGTGG + Intronic
908152169 1:61313284-61313306 ACTGGTCTGTGGGCTGTGCAGGG + Intronic
909318428 1:74252947-74252969 ACCAGTCAGCAGGATGTGGGTGG - Intronic
909673542 1:78214342-78214364 AATGGTCTGGAGGCTGTTGGGGG + Intergenic
910260991 1:85293796-85293818 AGAGGTGTGCAGGCTGCGGGTGG - Intergenic
910459836 1:87436989-87437011 GCTACTCTGCAGGCTGTGGTGGG + Intergenic
911854066 1:102854548-102854570 ACCGATCAGCAGGATGTGGGTGG + Intergenic
912008289 1:104930950-104930972 AGTGGAATGCAGGGTGTGGGTGG + Intergenic
912350152 1:109004900-109004922 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
912684345 1:111750168-111750190 TCTGGTCTGAAGCCTGAGGGAGG + Intronic
913135686 1:115886534-115886556 GCTGGTCTGGAGGCTGAGGCAGG + Intergenic
913178539 1:116297666-116297688 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
913522020 1:119653642-119653664 ACTGGTCTGTGAGCTATGGGAGG - Intergenic
915562009 1:156693037-156693059 ACAGGGCTGTGGGCTGTGGGGGG - Intergenic
915701798 1:157803600-157803622 ACTGTGCTGGAGGGTGTGGGGGG - Intronic
917032908 1:170714619-170714641 TCTGCTCTGCATCCTGTGGGAGG - Intronic
917095901 1:171398570-171398592 AATGTTTTGCAGGCAGTGGGTGG + Intergenic
917139430 1:171820236-171820258 GATTGTCTGAAGGCTGTGGGGGG + Intergenic
917708935 1:177664813-177664835 GCTAGTCTGCAGGCTGAGGCAGG + Intergenic
917992318 1:180394203-180394225 ACTACTCTGGAGGCTGTGGTGGG - Intronic
918994000 1:191732470-191732492 ACTAATCAGCAGGATGTGGGTGG + Intergenic
919167818 1:193918387-193918409 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
920494503 1:206445170-206445192 ACAGCTCTGCAGGCTGTGTTGGG + Intronic
920881913 1:209888601-209888623 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
921166017 1:212507626-212507648 ACTGGTATGGAGGGTCTGGGTGG + Intergenic
921354780 1:214275722-214275744 ACCGATCAGCAGGATGTGGGCGG - Intergenic
921835904 1:219778516-219778538 AATGGCCTGCAGGCTGAGAGTGG - Intronic
922056953 1:222050512-222050534 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
922392515 1:225159981-225160003 ACTGGAATGCAGGGTGTGGTAGG - Intronic
923288802 1:232524170-232524192 ACTGTACTGGATGCTGTGGGTGG + Intronic
923324694 1:232871079-232871101 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
923498892 1:234548400-234548422 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
923592917 1:235336100-235336122 ACTTGTCTGGAGGCTGGGCGTGG + Intronic
924383360 1:243482926-243482948 TGTGGTTCGCAGGCTGTGGGGGG + Intronic
1063383939 10:5604207-5604229 ACTGGTTTGCCTTCTGTGGGGGG + Intergenic
1063455025 10:6176965-6176987 ACTGGGCTCCAGGATGTGGGTGG + Intronic
1063491237 10:6465393-6465415 GGTGGTCTTCAGGCTGTGGTGGG + Intronic
1063859414 10:10291417-10291439 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1065188263 10:23189715-23189737 ACTAGCCTGCAGGCTCTGGGTGG - Intergenic
1065309026 10:24396223-24396245 ACTAGTCGGGAGGCTGTGGCAGG + Intronic
1065590495 10:27257448-27257470 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1065896007 10:30163578-30163600 ACCGATCAGCAGGATGTGGGTGG + Intergenic
1066536059 10:36393361-36393383 GCTGCTCTGCAGGCTGAGGCAGG + Intergenic
1066575593 10:36820790-36820812 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1066590449 10:36988845-36988867 ACTAATCAGCAGGATGTGGGTGG - Intergenic
1066598323 10:37076764-37076786 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1067094137 10:43287215-43287237 GCTGTGCTGCAGGCTCTGGGAGG + Intergenic
1067707484 10:48620680-48620702 ACTGGCCCATAGGCTGTGGGTGG + Intronic
1067999611 10:51316978-51317000 ACTGGCCTGCAGATTGTGTGTGG - Intronic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068483291 10:57623192-57623214 ACTGGGCTGCAGGCTTTATGTGG - Intergenic
1069606108 10:69739769-69739791 GGTGGACTGCAGGCTGTAGGAGG - Intergenic
1072147522 10:92655578-92655600 GCTGGACTTCAGGCTGTGTGAGG - Intergenic
1074855225 10:117468481-117468503 TCGGGTCTGCAGGCCCTGGGAGG - Intergenic
1075419636 10:122291158-122291180 ACTGAACTGGAGGATGTGGGCGG - Exonic
1075715155 10:124551444-124551466 CCTGCTCTGCAGGGTGGGGGCGG + Intronic
1076267366 10:129119203-129119225 ACTGCACTGCAGCCTGTGTGAGG + Intergenic
1076525238 10:131108555-131108577 ACTGGTCAGCCGCCTGTGTGAGG - Intronic
