ID: 1027448371

View in Genome Browser
Species Human (GRCh38)
Location 7:78300994-78301016
Sequence AACATTAATTCCTACATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027448371_1027448373 6 Left 1027448371 7:78300994-78301016 CCTGTAATGTAGGAATTAATGTT 0: 1
1: 0
2: 3
3: 19
4: 291
Right 1027448373 7:78301023-78301045 ATTTTAAGATGAACAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027448371 Original CRISPR AACATTAATTCCTACATTAC AGG (reversed) Intronic
901151418 1:7105586-7105608 AACATTAGTTCATACATCCCAGG + Intronic
902176060 1:14652006-14652028 TAAATTAATTCCTACAGAACAGG + Intronic
903268957 1:22175962-22175984 AACAGCAGTTCCTACATTAAGGG + Intergenic
904102950 1:28048872-28048894 AACAATATTTTCTAAATTACTGG - Intronic
905540006 1:38753007-38753029 GCCATCAATTCCTACTTTACAGG - Intergenic
906722162 1:48016408-48016430 TACATTAATTCCTAGATAATTGG + Intergenic
906839856 1:49125308-49125330 AACATTAAACCCTACATCTCAGG - Intronic
907959573 1:59266043-59266065 AACATTAATTAATATATTATTGG - Intergenic
908108789 1:60874438-60874460 CACATAAATTACTACACTACAGG + Intronic
909796803 1:79749974-79749996 AATATTAATTTCTACATAATAGG + Intergenic
909839923 1:80307526-80307548 AACAATAATGCCTGCTTTACGGG - Intergenic
910389619 1:86725891-86725913 GACATTAATTCCAAATTTACTGG + Intronic
910713165 1:90202834-90202856 AACAATAATGCCTACTTCACGGG - Intergenic
912855032 1:113160219-113160241 AACATTTATTCTTACAGTTCTGG - Intergenic
913302544 1:117387725-117387747 AACATTATTTCCCACAGTTCTGG + Intronic
913535359 1:119767060-119767082 AAAATTAATTACTACACTTCAGG + Intronic
916811761 1:168312082-168312104 AACATTAATTCTTCCATTCCTGG - Intronic
916869750 1:168900637-168900659 AATATTAATTCCTGTATAACTGG + Intergenic
920746297 1:208632123-208632145 AACAGTAATTCTTACATCACAGG + Intergenic
921171737 1:212556454-212556476 AACATTACTTGATAGATTACTGG + Intergenic
921429233 1:215044525-215044547 AACAATAATACCTATATTATAGG + Intronic
921984896 1:221302300-221302322 AACATTATCTCCTTTATTACAGG + Intergenic
922182935 1:223250187-223250209 AATAGTAATACCTACATTGCAGG + Intronic
922953025 1:229575052-229575074 AACATTAATTACCTCATTAAAGG - Intergenic
923576721 1:235165187-235165209 AAAATGAATTCCTAGAATACTGG - Intronic
924918548 1:248601073-248601095 AATATTGATCCCTACACTACAGG - Intergenic
1062993544 10:1843412-1843434 AACAATAATGCCTACATCACAGG + Intergenic
1063756857 10:9021135-9021157 TACATTAATTCCTTCCTTGCTGG + Intergenic
1064553533 10:16525417-16525439 AACACTAATACCTAAATTATAGG + Intergenic
1065783072 10:29188901-29188923 AACATTAAGTGATACATGACTGG + Intergenic
1066248293 10:33606645-33606667 AACATTGTTTACTACATTAATGG - Intergenic
1067400407 10:45968264-45968286 AACATTAATCCTTACATTTATGG - Intergenic
1067716638 10:48695542-48695564 AATAGTAATGCCTACCTTACAGG + Intronic
