ID: 1027442106

View in Genome Browser
Species Human (GRCh38)
Location 7:78230636-78230658
Sequence CCTTATTTATTGAGACTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027442106 Original CRISPR CCTTATTTATTGAGACTTTG AGG Intronic
900024667 1:260690-260712 CCTCATTTAATGAGACACTGGGG + Intergenic
900028276 1:350095-350117 CCTCATTTAATGAGACACTGGGG + Intergenic
900670292 1:3849156-3849178 CCTTAAATATTGATACCTTGGGG - Intronic
902795928 1:18800293-18800315 CCTTACTTCCTGAGACTTGGTGG - Intergenic
905727670 1:40267810-40267832 CCTTATCTCTGGAGACTTTCTGG + Exonic
908638978 1:66201027-66201049 CCTAATTTATTGAGAGTTTTTGG + Intronic
909685607 1:78344947-78344969 CCTAATTTATTGAGAGTTTTTGG - Intronic
909934214 1:81532280-81532302 CCTTATTTATTGGGGCTCTGAGG - Intronic
910385271 1:86675679-86675701 CATTATGGAATGAGACTTTGGGG + Intergenic
910949612 1:92631862-92631884 CCTAATTTATTGAGAGTTTTTGG + Intronic
913398993 1:118407077-118407099 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
915045173 1:153006811-153006833 CCTAATTTATTGAGAGTTTTTGG + Intergenic
915529429 1:156494790-156494812 CCTTATTTCTGGTGACCTTGAGG - Intronic
915704487 1:157831065-157831087 CTTTATCAACTGAGACTTTGGGG - Exonic
916639086 1:166707578-166707600 CCTAATTTATTCAGAGTTTTTGG + Intergenic
916921967 1:169478280-169478302 CCTTATTCAGAAAGACTTTGCGG + Intronic
918717305 1:187806120-187806142 CCTAATTTATTGAGAGTTTTTGG + Intergenic
918954828 1:191193072-191193094 CATTATTTCTTAAGACATTGTGG + Intergenic
919243435 1:194945376-194945398 CCTTATTTATTCACCTTTTGAGG - Intergenic
919647960 1:200115008-200115030 CCTTTTTTATTGAGACTAAATGG + Intronic
920960536 1:210659878-210659900 CCTATTTTATTGAGAGTTTTTGG - Intronic
920992808 1:210956084-210956106 CCTAGTTTATTGAGAGTTTTTGG + Intronic
922186204 1:223277047-223277069 CTTTATTCATTGAAACTGTGGGG - Intronic
922191210 1:223320232-223320254 CGATATTTATTGAGATGTTGGGG - Intronic
1063326814 10:5111895-5111917 CCTAATTTATTGAGAGTTTTTGG - Intronic
1064022005 10:11816644-11816666 AAATATTTATTGAAACTTTGTGG + Intergenic
1065273733 10:24064323-24064345 CCTAATTTATTGAGAGTTTTGGG + Intronic
1066609351 10:37222700-37222722 CCTCATTCATTCAGACTTGGTGG + Intronic
1067194918 10:44108916-44108938 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1069216962 10:65832816-65832838 CATTATCTCTTGAGACCTTGAGG - Intergenic
1069448573 10:68497110-68497132 CCGTATTCATTGAGAAGTTGCGG - Intronic
1069666340 10:70162689-70162711 CCTCATTTGATGATACTTTGTGG + Exonic
1070405225 10:76088440-76088462 AAATATATATTGAGACTTTGAGG + Intronic
1071356212 10:84798767-84798789 CCTTTTTCAGTGAGATTTTGAGG + Intergenic
1071435209 10:85642580-85642602 CTGTATTTATTGAGACTTACTGG + Intronic
1071585169 10:86813284-86813306 CCTTATAAAATGAGACTTTCCGG + Intronic
1072129091 10:92475296-92475318 GCTTGCTTATGGAGACTTTGGGG - Intronic
1072293427 10:93987778-93987800 CCTTCCATATTGAGACTATGTGG - Intergenic
1073202226 10:101744966-101744988 ACTTATTTCTTGAGACTGTCTGG + Intergenic