1076571634 10:131437219-131437241 ACTGGGCTGTGGGCAGTGGGTGG - Intergenic
1076684329 10:132190277-132190299 ACTGGTCTGTAGTGTTTGGGTGG + Intronic
1076702780 10:132282889-132282911 GCTGGTCAGGAGGCGGTGGGGGG + Intronic
1077287693 11:1775092-1775114 TCTGGTCTGCAGGCTTTGGAGGG + Intergenic
1077315383 11:1917373-1917395 AGTGGGGAGCAGGCTGTGGGAGG - Intergenic
1077377758 11:2213182-2213204 ACTGGCCTGCAGGCTATGCCGGG + Intergenic
1077435110 11:2535203-2535225 ACTGGCCTGCAGGCTTTGGGCGG + Intronic
1077700026 11:4432521-4432543 AATGATGTCCAGGCTGTGGGTGG + Intergenic
1078258749 11:9684191-9684213 ACTGCTCAGCAGGCTGAGGTGGG - Intronic
1078771548 11:14357307-14357329 ACTAGTCTGATGGCTGAGGGAGG - Intronic
1078896075 11:15598351-15598373 ACTGGTCTGAATGTTGGGGGTGG - Intergenic
1079756685 11:24273816-24273838 ACCAATCAGCAGGCTGTGGGTGG - Intergenic
1080239863 11:30114552-30114574 ACAGTTCTGCAGGCAGTTGGTGG - Intergenic
1080522868 11:33082891-33082913 GCTACTCTGCAGGCTGTGGTGGG - Intronic
1080556718 11:33423915-33423937 GCTAGTCTGCAGGCTGAGGCAGG + Intergenic
1080627404 11:34042986-34043008 ACTGTTCCACAGGCTGGGGGAGG + Intergenic
1081106728 11:39079210-39079232 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1081154812 11:39677116-39677138 ACTGGCCTGCACACAGTGGGGGG - Intergenic
1081540436 11:44030803-44030825 GCTGGTCTGGAGGCTGGGGTGGG + Intergenic
1082615591 11:55356168-55356190 ATTGGCCTGCAGGCTCTGGGGGG + Intergenic
1083326894 11:61877510-61877532 GCTGGTGTGCATGCAGTGGGCGG - Exonic
1084359259 11:68659182-68659204 AATGGCCCGCAGGCAGTGGGCGG + Intergenic
1084477853 11:69398974-69398996 TCTGGGCAGCAGGATGTGGGGGG + Intergenic
1085278052 11:75312503-75312525 ACTGCTCTGCAAGGTGTGTGTGG + Intronic
1086724747 11:90167897-90167919 ACCAGTCAGCAGGATGTGGGTGG + Intronic
1086798244 11:91136332-91136354 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1088571004 11:111222743-111222765 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1089453710 11:118613600-118613622 ACTGGTATCCATGCTGTGGCTGG + Intronic
1089501098 11:118931694-118931716 ACTAGGCTGCAGGCTGTGTGAGG - Intronic
1090671265 11:128947307-128947329 ACTGGGCTGCAGGAAGTGAGTGG - Intergenic
1090688251 11:129149160-129149182 ATTGGCCTCCAGCCTGTGGGTGG - Intronic
1090820317 11:130336367-130336389 GCTAGTCTGGAGGCTGAGGGAGG - Intergenic
1091090648 11:132768390-132768412 AGTGGTCTGGAGGCAGGGGGAGG - Intronic
1091237681 11:134032915-134032937 AGGGGTGTGCACGCTGTGGGAGG + Intergenic
1091309550 11:134562860-134562882 ACTGAGCCCCAGGCTGTGGGTGG + Intergenic
1091358368 11:134955527-134955549 ACTGGGCTGGAGTCTGTGGTGGG + Intergenic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1092113904 12:5985066-5985088 ACTGGTCTGCATTCTGGCGGAGG + Exonic
1092286818 12:7133375-7133397 TCAGGTCTGGAGGCTCTGGGAGG + Intronic
1093741259 12:22692651-22692673 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1093994343 12:25625532-25625554 GCTGGTCTGCTGTCTCTGGGGGG + Intronic
1094696036 12:32819759-32819781 CCTGGTCTGGATTCTGTGGGAGG + Intronic
1095177094 12:39105291-39105313 ACTGGTATGTATGGTGTGGGTGG - Intergenic
1095534105 12:43225210-43225232 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1095776849 12:46018943-46018965 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1095981423 12:47976819-47976841 ACTGGTCTGCAGGGTCTGCCCGG - Exonic
1096692633 12:53330468-53330490 ACTACTCTGGAGGCTGAGGGTGG - Intronic
1098790303 12:74814672-74814694 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1099307927 12:80981587-80981609 ACTGGTCTGCAGCCTGGGGTTGG - Intronic
1101046232 12:100809273-100809295 GCTGCTCTGGAGGCTGAGGGAGG + Intronic
1101160970 12:101976007-101976029 ACTAGACTATAGGCTGTGGGAGG - Intronic
1102983235 12:117258902-117258924 ACTGGCTTTCAGGCTCTGGGAGG + Intronic
1103180028 12:118902759-118902781 ACTGCTCTGGAGGCTGAGGAAGG - Intergenic
1103833706 12:123801581-123801603 ACTGATCTCCAGGCTGTCGTTGG + Intronic
1103903477 12:124315481-124315503 ACAGGAATGCAGGCTGAGGGCGG - Exonic
1104402608 12:128489089-128489111 ACTGGTCCCCGGGCAGTGGGCGG + Intronic
1104959004 12:132479363-132479385 GTTCCTCTGCAGGCTGTGGGAGG + Intergenic