1067868732 10:49937566-49937588 AACATTAATCCTTACATTTATGG - Intronic
1068032605 10:51721929-51721951 AACATTAAATTATTCATTACAGG + Intronic
1068180581 10:53513117-53513139 AACCTTAATTACTTCATTAAAGG - Intergenic
1068640061 10:59393666-59393688 AACATTACTTCTGACCTTACAGG - Intergenic
1069414521 10:68186063-68186085 AAGATTATTTCCTACATTATAGG - Intronic
1069743314 10:70699283-70699305 AACATTACTGCCTACCTTATAGG + Intronic
1071723687 10:88173591-88173613 AATATTAATTCTTACAATCCAGG + Intergenic
1072572013 10:96666752-96666774 AGCATTGATTCCTATTTTACAGG - Intronic
1075868275 10:125747047-125747069 AGCAATAATTTCTACATTTCTGG - Intronic
1078358801 11:10652590-10652612 AATATTAATGCCTACATCAGAGG - Intronic
1078457909 11:11489782-11489804 AACATTAATACCTACCTTATTGG - Intronic
1079087014 11:17453716-17453738 CTCAGTAATTGCTACATTACAGG - Intronic
1079177180 11:18153172-18153194 AACAGTAATTCACACATTGCAGG + Intronic
1079573998 11:21980350-21980372 AATATTAACACCTACCTTACGGG + Intergenic
1080113502 11:28596345-28596367 ATAATTATTTCCTACATTAGTGG - Intergenic
1081223737 11:40495645-40495667 AACAATAATTCAAAGATTACTGG - Intronic
1081252579 11:40853212-40853234 AAAATAAATGACTACATTACTGG + Intronic
1081449961 11:43161441-43161463 AACATTAATCCCAATATCACAGG + Intergenic
1081496898 11:43620895-43620917 AACAATACTTTCTACATTATTGG - Intronic
1081509744 11:43758130-43758152 AACATTAAATCCTAAATCTCTGG + Intronic
1081560661 11:44212520-44212542 AACTTGAACTCATACATTACTGG + Intronic
1081609697 11:44553556-44553578 AACATTAGTTCCTTCCTTAGAGG + Intergenic
1082717099 11:56627501-56627523 CTCATTAATTCATACATTAATGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1085439670 11:76547580-76547602 ATCAGTAATGCCTACTTTACAGG + Intronic
1085804218 11:79619681-79619703 AACAATTATGCCTACCTTACAGG - Intergenic
1086014131 11:82144133-82144155 AACATTAATCTATACATTAAAGG + Intergenic
1087826349 11:102768797-102768819 AAGAATAATTCCTAGATTACCGG - Intergenic
1088901728 11:114123145-114123167 AACCTTAATTACTTCCTTACGGG + Intronic
1090326812 11:125894837-125894859 GACATTAATTTCTACATCATTGG - Intronic
1090654407 11:128831964-128831986 AACAATAATACCTACCTTAAAGG - Intergenic
1091962617 12:4710851-4710873 AATAATAATTCCTGCATCACAGG + Intronic
1092659884 12:10726640-10726662 ACCATTAATTCATTCAATACAGG - Intergenic
1093109110 12:15127897-15127919 AACATTAATTTCTACTTTTAAGG - Intronic
1094147951 12:27250163-27250185 CACATTAATGCCTACTTTTCAGG + Intronic
1094552610 12:31466812-31466834 GACATTAATTCTTAAATTTCAGG + Intronic
1095260343 12:40091837-40091859 CACATTAATTACTACAATAATGG + Intronic
1096064730 12:48730602-48730624 AACAGTAATACCTACTTCACAGG - Intergenic
1096315288 12:50559257-50559279 AAGATTAACTACTAAATTACAGG - Intronic
1097818264 12:64099227-64099249 AACATTAATCCTTACATCATAGG + Intronic
1098466246 12:70789778-70789800 AACAATCATTTATACATTACTGG + Intronic