1073870591 10:107859271-107859293 TCTGATCGATTGAGACTTTGAGG - Intergenic
1073961717 10:108938847-108938869 TTTTATTTATTGGGATTTTGGGG - Intergenic
1075242407 10:120791267-120791289 CCTAATTTATAAAGACTTTTTGG - Intergenic
1076870485 10:133190549-133190571 CCTCACATATTGAGACTTGGAGG + Intronic
1077427902 11:2494528-2494550 CCTAGTTTATTGAGAGTTTTTGG + Intronic
1078680396 11:13470123-13470145 CTTTTTTTTTTGAGAGTTTGTGG - Intergenic
1078726354 11:13935222-13935244 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1078918638 11:15805717-15805739 CCATATTTATGCAGACTTTTAGG + Intergenic
1079640412 11:22797847-22797869 CCTTCTTTATTGTGGTTTTGGGG + Intronic
1079813259 11:25022830-25022852 CCTAGTTTATTGAGAGTTTCTGG + Intronic
1081542590 11:44046851-44046873 TCTGATTTATTGATTCTTTGAGG + Intergenic
1082857125 11:57817948-57817970 CCTTATATATTGAGGCTATGGGG + Exonic
1083005940 11:59346355-59346377 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1086565401 11:88220377-88220399 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1087490489 11:98820771-98820793 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1088293311 11:108264441-108264463 CCTAATTTATTCAGAGTTTTTGG - Intronic
1090521531 11:127485052-127485074 CCTAATTAATTGAGACAATGCGG - Intergenic
1090539371 11:127683762-127683784 CCTTATTTAATGATTCTGTGTGG - Intergenic
1091359432 11:134963935-134963957 CTTCATTTATTGAGTCCTTGTGG + Intergenic
1091854621 12:3729402-3729424 CCTTATTTAAAAAGACTTTGGGG + Intronic
1093687584 12:22074506-22074528 CCTTGTTGATTGTGTCTTTGTGG - Intronic
1094560888 12:31552245-31552267 CCTAATTTATAGAGAGTTTTTGG + Intronic
1094834360 12:34315345-34315367 TCTTAATTATTGCCACTTTGGGG + Intergenic
1097292481 12:57929913-57929935 TCTTATTTAATGACACCTTGGGG + Intergenic
1097726890 12:63085669-63085691 CAATATTTAATGATACTTTGGGG + Intergenic
1098015130 12:66096611-66096633 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1098129632 12:67335799-67335821 CCTTATTTATTTATTTTTTGAGG + Intergenic
1098947722 12:76606943-76606965 CCTCAGTTATTCAGACTTTCTGG - Intergenic
1099748497 12:86738776-86738798 GCTTATTAATTAGGACTTTGGGG + Intronic
1101745157 12:107535239-107535261 CCTAATTTGTTGAGAGTTTAGGG - Intronic
1106549619 13:30760052-30760074 CCTTATTTATTGGAGATTTGTGG + Intronic
1106573937 13:30956995-30957017 CCTTACTAAGAGAGACTTTGTGG + Exonic
1107253570 13:38395160-38395182 AGTTAACTATTGAGACTTTGGGG + Intergenic
1107801632 13:44113773-44113795 TATTATTTATTTTGACTTTGGGG + Intergenic
1108170018 13:47731602-47731624 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1108309680 13:49175878-49175900 CCTAGTTTATTGAGAGTTTTTGG + Intronic
1109598072 13:64583484-64583506 TTATATTAATTGAGACTTTGTGG + Intergenic
1110272053 13:73601922-73601944 CCTTAATTATGGCTACTTTGGGG + Intergenic
1112982696 13:105405790-105405812 ACTAATTTATTGAATCTTTGTGG - Intergenic
1114788385 14:25627382-25627404 CCATATTGATTTAGAATTTGAGG - Intergenic