1105534054 13:21247701-21247723 CCTGGTCTGCAGGGAGGGGGTGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106221168 13:27747628-27747650 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1107003828 13:35584609-35584631 ACTACTCTGGAGGCTGAGGGAGG - Intronic
1107176504 13:37405703-37405725 ACAGGTCTGGAGGCTGAGCGAGG + Intergenic
1107833445 13:44394779-44394801 ACTGGTCTGCATGCTGGGACAGG + Intronic
1109065433 13:57682655-57682677 AGTAGTCTGCAGGCTTTGTGTGG + Intronic
1109340600 13:61053347-61053369 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1112436482 13:99394442-99394464 GCTGGTCAGCAGGCAGAGGGAGG - Intergenic
1115533132 14:34345390-34345412 ACCGATCAGCAGGATGTGGGTGG - Intronic
1115889067 14:38006811-38006833 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
1116085399 14:40231014-40231036 CCTGCTCTCCAAGCTGTGGGTGG - Intergenic
1117963917 14:61188358-61188380 CTCGGTTTGCAGGCTGTGGGCGG - Intronic
1118303586 14:64636218-64636240 ACTTATGTGAAGGCTGTGGGTGG + Intergenic
1118310967 14:64692758-64692780 TCTAGGCTGGAGGCTGTGGGTGG + Intergenic
1119270910 14:73303466-73303488 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1122547690 14:102533462-102533484 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
1122641211 14:103160733-103160755 GTTGGGGTGCAGGCTGTGGGGGG - Intergenic
1122641265 14:103160891-103160913 ATTGAGGTGCAGGCTGTGGGGGG - Intergenic
1122784185 14:104156348-104156370 CCTGGCCTGCAGGCTGCTGGTGG + Intronic
1123040532 14:105488459-105488481 CCTTCTCTGCAGGCTTTGGGCGG + Exonic
1124211380 15:27767742-27767764 ACTAATCAGCAGGATGTGGGTGG + Intronic
1124377828 15:29139903-29139925 TCTGCTCTGCAGGCTGGGGCTGG + Intronic
1125472866 15:40021629-40021651 TCAGGCCTGCATGCTGTGGGAGG - Intronic
1126821148 15:52505314-52505336 ACAAGTCGGCAGGCAGTGGGCGG - Intronic
1128663545 15:69521576-69521598 TCTGGTCTGCATGCTGTGGGTGG - Intergenic
1128818375 15:70630418-70630440 ACTGGTGGACAGGCTGTGGAAGG + Intergenic
1131112845 15:89776334-89776356 GCCGGGCTGCAGGCTCTGGGAGG - Intronic
1131198358 15:90375341-90375363 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1131556812 15:93406755-93406777 GCTGCTCTGGAGGCTGTGGCGGG + Intergenic
1131674591 15:94659334-94659356 AATGCTCAGCAGGCTGTGGTCGG - Intergenic
1133109248 16:3535980-3536002 AGTGGCAAGCAGGCTGTGGGAGG - Intronic
1133191284 16:4135445-4135467 ACTACTCTGCAGGCTGAGGCAGG - Intergenic
1133222729 16:4325823-4325845 GCTGCTCTGCAGGCTGAGGCAGG + Intronic
1134056801 16:11175185-11175207 ACTGATCTGCAGGCCTAGGGTGG - Intronic
1134206776 16:12244495-12244517 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1134744873 16:16580256-16580278 GCTACTCTGGAGGCTGTGGGAGG + Intergenic
1134755013 16:16659430-16659452 ACTACTCTGGAGGCTGTGGTGGG - Intergenic
1134991050 16:18699743-18699765 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1135066775 16:19316859-19316881 AATGGTCCCTAGGCTGTGGGAGG - Intronic
1135209675 16:20513927-20513949 ACGGGTCTGCAGGTTGTCTGGGG + Intergenic
1135338905 16:21629788-21629810 ACCAATCAGCAGGCTGTGGGTGG - Intronic
1135409345 16:22221360-22221382 ACTGCTCTGGAGGCTGAGGCGGG + Intronic
1135528201 16:23229957-23229979 ACTACTCTGCAGGCTGAGGTGGG - Intergenic
1135685836 16:24497743-24497765 ACAGTTCTGCAGGCTGTAGAGGG - Intergenic
1138459927 16:57142159-57142181 ACTAGACTGCAGGCTCTGGGAGG - Intronic
1138586313 16:57972550-57972572 ACTGGTCAGGAGGCTGCGGAGGG + Intergenic
1138688072 16:58743648-58743670 AATGGTTTGCAGGAGGTGGGAGG - Intergenic
1139470067 16:67173689-67173711 ACTTGTCTGCAAGCTGGGTGTGG + Intronic
1139481030 16:67230821-67230843 TCTTGTCTACAGGGTGTGGGGGG - Intronic
1139673620 16:68508586-68508608 GCTGGTGTCCAGGCTGTGAGTGG + Intergenic
1140548372 16:75834980-75835002 ACCGGTCTGCAGCCTGGAGGTGG + Intergenic
1142550657 17:736942-736964 ACAGGTCTGGAGGCTGGGCGTGG - Intronic
1142927997 17:3258192-3258214 ACTGGTCTGCAGACTCCAGGAGG + Intergenic
1142987082 17:3702399-3702421 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1143552864 17:7641795-7641817 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1143695357 17:8611216-8611238 ACTGGGCTTCACGCTGTGTGAGG - Intronic