1098684729 12:73404247-73404269 AACATAAATTCTTGCATTAGTGG + Intergenic
1100031423 12:90196885-90196907 AACTTTAGTTGCTACATTAAAGG + Intergenic
1100866376 12:98861528-98861550 CACATTAACTCCTCCATTCCAGG - Intronic
1101423820 12:104571038-104571060 AACAAGAATTCCTACGTTCCAGG - Intronic
1102704794 12:114871506-114871528 AACAATAATAGCTACTTTACTGG + Intergenic
1103401185 12:120643964-120643986 AAGATGAATTCCTACCTTAAAGG + Intronic
1103872040 12:124099156-124099178 AACATGAATTCCTACAAAAGGGG - Intronic
1106212474 13:27663034-27663056 AAAATTAATTTCTACCTTAAAGG + Intronic
1106586339 13:31059436-31059458 GACATTAACTTCTTCATTACCGG + Intergenic
1107875507 13:44787512-44787534 AACAATAATCCCTACCTTGCAGG - Intergenic
1108927112 13:55764877-55764899 AAAATTAATTCCAACATAAAAGG + Intergenic
1109162246 13:58990610-58990632 AACATTAACTCCTACAATATGGG + Intergenic
1109176419 13:59162682-59162704 AACATTCTTTCCTACATTGTTGG - Intergenic
1109827798 13:67745480-67745502 AAAATTAATTGCTAGATGACGGG - Intergenic
1110125431 13:71936684-71936706 ACCACTACTTTCTACATTACTGG - Intergenic
1110473425 13:75886341-75886363 AACAAAAAATCCTACATGACTGG - Intergenic
1111765924 13:92529456-92529478 ATCATTAATTCTTCAATTACTGG - Intronic
1113492739 13:110705398-110705420 CAGAATAATTCCTACATTCCAGG - Intronic
1114891073 14:26924289-26924311 AACAATAATTCCTATTTCACAGG + Intergenic
1115494366 14:33987622-33987644 AACATTCATTGGCACATTACTGG - Intronic
1115693282 14:35868953-35868975 AGAATTAAATCCTACACTACTGG - Intronic
1116630899 14:47331209-47331231 AACACTACTTCCAACATTAGGGG + Intronic
1117045671 14:51810818-51810840 AGCAGTAATACCAACATTACTGG - Intergenic
1119115102 14:72012835-72012857 AACACTAATACCAACATTGCTGG + Intronic
1120416821 14:84229857-84229879 AACATTAATTACATCATTAGAGG + Intergenic
1120823991 14:88938701-88938723 GACATTAATGCATATATTACTGG - Intergenic
1121220142 14:92278877-92278899 AACAAGAGTTCCTACATCACAGG - Intergenic
1121625309 14:95381149-95381171 AAATTTATTTCCTACAGTACTGG - Intergenic
1121736798 14:96224407-96224429 AATATTAGTCCCTACATTGCAGG + Intronic
1124116648 15:26849626-26849648 AACAATAATTCATACTTTTCGGG + Intronic
1127493158 15:59484204-59484226 AAAAATAATTCCTACATTTAAGG + Intronic
1127666692 15:61154623-61154645 AACTTTACTTCGTAAATTACAGG + Intronic
1127833079 15:62767903-62767925 AAGATTAATTCCTATGTTAGTGG + Intronic
1129113966 15:73354662-73354684 AACATTAATCCCCACCTCACAGG + Intronic
1130754907 15:86752882-86752904 GACATTAATTGCTAAATTAATGG + Intronic
1133450766 16:5902203-5902225 AACATTAATTCGTACTTAATGGG - Intergenic
1133687874 16:8183555-8183577 AATACTAATCCCTACATCACCGG + Intergenic
1133760049 16:8791325-8791347 AACATTAATTTTTACAGTTCTGG - Intronic
1134679254 16:16112540-16112562 AATATTAACTCCTACCTCACAGG - Intronic