1115124565 14:29976292-29976314 CCTACTTTATTGAGAGTTTTTGG - Intronic
1115265757 14:31498476-31498498 CCTTGTTTATTGAGTATTTTTGG - Intronic
1115329919 14:32186125-32186147 CATTATTTATTAAGACTATCTGG - Intergenic
1115907073 14:38211599-38211621 CCTTATCTATTGTTACTTTTAGG - Exonic
1116011339 14:39355734-39355756 CCTAATTTATTGAGAGTTTTTGG + Intronic
1116601923 14:46936742-46936764 CCTAATTTATTGAGAGCTTTTGG - Intronic
1119451185 14:74712391-74712413 ACTTATTTCTTGAAAGTTTGTGG - Intronic
1119696609 14:76718509-76718531 TGATTTTTATTGAGACTTTGAGG - Intergenic
1121470920 14:94153758-94153780 CCTTATTCATTGAGCCCTGGGGG - Intronic
1124697128 15:31873037-31873059 CATTAATTATTGATTCTTTGTGG + Intergenic
1124711300 15:32014530-32014552 CTTTATTTATTGGCATTTTGTGG - Intergenic
1125910884 15:43437758-43437780 CCTTATTTTTTTATACCTTGAGG - Intronic
1125920068 15:43520176-43520198 CCTTATTTCTAGACACTCTGCGG + Intronic
1126026899 15:44455602-44455624 CCTAATTTATTGAGAGTTTTTGG + Intronic
1126286877 15:47023293-47023315 TCTTCTTTAATCAGACTTTGAGG - Intergenic
1130265621 15:82399706-82399728 CCAAATTTTTTGGGACTTTGAGG + Intergenic
1131213381 15:90517016-90517038 GCATAGTTATTGAGACTTAGGGG - Intergenic
1131522794 15:93128883-93128905 CCTTAAGACTTGAGACTTTGAGG - Intergenic
1131888310 15:96944399-96944421 CTTTATTAATTAAGACTCTGTGG - Intergenic
1133573626 16:7066403-7066425 CTTTATTGATTTGGACTTTGGGG + Intronic
1135240542 16:20803764-20803786 CATTATTTATTGTGACTGAGGGG + Intronic
1138859123 16:60733810-60733832 CCTAATTTATGGAGGTTTTGGGG + Intergenic
1138923837 16:61566782-61566804 CCCTATTTTCTGAGGCTTTGAGG - Intergenic
1139024607 16:62799322-62799344 GCTTAGTTTTTGATACTTTGTGG + Intergenic
1143431123 17:6885564-6885586 CATAATTTATTGAGAGTTTTTGG + Intronic
1144168269 17:12633590-12633612 GCTTGTTTATTGAGATTTTTTGG - Intergenic
1146462913 17:33061343-33061365 CCTAATTTATTGAGAGTTTTTGG + Intronic
1147366298 17:39961578-39961600 TCATATTGAATGAGACTTTGGGG + Intergenic
1147984443 17:44297062-44297084 CTTTATTTATTGAGTATTTCTGG + Intergenic
1148521134 17:48276061-48276083 CTTTATTTTTTAAGACATTGGGG - Intronic
1149631474 17:58128352-58128374 CCTTATCTCTGGAGACTTTAAGG + Intergenic
1149727547 17:58911758-58911780 CATTATTGATTGAGTCCTTGTGG + Intronic
1156424640 18:36997315-36997337 CCTTTCTTATTAAGATTTTGTGG + Intronic
1156787245 18:40930544-40930566 TCTTGTTTATTGACATTTTGTGG - Intergenic
1157008510 18:43617223-43617245 CCTAATTTATTGAGAGTCTTTGG + Intergenic
1157009739 18:43632525-43632547 ACTTATTTCTTAAGACTGTGAGG + Intergenic
1159209110 18:65293121-65293143 CTTTAAGCATTGAGACTTTGGGG + Intergenic
1159508346 18:69363940-69363962 TGTTATTTATTGATACATTGTGG + Intergenic
1164355811 19:27427606-27427628 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1164383831 19:27756867-27756889 CCTTATATATTGAGGCTATGGGG + Intergenic
925617762 2:5759864-5759886 CCATATTTTTGGAGACTCTGGGG + Intergenic
925853074 2:8102587-8102609 CCTCATTTATTGAGGGCTTGAGG - Intergenic