1144912781 17:18696749-18696771 GCTATTCTGGAGGCTGTGGGAGG + Intergenic
1145278246 17:21449130-21449152 ACTGGGGTGCAGGCTGTGTCAGG - Intergenic
1145316067 17:21735029-21735051 ACTGGGGTGCAGGCTGTGTCAGG - Intergenic
1145714495 17:27006950-27006972 ACTGGGGTGCAGGCTGTGTCAGG - Intergenic
1146282230 17:31552038-31552060 ACTGCTCTGGAGGCTGAGGTGGG + Intergenic
1147153639 17:38532505-38532527 TTTGGTCTGCTGGCTGTGGAGGG - Exonic
1147744379 17:42686246-42686268 CCTGGCATTCAGGCTGTGGGTGG + Intronic
1147770588 17:42865437-42865459 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
1148897527 17:50847938-50847960 TCTGTTCTGCAGGATGGGGGTGG + Intergenic
1150133375 17:62680979-62681001 AGGGGGCTGCAGGCTGGGGGAGG + Intronic
1150451296 17:65271145-65271167 ACTGCTCTGCGGGCTGCGGCGGG + Intergenic
1150580361 17:66468362-66468384 ACTGGGTCGCTGGCTGTGGGAGG + Intronic
1150649069 17:66998196-66998218 AGTGGTCTGCAGGATGTCTGAGG - Intronic
1150968364 17:69998004-69998026 AATGGTCTGCAGTCAGTTGGTGG - Intergenic
1151471108 17:74318327-74318349 ACTGGTGTACCGGCTCTGGGAGG - Intergenic
1151473543 17:74332469-74332491 TGTGGGCTGCAGGCTTTGGGAGG - Intronic
1151549760 17:74815355-74815377 ACAGATCTGCAGGCAGAGGGTGG + Intronic
1152109461 17:78349687-78349709 AGAGGTCTCCAGGGTGTGGGAGG + Intergenic
1152655335 17:81516782-81516804 ACTGGGCAGCTGGCTGTGAGTGG + Intronic
1152657764 17:81527891-81527913 CCTGGGCTGCAGGTTGTGGCTGG + Intergenic
1152795454 17:82304151-82304173 CCCGGTCTCCAGGCTGTGGCAGG - Intergenic
1153198395 18:2625358-2625380 TCTCCTCTGCAGGCTGTGGGAGG + Intergenic
1155294905 18:24376173-24376195 ACCAGTCAGCAGGATGTGGGTGG - Intronic
1159011629 18:63063610-63063632 AGGGGCCTGCAGGGTGTGGGTGG - Intergenic
1159708851 18:71728133-71728155 ACTGGTAAGCATGTTGTGGGTGG + Intergenic
1159809644 18:73002315-73002337 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1160356464 18:78231271-78231293 AATGGGCTGTAAGCTGTGGGTGG + Intergenic
1160448006 18:78942162-78942184 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448017 18:78942210-78942232 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448027 18:78942258-78942280 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448037 18:78942306-78942328 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448055 18:78942401-78942423 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448065 18:78942449-78942471 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448076 18:78942497-78942519 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448113 18:78942687-78942709 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1161006437 19:1939546-1939568 ACTAGTCTGGAGGCTGAGGCAGG - Intergenic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161658309 19:5529687-5529709 CCTGGCCAGCTGGCTGTGGGTGG - Intergenic
1162237867 19:9322363-9322385 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1163103019 19:15108999-15109021 GCTGCTCTGCAGGCAGTGAGGGG + Intronic
1163125818 19:15243632-15243654 ACTGCTCTGGAGTTTGTGGGAGG - Intronic
1164161594 19:22628721-22628743 AGTGGTAGGCAGGCTGTGGGGGG + Intergenic
1164310600 19:24042319-24042341 ACCAATCTGCAGGATGTGGGTGG + Intronic
1164621748 19:29700108-29700130 AGGGGTGGGCAGGCTGTGGGAGG + Intronic
1164776786 19:30858937-30858959 CCAGGCCTCCAGGCTGTGGGAGG + Intergenic
1165861798 19:38912889-38912911 ACTGATCTGGAGGCTGAGGCAGG - Intergenic
1166351781 19:42202306-42202328 ACTGGAGTGCAGGGTATGGGGGG - Intronic
1167337013 19:48892779-48892801 ACTGTTCTGCTGGCTGGGCGCGG - Intronic
1167373917 19:49101308-49101330 CCTGGTGTGCAGGCTGTTGTGGG + Intronic
1167868970 19:52351658-52351680 CCTGCTCTGCAGCCTGTGTGAGG + Intronic
925154214 2:1637729-1637751 CCTGGTCTCTAGGCTGTGGAGGG + Intronic
925270335 2:2601521-2601543 ACTGGTCTGAAGGCCCTGCGTGG + Intergenic
926345881 2:11944450-11944472 GCTGGTCAACAGGCAGTGGGTGG + Intergenic
926394387 2:12426198-12426220 AATGGATGGCAGGCTGTGGGTGG + Intergenic
927111855 2:19869307-19869329 GCTGGGCGGCAGGCTGTGGGGGG - Intergenic
928379212 2:30803348-30803370 TCTGGTCTGCAGGCTGGGACAGG + Intronic
929629801 2:43447723-43447745 ACTAGTCTTAAGGCTATGGGAGG - Intronic
930338631 2:50083652-50083674 ACCGATCAGCAGGATGTGGGTGG - Intronic