1137703693 16:50518766-50518788 ATAATAAATTCCTACCTTACCGG - Intergenic
1138472989 16:57253098-57253120 GACATTCATTCCTATTTTACTGG + Exonic
1138695825 16:58812433-58812455 AGCATTCTTTCCTAAATTACTGG - Intergenic
1138960508 16:62023444-62023466 AATAATAATTCCTACCTAACGGG + Intronic
1140132800 16:72178861-72178883 AACAATAATACCTACCTTACAGG + Intergenic
1140909272 16:79437336-79437358 AACATGAAGACGTACATTACAGG + Intergenic
1144380376 17:14689549-14689571 AATATTAATTCTTCCAATACAGG + Intergenic
1147307126 17:39571945-39571967 GGCATTAATACCTACATTTCAGG - Intergenic
1153132883 18:1877494-1877516 AACTTTATTTCCTATAGTACTGG - Intergenic
1155542941 18:26886143-26886165 AATATTAATTTCTTCATTGCTGG + Intergenic
1156067020 18:33155831-33155853 AACATAAAGTCCTACATTACTGG + Intronic
1156973374 18:43185350-43185372 AATATAAATGCCTACATCACAGG - Intergenic
1157554876 18:48606855-48606877 AAAAATAATGCCTACATTATAGG + Intronic
1157634071 18:49131581-49131603 AACCTTAATTACTTCATTAAAGG + Intronic
1159288117 18:66379003-66379025 AACATTAACTCCTACATTAGAGG - Intergenic
1160181144 18:76637870-76637892 AACAATAATTGCTGCATTATGGG + Intergenic
1160262434 18:77307353-77307375 AAAATAAATTCATACATTATAGG - Intergenic
1162052835 19:8045238-8045260 AAAATTCATTCCTACTTTATAGG - Intronic
1164798481 19:31056055-31056077 AACATAAATCCCCACATTAAAGG - Intergenic
1164963143 19:32454255-32454277 TCCATTAATTCCTACACCACGGG - Intronic
1165976481 19:39681083-39681105 TATATTAATTCATATATTACTGG + Intergenic
1168485276 19:56756441-56756463 AACATTACTTCCTACATTTCAGG - Intergenic
925036539 2:691762-691784 AACATGACTTCTAACATTACAGG - Intergenic
925831514 2:7900563-7900585 AAAATTAATTTCTGCATCACAGG + Intergenic
928063781 2:28142162-28142184 ATCATTAATCCCTCTATTACAGG - Intronic
930219469 2:48731637-48731659 AATAATAATTCCTACTTCACAGG + Intronic
930760576 2:55031020-55031042 AACAGTAGTACCTACCTTACAGG - Intronic
932094293 2:68833334-68833356 AAAATTAATTAATACATTGCAGG - Intergenic
933541608 2:83650767-83650789 AACAATGAATCTTACATTACTGG - Intergenic
934506444 2:94898226-94898248 GATATTACTTCCTATATTACAGG - Intergenic
934540998 2:95175000-95175022 AGCATTAAATCCCACATTTCTGG - Intronic
935110492 2:100089842-100089864 AACATTAATTCGTGCCTTTCTGG + Intronic
935412237 2:102776767-102776789 AACAGTAACTCATTCATTACTGG - Intronic
936124483 2:109775359-109775381 AACATTAATTCGTGCCTTTCTGG - Intergenic
936220206 2:110596097-110596119 AACATTAATTCGTGCCTTTCTGG + Intergenic
937515495 2:122650436-122650458 AACATTACTTCCTACCCCACTGG - Intergenic
937755249 2:125529826-125529848 AACAGTAATTCATACAGTGCAGG + Intergenic
939535599 2:143423818-143423840 AACAATAATACCTACATCATAGG - Intronic
940799824 2:158121387-158121409 ATCATTTATTCCCACATTGCAGG + Exonic
941169132 2:162116394-162116416 AACATTTATTCCTACAGTTCTGG - Intergenic
941258453 2:163264623-163264645 AACAAGACTTCCAACATTACTGG + Intergenic
