ID: 1027445460

View in Genome Browser
Species Human (GRCh38)
Location 7:78268555-78268577
Sequence GCTCAGTCATTTATAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027445460_1027445463 0 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 46
1027445460_1027445462 -5 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445462 7:78268573-78268595 TGAGCTGCCATACCCCTAGTGGG No data
1027445460_1027445464 1 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445464 7:78268579-78268601 GCCATACCCCTAGTGGGTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 61
1027445460_1027445461 -6 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445461 7:78268572-78268594 CTGAGCTGCCATACCCCTAGTGG No data
1027445460_1027445466 2 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445466 7:78268580-78268602 CCATACCCCTAGTGGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027445460 Original CRISPR GCTCAGTCATTTATAATTGT TGG (reversed) Intronic
902269163 1:15290644-15290666 GCTGAGTCATTTCTCAGTGTGGG - Intronic
902981953 1:20130191-20130213 GGTCAGTCTTTTTCAATTGTAGG + Intergenic
908422252 1:63970334-63970356 GCCCAGTAATATGTAATTGTAGG + Intronic
918846553 1:189622315-189622337 GCTCACTGATTAGTAATTGTAGG - Intergenic
922432955 1:225574298-225574320 GCTCAGTTATATAAGATTGTGGG + Intronic
1065356966 10:24851677-24851699 GATCAGTCATTCTTCATTGTAGG - Intronic
1065742559 10:28810509-28810531 TCTGAGTCATTCAGAATTGTGGG + Intergenic
1066383477 10:34921443-34921465 GCACAGTCATTTAGAATTGTGGG + Intergenic
1066486657 10:35852237-35852259 GCCCAGTCATTTATCATCTTAGG + Intergenic
1067153761 10:43757732-43757754 GCTCATTCAATGATCATTGTTGG - Intergenic
1067537218 10:47121976-47121998 GCTCAGTCACTTATAATCTCAGG + Intergenic
1069496295 10:68906397-68906419 GTTTAGTAATTTATAATTCTGGG + Intronic
1071363341 10:84873925-84873947 ACTCAGTCAGTTATATTTCTAGG + Intergenic
1072135396 10:92540633-92540655 TTTCAGTCATTTGTAATTTTTGG - Intronic
1076508541 10:130995157-130995179 GCACAAACATTTATAATTGTGGG + Intergenic
1081658876 11:44875684-44875706 GCTCAGTCATTTCTAGCTCTTGG + Intronic
1086335726 11:85798919-85798941 ACTCAATCATTTAGATTTGTGGG + Intronic
1088808698 11:113374729-113374751 TCTCGGTCATTTATAAATGAAGG + Intronic
1092775626 12:11942832-11942854 GCTCAGGCATTTATCATTGCAGG - Intergenic
1093538727 12:20254673-20254695 GCTCATTTATTTAAAATTTTTGG + Intergenic
1094796731 12:33982145-33982167 AATCAGTCATTTATATGTGTTGG - Intergenic
1095227284 12:39692952-39692974 TCTCAGTCTTTTATCATTATTGG + Intronic
1097696329 12:62778514-62778536 GCTCTGTCATTTTTAACTCTTGG - Intronic
1098422118 12:70309587-70309609 GTTCACTCATTTATAATGGAAGG + Intronic
1099948219 12:89269876-89269898 GGTCAATGATTTATAATTTTAGG + Intergenic
1101934112 12:109042401-109042423 GATTAGGCATTTATAATTGTAGG - Intronic
1103313381 12:120031023-120031045 GGTCAGTTCTTAATAATTGTTGG - Intronic
1107063021 13:36181745-36181767 GCTCAGACATTTATCATTTCTGG + Intronic
1108781190 13:53836709-53836731 TCTGAGTCATTTCTATTTGTTGG + Intergenic