931562638 2:63579201-63579223 ACTGGCCTCCAGACTGTGTGAGG - Intronic
931832449 2:66066687-66066709 CCTGGGATCCAGGCTGTGGGAGG + Intergenic
932167822 2:69524321-69524343 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
936384538 2:112017120-112017142 ACTAATCAGCAGGATGTGGGTGG - Intronic
936457499 2:112686575-112686597 ACTGTGCTTCAGGCTGTGGAAGG - Intergenic
937089563 2:119196832-119196854 GCTGGTCCTCAGGCAGTGGGAGG + Intergenic
937095203 2:119230827-119230849 GCTGGCGTGCAGGCTGCGGGAGG + Exonic
937251621 2:120527602-120527624 TCTGATGTGCAGGCTGGGGGTGG + Intergenic
937439066 2:121901775-121901797 ACAGTTCTGGAGGCTCTGGGGGG + Intergenic
938015852 2:127866653-127866675 TCTGCCCTGCAGGCTGTGGATGG - Intronic
938252635 2:129827603-129827625 GCTCCTCTGCTGGCTGTGGGCGG - Intergenic
939123898 2:138152077-138152099 ACTGCTCAGGAGGCTGTGGCAGG + Intergenic
941878333 2:170457864-170457886 ACTGCTCAGGAGGCTGAGGGAGG - Intronic
943744560 2:191448217-191448239 ACCGATCAGCAGGATGTGGGTGG + Intergenic
943899364 2:193412424-193412446 ACCGATCAGCAGGATGTGGGTGG - Intergenic
943947765 2:194090119-194090141 ACGGATCAGCAGGATGTGGGTGG - Intergenic
944051673 2:195476884-195476906 GCTGTTCTGCAGGCTGAGGTGGG - Intergenic
944237176 2:197451110-197451132 ACCAATCAGCAGGCTGTGGGTGG + Intergenic
944555338 2:200882786-200882808 ACTACTCTGGAGGCTGAGGGAGG + Intronic
944974982 2:205039758-205039780 ACTGGTCAGCAGGCTGAGTGTGG - Intronic
945437386 2:209834990-209835012 ACTGCTCTGGAGTCTGTGAGGGG - Exonic
945840337 2:214880207-214880229 ACTGCTCTGCCAGCTGTGAGTGG + Intergenic
946247316 2:218395077-218395099 ACTGGCCTGCTGGATGTGGAGGG + Exonic
946707466 2:222472704-222472726 ACTGGTCTGCTCCCTGTTGGGGG - Intronic
947382468 2:229558658-229558680 ACTGGGCTGCAGGATGGGGTGGG + Intronic
947842005 2:233213783-233213805 AATGGTTTGCAGGCAGAGGGTGG + Intronic
948510260 2:238459152-238459174 AATGATCTGCAGGCTGGAGGAGG + Intergenic
948817832 2:240522071-240522093 ACCAGTCAGCAGGATGTGGGCGG - Intronic
949048794 2:241885877-241885899 GCAGGGCTGCAGGCTGTGGACGG + Intergenic
1168890394 20:1292215-1292237 ACTGGTGGAAAGGCTGTGGGTGG + Intronic
1169488940 20:6055494-6055516 AAAGATCTTCAGGCTGTGGGTGG - Intergenic
1170369736 20:15635954-15635976 GCTGGTCAGCAGGCTGAGGCAGG + Intronic
1170665583 20:18383143-18383165 ACTGGGCAGCTGTCTGTGGGAGG - Intergenic
1170753256 20:19171467-19171489 ACAGGTCTGCAGGTTGGGTGGGG - Intergenic
1171270302 20:23811787-23811809 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1171318713 20:24220198-24220220 ACCAATCTGCAGGATGTGGGTGG - Intergenic
1171415556 20:24978052-24978074 ACTGTTCTCCAGGCAGTGGGTGG - Intronic
1172187742 20:33041830-33041852 CCTGGTCTGAAGGCTGTAGAGGG + Intronic
1172320563 20:33993140-33993162 TCAAATCTGCAGGCTGTGGGCGG - Intergenic
1172512775 20:35512142-35512164 ACTGGACTGTAGGCTGTCTGTGG - Exonic
1172691894 20:36795967-36795989 ACTGGAGTTCAGGCTGTCGGAGG - Intronic
1173716823 20:45215171-45215193 GCTGGTCGGGAGGCGGTGGGGGG + Intergenic
1173734511 20:45349618-45349640 ACTGCTCTGGAGGCTGAGGCAGG + Intergenic
1173811238 20:45957180-45957202 TGGGGTCTGCAGGCTGTAGGAGG + Intronic
1174447521 20:50600646-50600668 ACTAGTCAGGAGGCTGAGGGGGG + Intronic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176089817 20:63313791-63313813 GCTGACCTGCAGGCTGTCGGGGG - Exonic
1176231984 20:64037463-64037485 GCTGGTCTGCAGGCTCTTGGGGG - Intronic
1176245737 20:64095588-64095610 TCTGTTCTTCAGGCAGTGGGGGG + Intronic
1177565231 21:22811431-22811453 ACTATTCTGCAGGCTGAGGTGGG + Intergenic
1177967925 21:27751469-27751491 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179187802 21:39097987-39098009 AGTGACCTGCAGGCTGTGGTTGG - Intergenic
1180222851 21:46370287-46370309 TCTGGTCTGCAGGCAGTGAGTGG + Intronic
1180658046 22:17441058-17441080 ACTACTCTGGAGGCTGTGGCAGG - Intronic
1181665467 22:24392874-24392896 ACAGGTCTGGTGGCTGTTGGCGG + Intronic
1182148139 22:28010090-28010112 ATAGGACTGCAGCCTGTGGGCGG + Intronic
1183120615 22:35727472-35727494 TGTGGTCTGCAGGCTCTGGCAGG + Intronic
1183250610 22:36727544-36727566 ACCGGTCTGAAGGATCTGGGAGG - Intergenic