925951010 2:8911295-8911317 CCTAATGAAATGAGACTTTGGGG + Intronic
927451673 2:23214249-23214271 TCTGATTTATGGAGACTTTCTGG - Intergenic
928905957 2:36367914-36367936 CATTAATTATTAAGACTATGAGG + Intronic
931205845 2:60145017-60145039 CCTAATTTATTGAGAGTTTTTGG - Intergenic
931424258 2:62156802-62156824 CCTTATTTAATCAGTCTTTGAGG + Intergenic
931614027 2:64137130-64137152 CCATATTTATTGAGGTTTTTGGG + Intronic
932966624 2:76483172-76483194 CAACATTTATTGAGACATTGTGG + Intergenic
933257252 2:80095185-80095207 CCTAATTTATTGAGAGTTTTTGG + Intronic
936644933 2:114357918-114357940 CCTAATTTCTTGAGAGTTTTTGG + Intergenic
939481963 2:142760363-142760385 CCATATTTATTTAGACTCGGGGG - Intergenic
940095516 2:149969667-149969689 GCTAATTTATTGAGAGTTTTTGG - Intergenic
940572806 2:155462002-155462024 CCTAATTTGTTGAGAGTTTTTGG + Intergenic
941129000 2:161623702-161623724 CCTATTTTGTTGAGACTTTTAGG + Intronic
942937309 2:181573821-181573843 GCTTCTTTTTTGTGACTTTGGGG + Exonic
943163461 2:184284696-184284718 CCTATTTTATTGAGAGTTTTTGG - Intergenic
943327513 2:186519278-186519300 CCTAGTTTACTGAGACTTAGTGG + Intergenic
944716491 2:202380553-202380575 CCTGCTTGAGTGAGACTTTGCGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945598988 2:211834629-211834651 CGATATTTATTGAGTCTTTCAGG - Intronic
949087978 2:242173482-242173504 CCTCATTTAATGAGACACTGGGG - Intergenic
1169640126 20:7742144-7742166 CCATTTTTATTGATAGTTTGGGG + Intergenic
1169946867 20:10998339-10998361 TCTTGGTAATTGAGACTTTGTGG + Intergenic
1170832501 20:19855062-19855084 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1171454955 20:25264236-25264258 CCTAGTTTATTGAGAGTTTTTGG - Intronic
1172810224 20:37642244-37642266 ACGTATTTATAGAGACTGTGAGG - Intergenic
1173696021 20:45013628-45013650 TGTTATTTTTTGAGACATTGTGG + Intronic
1174131177 20:48344250-48344272 CCTTAGTTAATGAGGCTTCGAGG - Intergenic
1177394612 21:20516440-20516462 TCTTGTTTATTGACACTTTATGG + Intergenic
1180602105 22:17028084-17028106 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1183274435 22:36884108-36884130 CCTTATTTTTTGATGCTTTTGGG + Intergenic
949961956 3:9319675-9319697 CCTAATCTAGTGAGAATTTGAGG - Intronic
951444766 3:22765633-22765655 CATTATTTATTGTGATTCTGTGG - Intergenic
951860465 3:27246217-27246239 CCTTTTTTATTATGACTTTTAGG + Intronic
953475345 3:43201309-43201331 GCTTTTGTATTGAGACTTTCAGG - Intergenic
955218831 3:57007148-57007170 CCTTATTTATTAATTCTTTATGG - Intronic
956369853 3:68547432-68547454 TCTTATTTGTTGACATTTTGGGG + Intergenic
957589130 3:82172643-82172665 CCTAATTTATTGAGAGTTTTTGG + Intergenic
958580988 3:96022991-96023013 CCTTAGTTTCTGAGACTATGTGG - Intergenic
959044013 3:101451672-101451694 CCTAATTTATTGAGAGTTTTTGG - Intronic
959045638 3:101470460-101470482 CCTCGTTTATTGAGAGTTTTTGG - Intronic
963005096 3:140719643-140719665 ATTTATCTATTGTGACTTTGAGG + Intergenic
963029889 3:140959313-140959335 CCTTACTTATTAAAAATTTGTGG - Intronic
963316072 3:143760187-143760209 CCTAATTTATTGAGAGTTTTTGG + Intronic