1109652611 13:65349725-65349747 GATCAGTACTTTATAAGTGTGGG + Intergenic
1110105048 13:71662910-71662932 ACTCAGTAATCTATAATTGAAGG - Intronic
1112979622 13:105366940-105366962 TCTTAGTAATTTATATTTGTTGG - Intergenic
1116556558 14:46317624-46317646 GATTAGTCATTTATTATTTTAGG - Intergenic
1116740449 14:48747599-48747621 GCTCAGTCATTTGTTACTTTTGG - Intergenic
1117163374 14:53010802-53010824 GCTCAGCCCTTTATGATTGTTGG + Intergenic
1119326922 14:73765440-73765462 ACTAAGTCTTTTATAAGTGTTGG + Intronic
1120814471 14:88840323-88840345 TCTCAGTCATTTATATCTTTTGG + Intronic
1125201306 15:37102331-37102353 GCTCAATCATTCATCATTTTTGG - Intergenic
1125333388 15:38604015-38604037 GCGCAGTCATGTAGATTTGTGGG - Intergenic
1126986059 15:54310151-54310173 AGTCAGTCATTTTTAATTATTGG + Intronic
1127225457 15:56923340-56923362 GCTGAGTTATTTATGAGTGTCGG + Intronic
1132319973 15:100918782-100918804 GGTGAGTCATTGTTAATTGTCGG - Intergenic
1137222949 16:46473613-46473635 GCACAGTCATCTATAATTAGAGG - Intergenic
1138807192 16:60104093-60104115 GCTCCGTCTTTGATAATAGTAGG + Intergenic
1139196768 16:64928609-64928631 GTTCATTCACTTACAATTGTGGG - Intergenic
1145854146 17:28135874-28135896 TCTCAGTCACTTATTATTATTGG + Intronic
1146356338 17:32137590-32137612 GGTCAGTGATATATAAATGTTGG - Intergenic
1146626097 17:34436604-34436626 GCTCAGCCACTTATACCTGTGGG - Intergenic
1149106202 17:52969569-52969591 CCTCAAACATTTATAATTTTTGG + Intergenic
1149256459 17:54832760-54832782 TCCCAGTCATTTATAAATCTTGG + Intergenic
1150518618 17:65842255-65842277 ACTAATTCATTTATAATTCTAGG + Intronic
1158869921 18:61676342-61676364 GCCCAGTCTTTGATAATTGGAGG + Intergenic
1160455574 18:78996672-78996694 ACTCATTAATTTATATTTGTTGG + Intronic
1162376559 19:10308672-10308694 GTTCAGTCATTTCTAACTCTGGG + Exonic
1162571301 19:11475222-11475244 TCTCAGTCTTTTAAGATTGTTGG - Intronic
1162653425 19:12109232-12109254 GCTGAGCCATTTATAATCCTTGG + Intronic
1163923873 19:20320202-20320224 TCTCAGTCTCTTTTAATTGTGGG - Intergenic
1165272722 19:34724475-34724497 GCTCAGCCATTGATCAATGTAGG - Intergenic
926622544 2:15060121-15060143 GCTCAGTCATCTATAAAAGGGGG + Intergenic
930437090 2:51358798-51358820 GCTCAGTAAATTACAGTTGTTGG - Intergenic
934695418 2:96396629-96396651 GCTGAGTCATTTATAATAAATGG + Intergenic
937239947 2:120453495-120453517 GCTCAGTCATCTGTAAATGCCGG - Intergenic
938087922 2:128413538-128413560 CCTCAGTCATCTATTGTTGTGGG - Intergenic
938648278 2:133353382-133353404 GCTCAGTCCTCTATAAAAGTTGG + Intronic
939742426 2:145925389-145925411 TCTCACTCATTTAATATTGTAGG - Intergenic
940028754 2:149237978-149238000 GCTAAGTAATTTACAATTTTAGG + Intergenic
940043774 2:149388026-149388048 GCTCGGTCATTTAGAACTGAGGG - Intronic
940189168 2:151020547-151020569 ACTCAGTCACTTGTAGTTGTAGG + Intronic
940403713 2:153276297-153276319 GTTCATTCTTTTATAATTCTTGG + Intergenic
942004534 2:171684895-171684917 GTTCATGCATTTATAATTGCTGG + Intergenic
948217310 2:236241239-236241261 GCTCAGTCATTTATTTTTAAGGG - Intronic
1168825272 20:808104-808126 ACTAAGTCATTCATAATTATAGG - Intergenic