1183407844 22:37639343-37639365 TCGGGTCTGCAGGCTGCGGGTGG + Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184096533 22:42319213-42319235 ACTTGGCTGGGGGCTGTGGGAGG + Intronic
1184654723 22:45935349-45935371 GCTGGGCTGCAGGCAGTGGTGGG - Intronic
949259149 3:2084706-2084728 ACAGATCAGCAGGATGTGGGTGG + Intergenic
949332915 3:2942051-2942073 ACTGGCCTGTAAGCTGTGTGAGG + Intronic
949395440 3:3609949-3609971 ACTGGTAGGCAGGATTTGGGTGG - Intergenic
949431354 3:3979496-3979518 ATTGTTCTCAAGGCTGTGGGGGG + Intronic
950212805 3:11136386-11136408 ACTGAGGTGCAGGCTGTGTGTGG - Intergenic
950432940 3:12961536-12961558 AAAGGGCTGCAGGCTGTTGGTGG - Intronic
950518667 3:13483378-13483400 CCAAGTCTGCAGCCTGTGGGAGG + Intronic
951079629 3:18437727-18437749 AGTGATCTCCAGACTGTGGGAGG - Intronic
951208632 3:19949752-19949774 AATGGCCTGCAGGCTGGGCGTGG + Intronic
952011159 3:28902657-28902679 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
952965244 3:38617015-38617037 ACTGATTTAGAGGCTGTGGGAGG - Intronic
953117431 3:40006968-40006990 ACTGCTCTGGAGGCTGAGGTGGG - Intronic
953136815 3:40188947-40188969 ATTGATCTGCATGCTGGGGGTGG - Intronic
953245586 3:41188411-41188433 ACTTGTCTACAGGGTGTGGGTGG + Intergenic
953403873 3:42650793-42650815 ACTCGTCTGCAGGCTGGGAAGGG - Intergenic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
954477450 3:50761442-50761464 AGTGGGCTGCAGTCTGTGTGAGG + Intronic
955770760 3:62382662-62382684 ACTTGTCTGCAGTTTCTGGGTGG - Intergenic
956052718 3:65265738-65265760 ACTGGTCAGAGGTCTGTGGGAGG - Intergenic
956110396 3:65864699-65864721 ACCTGCCTCCAGGCTGTGGGAGG + Intronic
957411820 3:79851284-79851306 ACTGCTCTGGAGGCTGAGCGAGG - Intergenic
959969014 3:112387383-112387405 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
960005520 3:112777273-112777295 TCTGGTGTGCAGGCAGTGGGGGG + Intronic
960831505 3:121854202-121854224 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
960868449 3:122226553-122226575 ACTAATCAGCAGGATGTGGGTGG - Intronic
962383648 3:134915964-134915986 ACCAGTCAGCAGGATGTGGGTGG - Intronic
962998263 3:140652311-140652333 GCAGGTCAGCAGGATGTGGGTGG + Intergenic
963627827 3:147695250-147695272 ACTGGAATGCAGGGTTTGGGTGG + Intergenic
965722343 3:171675952-171675974 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
967166404 3:186783636-186783658 ACAGGTATGCAGTCTGTTGGCGG + Exonic
967233989 3:187367262-187367284 ACCAATCTGCAGGATGTGGGTGG - Intergenic
968161172 3:196428340-196428362 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
968525011 4:1052315-1052337 GCTGTGCTGCAGGCAGTGGGGGG - Intergenic
968674180 4:1868639-1868661 ACTACTCAGCAGGCTGAGGGGGG - Intergenic
968726145 4:2248674-2248696 CCTGCCCTGCAGGCTGTAGGGGG - Exonic
968858902 4:3150744-3150766 ACCGGACTGCAGGCCGTGCGTGG + Intronic
968939533 4:3630844-3630866 GCTTTGCTGCAGGCTGTGGGCGG + Intergenic
969066384 4:4485014-4485036 TCTGGTCTGGAGGCTGTGTGTGG + Intronic
970632443 4:17964721-17964743 GCTGGACTTCAGGCTGTGAGTGG - Intronic
971028714 4:22613566-22613588 ACTGCTCTGCTGGAGGTGGGAGG - Intergenic
971322078 4:25613776-25613798 ACCAGTCAGCAGGATGTGGGCGG - Intergenic
971385785 4:26139502-26139524 ACTGAGCTGCAGGCTGTGACTGG - Intergenic
971793873 4:31201926-31201948 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
972427169 4:38944502-38944524 ACTGGTCTGTGGCCTGGGGGTGG - Exonic
972466883 4:39366144-39366166 CCTGGTATGCAGGGTGGGGGAGG - Intronic
973048708 4:45567924-45567946 ACCGATCAGCAGGGTGTGGGTGG + Intergenic
973854230 4:54994280-54994302 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
976690474 4:87863121-87863143 ACTAATCAGCAGGATGTGGGTGG - Intergenic
976736156 4:88312491-88312513 ACTAATCAGCAGGATGTGGGTGG - Intergenic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
977595854 4:98879002-98879024 ACTGGTATGTTGGCAGTGGGTGG - Intronic
977641312 4:99360763-99360785 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
977929855 4:102738444-102738466 ACTGGCCTGCAGGCTGATGCTGG - Intronic
978292055 4:107153071-107153093 TCTGATTTGCAGGCTGCGGGTGG + Intronic
978535507 4:109757553-109757575 TTTGGTCAGCAGGCTGTGGATGG + Intronic
982036758 4:151353490-151353512 ACCGATCGGCAGGATGTGGGCGG - Intergenic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