963578555 3:147095378-147095400 CCTAATTTATTGAGAGTTTTTGG + Intergenic
964040085 3:152250801-152250823 CCTAATTTATTGAGAGTTTTTGG + Intronic
965516009 3:169621813-169621835 ACCTATTTATTGACAGTTTGAGG - Intronic
966352153 3:179042533-179042555 CCTAATTTATTGAGAGTTTTTGG - Intronic
966519608 3:180858660-180858682 AAAAATTTATTGAGACTTTGTGG - Intronic
967813828 3:193782552-193782574 CCTTCTTAATTGAGCCTTTCTGG + Intergenic
970112097 4:12650276-12650298 CCACATATATTGAGAATTTGGGG + Intergenic
970530185 4:16973943-16973965 CCTTATTTTTTTGGAGTTTGAGG - Intergenic
970702224 4:18755704-18755726 CCTCATTCATTGAAACTTTAAGG + Intergenic
973654673 4:53034283-53034305 CCTAGTTTATTGAGAGTTTTTGG - Intronic
974226289 4:59049675-59049697 CCTTTTTTTTTGAGAATGTGTGG + Intergenic
974706152 4:65519337-65519359 CCTAATTTATTGAGAGTTTTTGG - Intronic
976459210 4:85288410-85288432 CCTTTTTTATGGAGGCTTTAGGG - Intergenic
977642881 4:99377149-99377171 GCTTAAATATTGAGACATTGTGG - Intergenic
980149411 4:129027486-129027508 CCTAATTTATTGAGAGTTTTTGG - Intronic
980542395 4:134211725-134211747 CCTAATTTATTGAGAGTTTTTGG - Intergenic
980888802 4:138792319-138792341 CCTAAATTGTTGGGACTTTGAGG + Intergenic
981618471 4:146667436-146667458 CCTAATTTATTGAGAGTTTTTGG - Intergenic
982251322 4:153409879-153409901 CCACATTTATTTATACTTTGTGG - Intronic
982976212 4:162065365-162065387 CCATATTTATTTAGGTTTTGGGG - Intronic
983092936 4:163526680-163526702 CCTTATTTATACAGAATTTTTGG + Exonic
983140687 4:164145631-164145653 CCTAATTTATTGAGAGTTTTTGG - Intronic
983919400 4:173329578-173329600 TCTTGATTATTGAGAATTTGGGG + Intergenic
985864309 5:2502025-2502047 CCTTATTTTTTGCAACTATGAGG + Intergenic
986147987 5:5098241-5098263 TCTAATTTATAGAAACTTTGGGG - Intergenic
986530795 5:8734806-8734828 CCTAATTTATTGAGAGTTTTTGG - Intergenic
987488986 5:18553324-18553346 CCTGATTTATTTGGATTTTGAGG + Intergenic
988114409 5:26866317-26866339 CCTTATTTTTCGGGACTCTGGGG + Intergenic
988122062 5:26977350-26977372 CCTTAATTATTGAGGCATTATGG - Intronic
989611626 5:43299347-43299369 CCTAATTTATTAAAACTTTCGGG - Intronic
989820487 5:45790086-45790108 CCTAATTTATTGAGAGTTTTTGG - Intergenic
990369250 5:55100474-55100496 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
990679609 5:58226960-58226982 CATTATGCTTTGAGACTTTGGGG + Intergenic
990916581 5:60912773-60912795 CCTAGTTTATTGAGAGTTTTTGG + Intronic
991292084 5:65042900-65042922 CTTCATTTACTGAGACTGTGAGG - Intergenic
991578749 5:68132528-68132550 CTTTACTTATTGAGAGTTAGAGG + Intergenic
992815308 5:80431398-80431420 CCTAATTTATTGAGAGGTTTTGG - Intronic
993516495 5:88842600-88842622 CTTTATTTACTGTAACTTTGTGG - Intronic
995460096 5:112394049-112394071 CCTAGTTTATTGAGAGTTTTTGG - Intronic
995727865 5:115201752-115201774 TCTTATTTATTGTGTATTTGAGG - Intergenic
995814439 5:116151040-116151062 CCTAATTTATTGAGAGTTTTTGG + Intronic
995851884 5:116554886-116554908 CCTTATTTGTTGAGATTGTCAGG + Intronic
996364595 5:122687693-122687715 CCGTTTTTATGGAGTCTTTGGGG - Intergenic