1168850218 20:971528-971550 CCTCAGTCATTTATCATGGCTGG - Intronic
1169292942 20:4368275-4368297 GCACAGTCATTTATAAGGGAGGG - Intergenic
1169756549 20:9049177-9049199 CCTCAGTCATTCATAAAGGTCGG + Intergenic
1173766598 20:45616446-45616468 CCTCAGTCATTTATAAGGATTGG + Intronic
949275363 3:2273619-2273641 GCTCAGTCAATTAAATTTCTAGG - Intronic
950975698 3:17241263-17241285 TCACAGCCATTAATAATTGTTGG - Intronic
952357345 3:32596834-32596856 GCTAAGTCATTTGCAATTTTTGG + Intergenic
954058154 3:48045298-48045320 ACTCTGTCAGTTATAATTATAGG + Intronic
956584845 3:70853291-70853313 TCTCAGTCATTTATTATTTTTGG - Intergenic
959437608 3:106335939-106335961 GCTAAGTCATTTATACATGGAGG - Intergenic
961618666 3:128205637-128205659 GCTCAGGCATTAGTAAATGTGGG - Intronic
963510434 3:146240977-146240999 GCTGAGTCATATTTCATTGTAGG - Intronic
963638203 3:147825619-147825641 ACTCACTCCTTTATAAATGTGGG + Intergenic
963672933 3:148274698-148274720 GCTCTGTCATTTACAATGTTAGG + Intergenic
963821563 3:149900996-149901018 GATCAGTAATTTATAAGTTTAGG + Intronic
964018836 3:151982216-151982238 GCTAAGACATTTATTGTTGTAGG + Intergenic
964922868 3:161919157-161919179 GCACAGTCTTTTCTAATTCTGGG - Intergenic
965719358 3:171644716-171644738 GGCCAATCATTTATCATTGTAGG + Intronic
968013691 3:195305941-195305963 GCTTAGTGATAGATAATTGTTGG - Intronic
970622334 4:17836005-17836027 GCTCAGTCATTTAACTTTTTGGG + Intronic
970822513 4:20235000-20235022 TCTCAGACATTTATAATTTCTGG - Intergenic
971168759 4:24211658-24211680 GCTCAGCCACTTATAAACGTAGG + Intergenic
971818200 4:31517529-31517551 GCTGAGGCATTTATAAATGTTGG + Intergenic
972075000 4:35076443-35076465 GCTCATTCATATTTAAGTGTAGG - Intergenic
975171367 4:71235395-71235417 GCTCAGGCATTGAATATTGTAGG - Intronic
975571368 4:75821562-75821584 GCTCAGAAATTTAAAAGTGTAGG - Intergenic
975792823 4:77973050-77973072 TCTCAGGCTTTTATAATTTTAGG - Intergenic
976352138 4:84071985-84072007 TCTCTGTCCTTTATAATTGTGGG - Intergenic
977287916 4:95132271-95132293 GCTTAGCCATTAATAAATGTTGG + Intronic
977966971 4:103163669-103163691 TCTCAGTCCTTTCTAACTGTTGG - Intronic
979527497 4:121732732-121732754 GGAGAGTCATTAATAATTGTAGG - Intergenic
979711310 4:123782788-123782810 TTTCAGTCATTTTTAATTGGGGG + Intergenic
979743023 4:124175155-124175177 GCCCAGTGATTCAAAATTGTGGG + Intergenic
981294915 4:143120734-143120756 CCTAAGTGATTTATAAGTGTTGG + Intergenic
982333207 4:154205428-154205450 GCTCACTCACTTGCAATTGTAGG - Intergenic
982663923 4:158237783-158237805 GCTCAATCCTTTATTATTTTTGG - Intronic
982705612 4:158705729-158705751 GCTCTTTCATGTATAAATGTTGG - Intronic
983342681 4:166484623-166484645 GCCAACTCACTTATAATTGTAGG - Intergenic
985046364 4:185944800-185944822 GCTCATTGTTTTATGATTGTGGG - Intronic
987701600 5:21406933-21406955 GCTCAGTTCTTTATTATTATAGG - Intergenic
988779857 5:34510485-34510507 GCTAAGTCTCTTATAATTATTGG - Intergenic
988848122 5:35150826-35150848 GCTTTGTCATTGATTATTGTGGG - Intronic
994379152 5:99049948-99049970 ACTAAGTCATTTATATCTGTAGG - Intergenic