982922163 4:161289534-161289556 ACTGCTCTGAAGGCTGAGGCAGG + Intergenic
983425822 4:167582261-167582283 ACCAATCAGCAGGCTGTGGGTGG + Intergenic
983566978 4:169163709-169163731 ACTGGTTTGCTTGCTGAGGGTGG - Intronic
984728797 4:183046175-183046197 ACTAATCAGCAGGATGTGGGTGG + Intergenic
985631901 5:1018197-1018219 ACTGGTCTCTGTGCTGTGGGAGG + Intronic
985664155 5:1173190-1173212 ACCAGTCAGCAGGATGTGGGCGG - Intergenic
985702152 5:1380110-1380132 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
985850275 5:2383507-2383529 ATTGTTCTGTAGGCTGTGGGGGG + Intergenic
986306958 5:6523147-6523169 CCTGGCCCTCAGGCTGTGGGTGG + Intergenic
987001872 5:13668121-13668143 ATTGGACTGCAAGCTGGGGGTGG - Intergenic
987290634 5:16505313-16505335 CCTGGCGTGCAGGCTGGGGGAGG - Intronic
988551230 5:32202953-32202975 ACTGCTCTGGAGGCTGAGGTGGG - Intergenic
988860123 5:35268711-35268733 AATGTTTTGCAGGCTGGGGGTGG + Intergenic
989678990 5:44007153-44007175 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
990010748 5:50994666-50994688 ACTGTTCTGCAGCCTATTGGTGG - Intergenic
990367313 5:55084490-55084512 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
993032023 5:82715686-82715708 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
993562851 5:89433130-89433152 ACTGGACTACAGCCTGTAGGAGG + Intergenic
994841518 5:104929760-104929782 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
995651773 5:114377537-114377559 ACTGTCCAGCAGGGTGTGGGTGG + Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997522161 5:134529894-134529916 ACTGGTCTGGAGGGTGGGTGTGG + Intronic
998167660 5:139853505-139853527 ACTGGCCTGCAGGCTTCAGGAGG - Intronic
999671275 5:153960763-153960785 GCTGGTTTGCAGATTGTGGGTGG - Intergenic
1000022257 5:157328227-157328249 GCTGGACTGCAGGCTGTGTGAGG - Intronic
1001620226 5:173077682-173077704 AGTGTTCTGGAGGCTGGGGGTGG - Intronic
1002405347 5:179025803-179025825 ACTGCTCTGGAGGCTGAGGCAGG + Intronic
1002810299 6:621762-621784 ACCGGTCAGCAGTCTCTGGGAGG + Intronic
1004914544 6:20319634-20319656 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1005681067 6:28208457-28208479 ACTGGTCTGAAGGCTCTGGGTGG - Intergenic
1006923052 6:37638748-37638770 ACAGGGCTGCAGGCTATGGTGGG - Intronic
1007128526 6:39447966-39447988 ACTGGTCAGCGGGCTGTGAGCGG + Intronic
1007704204 6:43781169-43781191 ACTCGTCTGGAAGCTGAGGGTGG + Intronic
1008038927 6:46775484-46775506 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1009615403 6:65999056-65999078 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1011457029 6:87562074-87562096 ACTGCTCTGGAGGCTGAGGTGGG - Intronic
1013808407 6:114017882-114017904 AATGTTTTGCAGGCAGTGGGTGG + Intergenic
1013963302 6:115927481-115927503 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1014012463 6:116492099-116492121 ACTGGGCTGTAGACTCTGGGTGG - Intergenic
1016858796 6:148697639-148697661 ACCGATCAGCAGGATGTGGGTGG - Intergenic
1018733856 6:166672989-166673011 CCTGACCTGCAGGCTCTGGGTGG + Intronic
1019354218 7:570517-570539 ACTGCTGGGCAGGCAGTGGGGGG - Intronic
1020008394 7:4794257-4794279 ACCAGTCAGCAGGATGTGGGTGG + Intronic
1020022676 7:4878426-4878448 ACTGCTCTGAAGGCTGAGGCTGG + Intronic
1020784303 7:12555656-12555678 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1021520590 7:21536116-21536138 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG + Intergenic
1022474559 7:30701456-30701478 ACTGTTCTCCAAGCTCTGGGAGG + Intronic
1023834995 7:44062713-44062735 GCTGGACTCCAGGCTGTTGGGGG + Exonic
1026509144 7:71013468-71013490 ACTGCACTCCAGCCTGTGGGGGG + Intergenic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027659705 7:80974767-80974789 ACCAATCAGCAGGCTGTGGGTGG - Intergenic
1028563488 7:92201875-92201897 TCTGTGCTGCAGGCTGTGTGAGG - Intronic
1028842208 7:95440836-95440858 ACTCTTCTGCAGGCTGAGGTGGG + Intergenic
1029807272 7:103010370-103010392 GCTGGTCTGTAGGCTGTAGCAGG - Intronic
1029809519 7:103033836-103033858 ACCGATCAGCAGGATGTGGGTGG - Intronic
1030795686 7:113784393-113784415 ACAGTTCTGCAGGGTTTGGGAGG + Intergenic
1032438242 7:131920106-131920128 ACCCGTCTGCAGCCTGGGGGTGG + Intergenic
1032469149 7:132165424-132165446 TTTGGGCAGCAGGCTGTGGGTGG + Intronic