998083985 5:139301113-139301135 CCTAATTTATCGAGTCTTTATGG + Intronic
998618768 5:143771527-143771549 AGATATTTCTTGAGACTTTGGGG + Intergenic
1000802124 5:165740639-165740661 CCTTATTTAATGAAAACTTGGGG - Intergenic
1000819654 5:165967503-165967525 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1000860053 5:166446702-166446724 CCTACTTTATTGAGAGTTTTTGG + Intergenic
1001202306 5:169729371-169729393 TGTTATTTATTGTGTCTTTGGGG + Intronic
1001634937 5:173203037-173203059 TCTTATTTACAGAGGCTTTGCGG - Intergenic
1002509275 5:179702423-179702445 CCTTCTTTTTTAAAACTTTGTGG + Intronic
1002745714 5:181470276-181470298 CCTCATTTAATGAGACACTGGGG - Intergenic
1006041180 6:31256659-31256681 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1006197971 6:32259276-32259298 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1008020124 6:46566777-46566799 TCTTATTTATTTATATTTTGAGG - Intronic
1008412663 6:51198689-51198711 TCTTATTCATTGGGACTTTCTGG - Intergenic
1008976734 6:57435698-57435720 TCTTATTTATTGCCACATTGAGG + Intronic
1009054675 6:58320368-58320390 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
1009236464 6:61130203-61130225 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1009362256 6:62828866-62828888 CCAAATTTATTGAGAGTTTTTGG + Intergenic
1010419036 6:75650943-75650965 CCTTCTTTATTTTGAATTTGAGG + Intronic
1010961931 6:82155198-82155220 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
1010962716 6:82164738-82164760 CCTTTTTAGTAGAGACTTTGAGG - Intergenic
1012480617 6:99662938-99662960 CCTTATTTATTAACATTTTCTGG + Intergenic
1014347684 6:120294725-120294747 CCTAGTTTATTGAGAATTTTTGG + Intergenic
1014502560 6:122210563-122210585 TATTCTTTATTGAGACATTGTGG - Intergenic
1014767311 6:125421828-125421850 CCTTTTCTTTTGAGACTTCGTGG - Intergenic
1014907460 6:127047204-127047226 CCTAGTTTATTGAGAGTTTATGG - Intergenic
1015080901 6:129224527-129224549 CCTAATTTATTGAGAGTTTTTGG + Intronic
1015506915 6:133998178-133998200 ACTTATTAATTCAGAATTTGGGG - Intronic
1015930774 6:138357272-138357294 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1017277299 6:152584230-152584252 CCATATTTATTGAAACTTTGTGG - Intronic
1017323648 6:153121562-153121584 AAATATTTATTAAGACTTTGGGG - Intronic
1018319925 6:162597226-162597248 CCTTATTTTTTTAGAATATGTGG + Intronic
1018405369 6:163475979-163476001 CCTTATTGATTTCTACTTTGTGG - Intronic
1019250631 6:170743831-170743853 CCTCATTTAATGAGACACTGGGG - Intergenic
1024114803 7:46182492-46182514 CCTAATTTATTAATAGTTTGAGG + Intergenic
1024182915 7:46915714-46915736 CCTTGTTTCTTGAGACTATGAGG + Intergenic
1026641706 7:72131996-72132018 CATTATTCACTGAGAGTTTGGGG - Intronic
1027442106 7:78230636-78230658 CCTTATTTATTGAGACTTTGAGG + Intronic
1027931414 7:84539754-84539776 AGTTTTTTATAGAGACTTTGAGG - Intergenic
1028281634 7:88936948-88936970 TTTTATTTATTAATACTTTGTGG - Intronic
1030218873 7:107076162-107076184 TCTTTTTTATTGAAACTTTTAGG + Intronic
