ID: 1027441041

View in Genome Browser
Species Human (GRCh38)
Location 7:78219503-78219525
Sequence CAGTAGTACGAGAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027441041 Original CRISPR CAGTAGTACGAGAGGCCCTG AGG (reversed) Intronic
906723944 1:48030102-48030124 CAGGAGTGCTAGAGGCACTGGGG - Intergenic
912801503 1:112722590-112722612 CTGTAGTGAGAGAGGCCCTCGGG + Intronic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917704300 1:177616111-177616133 CAGCAGTAAGAGGGGCACTGTGG - Intergenic
917966362 1:180181465-180181487 CAGTAGTCAGAGGGGCCCTTTGG - Intronic
922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG + Intronic
923699314 1:236284583-236284605 CAGCATTGTGAGAGGCCCTGGGG + Intergenic
1064408355 10:15084245-15084267 CAGCAGTCCGTGAGGCCCCGTGG - Intronic
1065618915 10:27558722-27558744 CAGTAACATGAGAGACCCTGTGG + Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1089846340 11:121461444-121461466 CAGTAATAGGAGATGCCCTCTGG - Intronic
1090314589 11:125774018-125774040 CTGTAGTGCGAAAGGCCATGTGG - Intergenic
1097625688 12:61997465-61997487 CAGTGGAAAGAGAGGCCCAGTGG + Intronic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1111685177 13:91492943-91492965 CAGTAGCAAGAGAAGCACTGGGG - Intronic
1112185387 13:97123570-97123592 CAGTTGACCGGGAGGCCCTGAGG + Intergenic
1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG + Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1128772744 15:70294638-70294660 CAGTAGTTGCAAAGGCCCTGGGG + Intergenic
1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG + Intergenic
1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG + Exonic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG + Intronic
1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG + Exonic
1152521765 17:80860533-80860555 AAGTAGTACGTGAGGACTTGGGG - Intronic
1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG + Intergenic
1161208916 19:3056337-3056359 CAGTACTACGAGATGTCCTACGG - Exonic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1168258919 19:55181959-55181981 CAGTGGGACGAGGGACCCTGGGG - Intronic
925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG + Intergenic
926476288 2:13326929-13326951 CTGTAGTACAAGTAGCCCTGAGG - Intergenic
926796475 2:16623523-16623545 CAGTAGGAGGAGAGGTCCTTTGG - Intronic
927735176 2:25514281-25514303 CAGTAGTTGCAAAGGCCCTGAGG + Intronic
933555578 2:83826502-83826524 CAGTAGGACCAGAGTCCCAGAGG + Intergenic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG + Intronic
1169658147 20:7949126-7949148 CAGTCTTACAAGAGGCCCTTAGG - Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1177278173 21:18943166-18943188 CAGTAAGACAAGGGGCCCTGAGG + Intergenic
1181865057 22:25848271-25848293 CAGGGATACGGGAGGCCCTGAGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1185140520 22:49098396-49098418 CAGTATTAGGAGACACCCTGCGG - Intergenic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953923449 3:46967717-46967739 CAGCTGTATGACAGGCCCTGGGG - Intronic
954856996 3:53652657-53652679 CACTACTACCAGTGGCCCTGTGG - Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
989175590 5:38521965-38521987 ATGTACTACGAGAGGGCCTGAGG - Intronic
991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG + Intergenic
997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG + Intergenic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
1001742535 5:174065730-174065752 CAGTAGAACAAGTGGTCCTGTGG + Intronic
1002092198 5:176812112-176812134 GATTAGAAGGAGAGGCCCTGGGG - Intronic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1006732567 6:36247211-36247233 CAGTAGTCTGTGGGGCCCTGAGG - Intronic
1010394671 6:75376828-75376850 AAGTAGTTCAAGAGGCCCAGAGG - Intronic
1011927198 6:92661084-92661106 CATTACTACAAGAGGCCATGAGG - Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1021937415 7:25644923-25644945 GAGTAGGACGAGAGGCTCAGTGG + Intergenic
1022873945 7:34508597-34508619 CTCTAGTACAAGAAGCCCTGGGG + Intergenic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1038333660 8:26629425-26629447 CAGTAGCATTTGAGGCCCTGAGG + Intronic
1038463242 8:27734678-27734700 CTATAGTATGAGAGGTCCTGGGG - Exonic
1040007300 8:42631216-42631238 CAGTGGTATGGGAGGCACTGAGG - Intergenic
1040007651 8:42633633-42633655 CAGTGGTATGGGAGGCGCTGAGG + Intergenic
1047816808 8:128473705-128473727 CAGTGGTATGAGAGGCCCAGGGG - Intergenic
1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG + Intergenic
1048715690 8:137266095-137266117 CAGTAAAAAGAGAGGCCCGGAGG - Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1056516318 9:87353856-87353878 CAATAGTAACAGATGCCCTGGGG - Intergenic
1194482681 X:94446262-94446284 GAGTAGTATGAGAGGCCCACTGG - Intergenic
1202332424 Y:23768860-23768882 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202521304 Y:25697672-25697694 CACTTGTCCCAGAGGCCCTGAGG - Intergenic
1202538345 Y:25901203-25901225 CACTTGTCCCAGAGGCCCTGAGG - Intergenic