941514833 2:166460257-166460279 AAAATTAATTCATACATTTTGGG + Intronic
941533497 2:166696217-166696239 GACATTAATTCCAATATCACAGG + Intergenic
942403477 2:175628333-175628355 AACATTACTTGCTTCATAACTGG + Intergenic
945170958 2:206994478-206994500 AACGTTCATTCCTACTTCACAGG + Intergenic
945305870 2:208258131-208258153 AAAATCAACTCCTCCATTACTGG - Intronic
945540329 2:211078248-211078270 AAAATGGATTCCTACAATACGGG + Intergenic
946533705 2:220604356-220604378 AAATTTATTTCCTACATTTCTGG + Intergenic
1168905355 20:1398983-1399005 AACATTGATTCCCTCATTCCAGG + Intergenic
1169608701 20:7353771-7353793 AATATTAATACCAACTTTACAGG - Intergenic
1170618311 20:17972695-17972717 AACATGAAAACCTAGATTACAGG - Intronic
1170925143 20:20715793-20715815 AACATTAATGCCTACCTAAGTGG + Intergenic
1170925229 20:20716763-20716785 AACATCAATTCCTACCTAAGTGG + Intergenic
1173060954 20:39660694-39660716 AACCTTAATTACTTCATTAGTGG + Intergenic
1173618950 20:44422010-44422032 AATAATAATTCCTACTTCACAGG - Intronic
1173766437 20:45614521-45614543 AACAATAATCCCTACCTCACAGG + Intronic
1174785844 20:53431620-53431642 AATAATAATTCCTACCTCACAGG - Intronic
1175043445 20:56078449-56078471 AACAATAATTCCAACCTTAAAGG + Intergenic
1175456237 20:59117167-59117189 AACATCAATTTCTACAATCCAGG - Intergenic
1177936598 21:27354758-27354780 AACATTAACACCTACCTCACTGG - Intergenic
1178842945 21:36152632-36152654 GACATTGATTCCTACCTTAAAGG - Intergenic
1184088598 22:42280859-42280881 AATAATAATACCTACATCACAGG - Intronic
1184624102 22:45709253-45709275 AACACTAAATCCTGCCTTACAGG - Intronic
949465294 3:4337397-4337419 AACACAAATTACTTCATTACTGG + Intronic
951794736 3:26525702-26525724 AAATTTATTTCCTACATTTCTGG - Intergenic
952077662 3:29717162-29717184 GACAATAATACCTACATTAGGGG + Intronic
952392623 3:32893248-32893270 GACATTACATCCTACATTTCAGG - Exonic
955131716 3:56176032-56176054 AACATTACTTCCAAGATTGCTGG + Intronic
955623591 3:60892662-60892684 AACATTGATACTAACATTACTGG + Intronic
955644622 3:61123708-61123730 AACATTTATTACTACACTAAGGG - Intronic
955860383 3:63323331-63323353 AGCTTTAATTCCTAAATTTCTGG + Intronic
955873636 3:63466832-63466854 AACTTTAATTACTACCTTAGTGG + Intronic
956662377 3:71611926-71611948 AATAATAATACCTACCTTACAGG + Intergenic
960220702 3:115105287-115105309 AAAAATAATTCCTACATTATAGG - Intronic
961556439 3:127699503-127699525 AATAATAGTTCCTACATCACAGG - Intronic
963378556 3:144501047-144501069 AACATTTATTTGTACATTATTGG + Intergenic
963400655 3:144793014-144793036 AAAATAAATTCCTATATTTCTGG - Intergenic
964849726 3:161082036-161082058 AAAATTATTTCTTACATTTCTGG + Intergenic
965924486 3:173960191-173960213 TTCATTACTTCCTACAATACGGG + Intronic
967722198 3:192827544-192827566 GACCATAATTCCTACATCACAGG - Intronic
971055852 4:22911350-22911372 AGCTTTAATTCCTACCTTTCAGG - Intergenic