996882103 5:128310922-128310944 GATCAGTAATTTTTAAATGTTGG - Intronic
997957014 5:138286682-138286704 TCTCAGTCATTTCTAAGTATTGG - Intronic
999128120 5:149261848-149261870 GCTCACTCATGAATATTTGTTGG - Intergenic
1003601789 6:7524405-7524427 GATGAGGCATTTAAAATTGTGGG + Intergenic
1004848494 6:19672019-19672041 GCTCAGAGATTTAAAAGTGTAGG + Intergenic
1004941625 6:20563968-20563990 GCTCAATCATTTTTAACTGAGGG + Intronic
1005028366 6:21485778-21485800 GGTAAATGATTTATAATTGTTGG + Intergenic
1008052213 6:46911996-46912018 ACTCAGTGATTTAATATTGTCGG - Intronic
1012177853 6:96111011-96111033 ACCCAGTCATTTATATTTGTTGG + Intronic
1012278493 6:97301073-97301095 GGTCAGGCATCTATAATTATGGG + Intergenic
1014976673 6:127893595-127893617 GCTCAAGCATTTATTATTTTAGG - Intronic
1016725535 6:147361266-147361288 GCTCAGTCATTTTCATTTATTGG - Intronic
1018019991 6:159753005-159753027 TCTCATTCATTTTTATTTGTAGG + Intronic
1020805842 7:12789514-12789536 GAGAAGTCATTTATAATTATTGG + Intergenic
1020912392 7:14148083-14148105 TTTCAGTCATTTATAAATATAGG - Exonic
1023153895 7:37228550-37228572 GCTCATTCATTTAAAAATCTTGG + Intronic
1027445460 7:78268555-78268577 GCTCAGTCATTTATAATTGTTGG - Intronic
1028600392 7:92594389-92594411 GCTCTGTCATTTAATATAGTTGG - Intergenic
1035253156 7:157610352-157610374 GCTCAGTCATTTATGCTGGCAGG + Intronic
1037353044 8:17983448-17983470 ACCCATTCATTTATAATTCTTGG + Intronic
1038057908 8:23879068-23879090 GCTCAGTTACTTTTTATTGTGGG + Intergenic
1038930692 8:32190634-32190656 GTACAGTCATTTATTATTCTAGG + Intronic
1040637009 8:49286654-49286676 ATTCAGTCATTTTTAAATGTAGG - Intergenic
1040762858 8:50872213-50872235 GCTCAGTAATTAATAATTGTTGG - Intergenic
1041081644 8:54220304-54220326 GCTGGGTCATTTTTAATTGTTGG - Intergenic
1043096496 8:75981739-75981761 GCACAGTAATTTTTCATTGTTGG + Intergenic
1045579761 8:103466068-103466090 GCTAAGGCATTTATAATAGTAGG + Intergenic
1045684409 8:104696994-104697016 GCTCTGTCATGTGTAATTGTAGG + Intronic
1046592818 8:116226445-116226467 GCACAGTCTCTTATGATTGTGGG + Intergenic
1049147592 8:141012919-141012941 GTTCAGTCATTTATATCAGTAGG + Intergenic
1050627302 9:7518514-7518536 GCTGAGTAATTCTTAATTGTGGG + Intergenic
1051397774 9:16644509-16644531 GCTAAGTCATTTATAGTCATAGG + Intronic
1055669339 9:78586136-78586158 GCACAGTCATTTGTAAGTATAGG - Intergenic
1186555971 X:10558919-10558941 GCCTAGTGATTTATTATTGTTGG - Intronic
1191852620 X:65596853-65596875 GCTCAGTGATTAATAAATGAGGG - Intronic
1194987252 X:100504492-100504514 TCTCACTCATATATAATTGAAGG + Intergenic
1197065603 X:122230222-122230244 GCTCAGACATTAAAAATTTTAGG - Intergenic
1197066348 X:122237908-122237930 GTTCAGTCATTCACAATTTTGGG + Intergenic
1198519791 X:137441248-137441270 GCTCAGACATTTACAACTGCAGG + Intergenic
1198978726 X:142368288-142368310 GGTCTGTCTTTGATAATTGTGGG - Intergenic
1199743262 X:150755802-150755824 TCTGAGTCATTTGGAATTGTGGG + Exonic
1201643107 Y:16199881-16199903 GCTCAGCCATTGATCAATGTAGG - Intergenic
1201659708 Y:16385440-16385462 GCTCAGCCATTGATCAATGTAGG + Intergenic