1030341839 7:108389737-108389759 TCTAATTTATTGAGAGTTTTTGG + Intronic
1031343620 7:120636951-120636973 CCTTATAAATTCAGACTTTGTGG + Intronic
1031673510 7:124580729-124580751 CCTAATTTACTGAGAGTTTCTGG + Intergenic
1031735271 7:125351498-125351520 CTTTATTTATAGAGAAGTTGGGG - Intergenic
1032581657 7:133108629-133108651 CATTATTGATTGATAATTTGGGG + Intergenic
1033402147 7:141036406-141036428 CCTAATTTATTGAGAGTTTCTGG - Intergenic
1037243672 8:16806127-16806149 CCTTTTTTTTTGACACATTGAGG + Intergenic
1039145996 8:34447913-34447935 CCTAAATTATTGAGAGTTTTTGG + Intergenic
1039654642 8:39389358-39389380 CCTTATGTTTGGAGGCTTTGTGG + Intergenic
1040061663 8:43108839-43108861 CCTTGTTAATTGTGTCTTTGTGG - Intronic
1040084202 8:43322627-43322649 CCTAATTTATTGGGAGTTTTTGG + Intergenic
1040490823 8:47920518-47920540 CCTTATTTTTGGAGAATTTTAGG - Intronic
1041420712 8:57664644-57664666 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1041428441 8:57750109-57750131 CATTATTTATTTACACTCTGGGG - Intergenic
1041471574 8:58215585-58215607 CTTAATTTTTTGAGAGTTTGAGG - Intergenic
1043890992 8:85652594-85652616 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043893497 8:85717909-85717931 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1043896179 8:85739358-85739380 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1043896501 8:85742450-85742472 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043898823 8:85760817-85760839 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043900436 8:85773011-85773033 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043902398 8:85788286-85788308 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043904009 8:85800479-85800501 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043905621 8:85812673-85812695 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1043907228 8:85824860-85824882 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1044521262 8:93201878-93201900 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1044526491 8:93258208-93258230 AGTTATTTATTGACAATTTGAGG + Intergenic
1044793845 8:95876082-95876104 CCTAGTTTATTGAGAGTTTGTGG - Intergenic
1045177635 8:99742785-99742807 CCTAATTTATTGAGAGTTTTTGG - Intronic
1045752784 8:105506075-105506097 CCTTATTTATTAATACTGTGAGG - Intronic
1047656454 8:126982683-126982705 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1047667672 8:127109725-127109747 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1047675278 8:127194421-127194443 CTTAATTTATTGAGAGTTTTTGG + Intergenic
1048101158 8:131352948-131352970 CTTTATTTATTAAGAGTTGGTGG + Intergenic
1048311467 8:133325633-133325655 CCTGATTCATTGACACTCTGGGG + Intergenic
1050385936 9:5091164-5091186 TCCTATTTATTGAGGCTTAGGGG + Intronic
1050387357 9:5104868-5104890 CCTAGTTTATTGAGAGTTTTTGG - Intronic
1050794121 9:9515111-9515133 GCTTATTAATTGAGACTTACTGG - Intronic
1051447037 9:17151328-17151350 CCTAGTTTATTGAGAGTTTTTGG + Intronic