974417690 4:61631258-61631280 AACATTCATTAATACATCACTGG - Intronic
974629727 4:64471024-64471046 AACATTATTTCTTAAAATACTGG + Intergenic
974836782 4:67260769-67260791 AACCTTAATTACTTCCTTACAGG + Intergenic
975723848 4:77273299-77273321 AACATTGATTCCCACATTGTTGG + Intronic
975794878 4:77996723-77996745 AAGTTTACTTCCTAGATTACTGG + Intergenic
975797152 4:78019097-78019119 AAGATTAATTTCTCCATTAATGG + Intergenic
976038012 4:80847670-80847692 AACAATGATACCTACATTATGGG + Intronic
976528111 4:86116933-86116955 AGCATTAATTCCTACAGCATAGG + Intronic
977087860 4:92627353-92627375 AACATTAATTAGCACATCACTGG - Intronic
977320771 4:95512891-95512913 AAAAATATTTACTACATTACTGG - Intronic
977849805 4:101812943-101812965 ATTATTAATTCCCACATTCCAGG - Intronic
978069517 4:104450026-104450048 GACATTATTTCCAACTTTACAGG + Intergenic
978624671 4:110671259-110671281 AACATTAATACCTATCTTATAGG + Intergenic
980128573 4:128797301-128797323 AATAATAATACCTACATCACAGG + Intergenic
980478152 4:133347335-133347357 AACATTAATTACTTCTTTAGAGG - Intergenic
983397045 4:167212069-167212091 GACAATAATACCTACAATACAGG + Intronic
983793824 4:171834143-171834165 AACATTAATGCTTATATTTCAGG + Intronic
983808726 4:172030031-172030053 AATATTAATACCTGTATTACAGG - Intronic
983977378 4:173952148-173952170 AATCTTAATTCCTGCATTCCAGG - Intergenic
984531031 4:180916496-180916518 CACATTAAGTCCTAAATTAATGG + Intergenic
984615561 4:181893227-181893249 GACATTAATTCTTACATTTATGG - Intergenic
988471050 5:31538987-31539009 AAAATTAAGTCATACAGTACAGG + Intronic
992603385 5:78428432-78428454 AAAAATAAATCCTACATCACTGG - Intronic
992792925 5:80229847-80229869 AACAGTAGTTCCTACATCATAGG + Intronic
993147498 5:84113958-84113980 AGCATTAATTTCTGCAGTACTGG - Intronic
993989917 5:94643344-94643366 AGCTTTAATTCTTGCATTACTGG - Exonic
994299325 5:98127558-98127580 AATTTTAATTCTTACATTAGAGG - Intergenic
995391723 5:111647252-111647274 AACATTAATTATTACATTTCTGG - Intergenic
996296647 5:121926069-121926091 AACATTAGTTTCTAAATTATAGG + Intergenic
996336433 5:122388665-122388687 AACATTAACTGCTTCTTTACAGG - Intronic
996942259 5:129022246-129022268 AATATTAATTTCTACATCATAGG + Intronic
998656843 5:144190698-144190720 AATATTAATTACTATGTTACTGG - Intronic
1000221248 5:159216892-159216914 TACATTAATTCCTCCATGCCTGG + Intergenic
1000776192 5:165423192-165423214 AACAGTAAATCATACAATACTGG - Intergenic
1002006817 5:176240824-176240846 AACATTAATGCCTACCTAGCAGG + Intronic
1002129349 5:177070557-177070579 AACATTAGTACCTACCTCACAGG + Intronic
1002219559 5:177669812-177669834 AACATTAATGCCTACCTAGCAGG - Intergenic
1002802910 6:543222-543244 AAAATTCATTCATCCATTACTGG - Intronic
1003092635 6:3117071-3117093 CACATTAATTCCTGCATAAAAGG - Intergenic
1005465766 6:26110999-26111021 AAAGTTAATTCCTACATTTTTGG - Intergenic