1034405889 7:150902188-150902210 GCTGGACTGCAGGGTGGGGGTGG + Intergenic
1034490962 7:151392828-151392850 ACTGGTCAGAAGGTTCTGGGAGG - Intronic
1035038685 7:155911815-155911837 ACGGGAGTGCAGGCTTTGGGAGG + Intergenic
1036555645 8:9857310-9857332 ACTGCTCTGGAGGCTGAGGCAGG - Intergenic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1037521373 8:19683303-19683325 ACTGGCCCCCAGGCTGTGGGAGG - Intronic
1039068874 8:33632576-33632598 ACCAGTCAGCAGGATGTGGGTGG + Intergenic
1040877876 8:52171911-52171933 ATTGCTCTGCAGGCTGAGCGAGG - Exonic
1041263498 8:56042232-56042254 ACTAGTCTGGAGGCTGAGGCAGG - Intergenic
1047268069 8:123327018-123327040 ACTGCTCTGGAGGCTGAGGCAGG - Intronic
1047309732 8:123682055-123682077 ATTGGCCTGCAGGCTGTAGTTGG + Intronic
1047341238 8:123982431-123982453 ATTTGTCTACAGGCTGTTGGAGG + Intronic
1047502536 8:125453368-125453390 GCTCTTCTGGAGGCTGTGGGAGG + Intergenic
1048762291 8:137808495-137808517 GCTGCTCTGGAGGCTGAGGGAGG - Intergenic
1048952123 8:139505046-139505068 AGTGGTCTGCAGGCTTTATGAGG - Intergenic
1048952579 8:139508513-139508535 ACTTGTGTGCATGCTGTGTGGGG - Intergenic
1048978555 8:139689991-139690013 ACTGGTCTGCAGGCTGATGGGGG - Intronic
1048987533 8:139742734-139742756 TCTGATCTGCAGGCTGGGTGGGG + Intronic
1049079969 8:140434856-140434878 ACTAGTCAGGAGGCTGAGGGAGG + Intronic
1050253174 9:3767391-3767413 ATTTGTCTCCAGTCTGTGGGTGG + Intergenic
1050422367 9:5478979-5479001 GCTACTCTGGAGGCTGTGGGTGG - Intergenic
1050548620 9:6729996-6730018 ACTACTCTGCAGGCTGAGGCAGG + Intronic
1050868855 9:10540139-10540161 ACTACTCTGGAGGCTGAGGGAGG - Intronic
1051170018 9:14312984-14313006 ACTGCGCTGCAGGCGGTGGGCGG - Intronic
1052526017 9:29621228-29621250 ACTGCTCTGGAGGCTGAGGCAGG + Intergenic
1052994984 9:34547187-34547209 ACTGGTCTGGAGGATGTCTGAGG - Intergenic
1053318428 9:37073151-37073173 ACTGGCCTGCAGGCCGGGTGTGG - Intergenic
1054451235 9:65404488-65404510 GCTTTGCTGCAGGCTGTGGGTGG - Intergenic
1054819269 9:69505725-69505747 ACTGGTCTTCAGGCCGGGTGTGG + Intronic
1055381384 9:75710745-75710767 ACAGGTCTGCAGGCCCTGAGAGG - Intergenic
1056492068 9:87118129-87118151 GCTGCTCTGCAGGCTGAGGCAGG - Intergenic
1056799647 9:89682004-89682026 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1057285471 9:93750070-93750092 ACAGTTCTGCATGGTGTGGGAGG + Intergenic
1057300956 9:93881767-93881789 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1057457878 9:95230810-95230832 ACTAATCAGCAGGATGTGGGCGG - Intronic
1058065048 9:100539785-100539807 ACCAATCTGCAGGATGTGGGTGG - Intronic
1058390916 9:104494768-104494790 ACTGAACTGGAGGCTGTGTGGGG - Intergenic
1058838768 9:108884967-108884989 ACTACTCTGGAGGCTGAGGGGGG + Intronic
1059879835 9:118677990-118678012 ACTGGGCGGCAGGCTGGGCGGGG + Intergenic
1061379121 9:130243732-130243754 AGTGCTTGGCAGGCTGTGGGAGG - Intergenic
1061859906 9:133462667-133462689 GCCAGGCTGCAGGCTGTGGGTGG + Intronic
1062470524 9:136701639-136701661 ACGGGTCTGGAGGCTGGGGGTGG + Intergenic
1062554420 9:137107521-137107543 GCCTGTCTGCTGGCTGTGGGCGG - Exonic
1062692527 9:137850275-137850297 AATGTTTTGCAGGCAGTGGGTGG - Intronic
1185706464 X:2270974-2270996 ACCAGTCAGCAGGATGTGGGCGG + Intronic
1185748841 X:2594149-2594171 GCTGGTCTGGAGGCTGAGGTGGG - Intergenic
1187010489 X:15273636-15273658 ACCAATCTGCAGGATGTGGGCGG + Intergenic
1187471495 X:19573770-19573792 ACTGGTTTGCAGGCCAGGGGTGG + Intronic
1187681384 X:21770846-21770868 AATGGTGTGGAGGCTGTTGGGGG + Intergenic
1191167605 X:57406736-57406758 GCTGGTCTGCACTCTGTGGCAGG + Intronic
1191618502 X:63192006-63192028 ACCAGTCAGCAGGATGTGGGTGG - Intergenic
1194916762 X:99717546-99717568 TCTGGCCTGGAGGCTGTGTGTGG - Intergenic
1196700645 X:118664181-118664203 GCTGATTTGCTGGCTGTGGGAGG + Intronic
1200051755 X:153435957-153435979 ATTGTTCTCCATGCTGTGGGTGG + Intergenic
1200214652 X:154362327-154362349 CGTGGCCTGCAGGCAGTGGGAGG + Exonic
1200243025 X:154507648-154507670 CTTGGTCTGGAGGCTGTGGGAGG - Intronic
1200960111 Y:8988722-8988744 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1201403396 Y:13627624-13627646 ACCGATCAGCAGGATGTGGGTGG + Intergenic
1201676839 Y:16595525-16595547 ACCAATCAGCAGGCTGTGGGCGG + Intergenic