1055703915 9:78977456-78977478 CCTTATTTATTGGGCTTTTGTGG - Intergenic
1056727321 9:89131718-89131740 CCTAGTTTATTGAGAGTTTTTGG - Intronic
1056741389 9:89258532-89258554 CCTTAATTACTGTAACTTTGTGG - Intergenic
1057351670 9:94303982-94304004 CCTCATTCACTGATACTTTGAGG + Intergenic
1058052743 9:100422950-100422972 CCATATATAATTAGACTTTGGGG + Intergenic
1058054577 9:100436658-100436680 GCTTATTAATAGAAACTTTGAGG - Intronic
1058264052 9:102875164-102875186 CCATAATTATTGACACTTCGGGG + Intergenic
1058796632 9:108504917-108504939 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1059636058 9:116171732-116171754 CCTTATTCATTGAAACCATGGGG + Intronic
1059701186 9:116776579-116776601 CCTTGGTTATTGAGGTTTTGGGG + Intronic
1060249764 9:121976499-121976521 ATTAATTTTTTGAGACTTTGGGG - Intronic
1061835020 9:133323083-133323105 ACGTATTTATTGAAAATTTGAGG - Intergenic
1203580186 Un_KI270745v1:36428-36450 CCTCATTTAATGAGACACTGGGG - Intergenic
1186632051 X:11360466-11360488 CCTAATTTATTGAGAGTTTTTGG - Intronic
1186982902 X:14976651-14976673 CATTATTTATTGACCATTTGTGG - Intergenic
1187076688 X:15942550-15942572 TCTTATTTATGCAGAATTTGAGG - Intergenic
1187675751 X:21714972-21714994 TTTTAATTATTGAGAATTTGAGG + Intronic
1188590438 X:31827671-31827693 CTAAATTTATTAAGACTTTGTGG - Intronic
1190126865 X:47713409-47713431 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
1191646051 X:63482277-63482299 CCTAGTTTATTGAGAGTTTTTGG - Intergenic
1191822739 X:65330586-65330608 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1192077360 X:68013117-68013139 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1193569367 X:83123712-83123734 CTTTAATTTCTGAGACTTTGTGG + Intergenic
1193805168 X:85985740-85985762 CCTTCTATGTTGATACTTTGAGG + Intronic
1194228824 X:91296694-91296716 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1194404282 X:93475597-93475619 CCTAGTTTATTGAGAGTTTCAGG + Intergenic
1194798018 X:98237027-98237049 CCTAGTTTATTGAGAGTTTTTGG + Intergenic
1194924590 X:99809144-99809166 CCTAATTTATTGAGAATTTTTGG - Intergenic
1194963246 X:100259435-100259457 CCTAATTTATTGACAGTTTTTGG - Intergenic
1195508845 X:105690688-105690710 CCTTATTTTCTGAGAATTTTAGG + Intronic
1198198709 X:134392776-134392798 ACTTAATTAATGAGACTCTGTGG - Intronic
1198705046 X:139439634-139439656 CCTAATTTATTGAGAGTTTTTGG - Intergenic
1198848905 X:140943865-140943887 CCTTATTGGGTGGGACTTTGTGG + Intergenic
1199669971 X:150137293-150137315 CAGTATTTATTGTAACTTTGTGG + Intergenic
1200355563 X:155546701-155546723 TCAAATTTATTGAGATTTTGTGG + Intronic
1200948970 Y:8873711-8873733 CCTAATTTATTGAGAGTTTCTGG + Intergenic
1201016314 Y:9606142-9606164 CCTTATATGTTGAGATTCTGAGG - Intergenic
1201078982 Y:10215564-10215586 CCTAATTTATTGGGAGTTTTTGG + Intergenic
1201080538 Y:10240352-10240374 CCTAATTTATTGAGAGTTTTTGG + Intergenic
1201405786 Y:13648633-13648655 CCTCATTTATTGAGAGATTTTGG + Intergenic
1201580495 Y:15506724-15506746 CCTAGTTTATTGAGAGTTTTTGG - Intergenic