1007818852 6:44545037-44545059 AACAATAATCCCTACGTTAGGGG + Intergenic
1008121838 6:47627324-47627346 GACAGTAATTTCTACTTTACAGG + Intergenic
1009454242 6:63836183-63836205 ATCAGTAATTCATACATTGCTGG - Intronic
1009672129 6:66768883-66768905 AAAAATGATTCCTACATTTCTGG + Intergenic
1009832788 6:68960351-68960373 CACAATAATTCCTACATTTCTGG - Intronic
1010480633 6:76348539-76348561 AATAATAATTTCTACATTACAGG - Intergenic
1012386770 6:98691751-98691773 AACTGTAATTTCTATATTACAGG + Intergenic
1013867701 6:114718958-114718980 TACATTGATTCCTAGATTAAAGG + Intergenic
1013977963 6:116098537-116098559 AACATTAATTACTTCCTTAAAGG + Intergenic
1014147837 6:118018399-118018421 CATAATAATTCCTACCTTACAGG + Intronic
1015106525 6:129543022-129543044 AACATCAATTTCTCCTTTACTGG + Intergenic
1015779561 6:136850592-136850614 AAGAATAATTCCTAGATTTCTGG + Intronic
1015858395 6:137649925-137649947 AATAATAATTCCAACATCACAGG - Intergenic
1016128521 6:140436195-140436217 AACATAAATCCTCACATTACAGG - Intergenic
1017168923 6:151437495-151437517 AACAATAATGCCTACTTTATGGG + Intronic
1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG + Intergenic
1020336179 7:7064022-7064044 AACATTAATCCCAATATTGCAGG + Intergenic
1021100344 7:16581617-16581639 AAAAATAATTCCTACATTTTAGG + Intergenic
1021425356 7:20493961-20493983 AACATTAATTCCTGCTATAATGG + Intergenic
1023300592 7:38766629-38766651 AACATTAATCCCCACATCATGGG + Intronic
1027414491 7:77960569-77960591 AACAGTAATACCTATCTTACAGG + Intergenic
1027448371 7:78300994-78301016 AACATTAATTCCTACATTACAGG - Intronic
1027452488 7:78348297-78348319 GACATTAATAGCTACATCACGGG + Intronic
1027633858 7:80644539-80644561 AACATTTATTCCTACATTTTGGG + Intronic
1028058055 7:86273445-86273467 AAAATTAATATCTACATGACAGG + Intergenic
1029343086 7:99960166-99960188 GACATTATTTCCCACATCACGGG + Intergenic
1032822535 7:135537692-135537714 AATAATAATTCCTAATTTACTGG + Intergenic
1032986067 7:137338596-137338618 AACACTAATTACTACAACACAGG - Intronic
1033860488 7:145619098-145619120 AATATTGATGCCTATATTACGGG + Intergenic
1034367336 7:150562631-150562653 ATCATTAATTTCTACAGTTCTGG + Intergenic
1034717835 7:153260129-153260151 TACATTACTTCCTACATTGCTGG + Intergenic
1036487981 8:9196781-9196803 AAAATTAATACATACATTAATGG - Intergenic
1037079216 8:14762430-14762452 AATAATAATTCCCACTTTACAGG + Intronic
1037868236 8:22465528-22465550 AACATTAATGCATTCATTAGAGG - Intronic
1038300773 8:26345227-26345249 ATAATTAATTCCAAAATTACTGG - Intronic
1038637346 8:29298645-29298667 AATATTACTTCCTATATCACAGG + Intergenic
1039378802 8:37065196-37065218 AATATTAATTCCTCCAATCCAGG + Intergenic
1039704542 8:39993268-39993290 AACATTACTTCCTAGAGAACAGG - Intronic
1040575105 8:48645230-48645252 ATTAATAATACCTACATTACAGG - Intergenic
1040738658 8:50543804-50543826 AACAGTCATTCCTACATTGTTGG - Intronic
