ID: 1027437373

View in Genome Browser
Species Human (GRCh38)
Location 7:78178291-78178313
Sequence CGGCTAGTCACTATTATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027437373_1027437376 -8 Left 1027437373 7:78178291-78178313 CCTGGAATAATAGTGACTAGCCG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1027437376 7:78178306-78178328 ACTAGCCGAGGGCACTACTGAGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027437373 Original CRISPR CGGCTAGTCACTATTATTCC AGG (reversed) Intronic
906253897 1:44332736-44332758 TGGCTCCTCACTAGTATTCCCGG - Intronic
908404320 1:63799170-63799192 GTGCCAGTCACTATTATTCCAGG - Intronic
909091396 1:71230336-71230358 CTGCTAGTCAGTATTATTTCCGG + Intergenic
910895682 1:92066912-92066934 CGTCTAGTCACTTTTAAACCAGG + Intergenic
1067956854 10:50801084-50801106 AAGCTAGTCATTATTATGCCAGG - Exonic
1090483133 11:127085810-127085832 CAGCCAGTCACTTTTATTTCGGG - Intergenic
1096741865 12:53699450-53699472 CGGGTAGTTACTATCATTGCTGG + Intergenic
1103402665 12:120653972-120653994 CGGCCAGTCACTGTTATCTCAGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1108965379 13:56292028-56292050 CAACTAATCACTTTTATTCCTGG - Intergenic
1110843263 13:80166733-80166755 CTACTAGTCACTATTATTGGTGG - Intergenic
1115156908 14:30351633-30351655 GGGCTAGTCTCTATTAATTCAGG + Intergenic
1117335516 14:54754256-54754278 AGGGGAGTCACTATTATTCTAGG - Intronic
1144135080 17:12287112-12287134 CTGCTAGCCACTATTTTTACAGG + Intergenic
1164538941 19:29107851-29107873 CTGCTTGTCACTATTACTTCTGG - Intergenic
1165857295 19:38887410-38887432 CAGAGAGTCACCATTATTCCAGG - Intronic
940835870 2:158521204-158521226 GGGATAGTTACCATTATTCCAGG + Intronic
940878294 2:158920919-158920941 CTTCTAGTCACTGTTACTCCAGG + Intergenic
1170903716 20:20491431-20491453 CAGCCAGTCACTACTATGCCTGG + Intronic
1176406972 21:6375129-6375151 GGGCTGGTCACTATTATACCTGG - Intergenic
954936927 3:54335071-54335093 AGACTAGTTACTATTATTCTTGG + Intronic
967568523 3:190999847-190999869 CATCTAGTCAATATTACTCCCGG + Intergenic
968268244 3:197379089-197379111 GAGCCAGTCACTATTATTACCGG - Intergenic
975184035 4:71380386-71380408 GGGCTATTCACCAATATTCCAGG + Intronic
983899655 4:173120276-173120298 CTGCTTTTCCCTATTATTCCTGG - Intergenic
996085480 5:119300707-119300729 CAGCTAGTCACTGTTAGTGCTGG + Intronic
1000503558 5:162084619-162084641 AGGCTAGTCACTCTTATCCCTGG - Intronic
1001892021 5:175347531-175347553 CTGCTTGTCAGTACTATTCCTGG - Intergenic
1009922929 6:70085230-70085252 TGGCTAGTCACACTTCTTCCTGG - Intronic
1020477201 7:8610851-8610873 CTGCTATTAAATATTATTCCAGG + Intronic
1023741142 7:43281768-43281790 AGGCTAGTCTCTTGTATTCCTGG + Intronic
1027437373 7:78178291-78178313 CGGCTAGTCACTATTATTCCAGG - Intronic
1040432986 8:47362285-47362307 CGGCTAATCACAATCATTACAGG - Intronic
1188220011 X:27530037-27530059 CTGTTAGTCTCTTTTATTCCAGG - Intergenic
1199834783 X:151578402-151578424 TAGCTGGTCAATATTATTCCTGG - Intronic