ID: 1027445463

View in Genome Browser
Species Human (GRCh38)
Location 7:78268578-78268600
Sequence TGCCATACCCCTAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027445460_1027445463 0 Left 1027445460 7:78268555-78268577 CCAACAATTATAAATGACTGAGC 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027445463 Original CRISPR TGCCATACCCCTAGTGGGTT TGG Intronic
907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG + Intergenic
909212662 1:72844217-72844239 TGCCATCTCCCTAGGGGCTTGGG - Intergenic
911765130 1:101665048-101665070 TGTCATTCCCCTATTGGCTTGGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
918933374 1:190886891-190886913 TGCCAATCCCCTATTGGTTTGGG - Intergenic
921152505 1:212413626-212413648 TGCCAGACCCTAGGTGGGTTAGG + Intronic
1076310382 10:129502071-129502093 GCCCAGACCCGTAGTGGGTTTGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1097605593 12:61749334-61749356 TGGCATACTCCTTGTGGGCTTGG + Intronic
1102060254 12:109926225-109926247 AGCCTTACCCCTTCTGGGTTGGG + Intronic
1109240447 13:59880306-59880328 TCCCAAATCCCTAGTGTGTTTGG - Intronic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG + Intronic
1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG + Intronic
1132461360 16:56743-56765 TGCCATTCTCCTAGTGGGGAGGG - Intronic
1135940713 16:26819474-26819496 AGCCAAACCCCTAGTTTGTTGGG - Intergenic
1136395218 16:29988747-29988769 AGGCATTACCCTAGTGGGTTGGG + Intronic
1140832475 16:78764584-78764606 TGCCGTGCCCCGGGTGGGTTTGG + Intronic
1148851078 17:50555667-50555689 TGCCCCACCCCAAGGGGGTTGGG - Exonic
1151349680 17:73524413-73524435 TGCCCTTCCCCTGGTGGGCTGGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1162707009 19:12562673-12562695 TGACAAACCTCTAGTGGGATGGG - Intronic
1164696236 19:30246581-30246603 TGCCAGACCTCTTGTGGGGTGGG - Intronic
1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG + Intronic
938070662 2:128306645-128306667 TGCCATGCCCCCACTGGCTTGGG - Intronic
946173478 2:217908979-217909001 TGACTTACCCTGAGTGGGTTAGG - Intronic
1171023708 20:21609751-21609773 TGCCATGACCACAGTGGGTTGGG + Intergenic
1173937945 20:46884009-46884031 TGCCAAAACCCCAGTTGGTTTGG - Intergenic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1174975647 20:55330060-55330082 TGCCACACCCCCAATGGGTTGGG + Intergenic
1175570837 20:60020378-60020400 TGCCCTACCCCAAGTGGGAGAGG - Intronic
955619227 3:60843918-60843940 TGCCTTACCCCTAGAGTGTCAGG - Intronic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG + Intergenic
991711333 5:69411784-69411806 TGCCATAATCTTAGGGGGTTGGG - Intronic
1007344035 6:41214876-41214898 TGTCATTCCCCTAGTGGCTAGGG + Intergenic
1007620486 6:43210609-43210631 TGCCATACCCTTAATGTTTTAGG + Intronic
1008875981 6:56328411-56328433 TGCCATACCACTAGTGTGATGGG - Intronic
1017716475 6:157217169-157217191 TGCAAAACCCCCAGTGGGTTCGG - Intergenic
1023979668 7:45061349-45061371 TTCCTTACCCCTAGGTGGTTAGG + Intronic
1024233231 7:47378658-47378680 ATCCATACCCCTTCTGGGTTTGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG + Intronic
1036104166 8:5822568-5822590 TGTCATTCCCCTATTGGGTACGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1045272011 8:100670219-100670241 TGCTATACCCCCAGTGCCTTGGG + Intergenic
1047672951 8:127169062-127169084 TGATAAAACCCTAGTGGGTTAGG + Intergenic
1053449315 9:38179970-38179992 TGCCATTCCCCTGGTTGTTTGGG - Intergenic
1191256280 X:58280986-58281008 CTCCATGCCCCCAGTGGGTTGGG + Intergenic
1195332850 X:103819923-103819945 TGCCATAACCTTGGGGGGTTAGG - Intergenic
1197596998 X:128476809-128476831 TGCCATACCCGGATTGGTTTAGG + Intergenic
1199794592 X:151181817-151181839 TCCCATTCCCCGAGGGGGTTGGG + Intergenic
1200128382 X:153828895-153828917 TGCCAGCCCCCTAGCGGGATAGG - Intronic