1040828137 8:51646124-51646146 AACATTAATTCCTTCTTGAGGGG - Intronic
1041128927 8:54675893-54675915 AACATTTATTCTTACACTTCTGG + Intergenic
1041222795 8:55668986-55669008 CACATTAGTACCTATATTACGGG - Intergenic
1042725302 8:71868666-71868688 AACATGAACCCCTACACTACAGG + Intronic
1043249036 8:78046506-78046528 AACATTAATTCTTTCAATCCAGG - Intergenic
1043395678 8:79833635-79833657 AATATTAATGCCTTCATGACTGG + Intergenic
1044532361 8:93321824-93321846 AATATTTATTCTTACATTACAGG + Intergenic
1045618295 8:103943471-103943493 AATAGTAATACCTGCATTACAGG + Intronic
1048230697 8:132637861-132637883 TACAATAATTCCTGCTTTACTGG - Intronic
1049132299 8:140857534-140857556 AACAATTATTCTTACATTACTGG + Intronic
1050586214 9:7114284-7114306 AACATGAATTCCTAGCTGACAGG - Intergenic
1050939087 9:11437186-11437208 AACATTAAGTCCTGCAATAGTGG - Intergenic
1051019051 9:12517975-12517997 AACAATAATTCAGACATTTCAGG + Intergenic
1052376865 9:27727507-27727529 AACAGTAATTCCTACTACACAGG - Intergenic
1055289309 9:74766579-74766601 AATAGTAATTCCTACCTTATAGG - Intronic
1058008696 9:99949630-99949652 AAAATTAATTCTTACTTAACTGG + Intronic
1058648731 9:107155177-107155199 CAAATTAATTCCCACATCACAGG + Intergenic
1058740254 9:107935777-107935799 AAGATGAATGCCTCCATTACTGG - Intergenic
1059202262 9:112429230-112429252 AACATTCATTCTTACATGCCAGG + Intronic
1059767137 9:117394250-117394272 AACATAAATTTCTGCAATACTGG + Intronic
1060431974 9:123558154-123558176 AACATTAATCCCTTCCTCACCGG - Intronic
1061708671 9:132472298-132472320 AAAATTACTTCCTAAATGACTGG - Intronic
1186316722 X:8378487-8378509 AACAGAAATTCCTACACCACTGG - Intergenic
1187205036 X:17174079-17174101 AGCATTAGTACCTACTTTACAGG - Intergenic
1187223418 X:17352871-17352893 AACCTTAATTCCCTCTTTACAGG - Intergenic
1188042690 X:25388124-25388146 AACATTAATTCTTATCATACTGG - Intergenic
1189785965 X:44559042-44559064 AACATTAATTACTTCCTTAAGGG - Intergenic
1190760880 X:53437189-53437211 CACATATATTACTACATTACAGG - Intergenic
1191055934 X:56240864-56240886 AACAGTAATACCTACCTCACAGG + Intronic
1191940245 X:66471618-66471640 AAAATGAATACCTACATTTCAGG + Intergenic
1192136749 X:68608829-68608851 AATATTAATTCTTCCAATACAGG - Intergenic
1194238977 X:91420821-91420843 AACAGTAATTAATACATTTCTGG + Intergenic
1194305339 X:92239640-92239662 GACATTAGTTCATACATTAAGGG + Intronic
1194649126 X:96494409-96494431 AACATTCGTTCATACTTTACAGG - Intergenic
1194670127 X:96721843-96721865 AATAATAATAGCTACATTACAGG + Intronic
1195401612 X:104466981-104467003 AATATTAGTACCTACCTTACAGG - Intergenic
1198394460 X:136208065-136208087 AATAATAATTCCTACGTCACAGG - Intronic
1200872985 Y:8123428-8123450 AACATTAATTTCCACAATTCTGG + Intergenic
1200982513 Y:9275328-9275350 AACATTAATTTCCACAATTCTGG + Intergenic
1202091700 Y:21197754-21197776 AACATTAATTCATTCATGAGGGG + Intergenic