ID: 1027448431

View in Genome Browser
Species Human (GRCh38)
Location 7:78301723-78301745
Sequence AAAGCTGCTGAGATTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027448431 Original CRISPR AAAGCTGCTGAGATTGGTAT TGG (reversed) Intronic
902751739 1:18518999-18519021 AAGGCAGCTGGGATTGGAATAGG - Intergenic
904295882 1:29519479-29519501 AGAGCAGCTGAGATTGGGATGGG + Intergenic
905832299 1:41081336-41081358 GAAACTGCTGAGATTTCTATTGG - Intronic
911423671 1:97679094-97679116 AAAGCTGCTTTCATTGGAATAGG - Exonic
911806375 1:102213278-102213300 ACAGCTGCTGACATTGGGAAAGG + Intergenic
912637324 1:111309509-111309531 AGAACTGCTAAGATTGGGATAGG + Intronic
913465871 1:119141967-119141989 AAAGCTGATCAGTTTGGTTTTGG + Intergenic
915499478 1:156305276-156305298 ACAGCTGCAGATTTTGGTATAGG + Intergenic
916728071 1:167541418-167541440 AAAGCTGTGGAGAGTGGTTTGGG + Exonic
917378444 1:174377307-174377329 AAATCTGCTGAGATTTTTATTGG - Intronic
917522616 1:175760672-175760694 AAAGCTGGTGACATTGGTAGTGG - Intergenic
918927667 1:190809222-190809244 AGAGCTGCTTAAAGTGGTATGGG + Intergenic
919975813 1:202611477-202611499 AAAGTAGCTGGGATTGTTATAGG + Intronic
920095155 1:203481975-203481997 AGAGCTGCTGAGGTTGGCACAGG + Intronic
921393729 1:214645675-214645697 AAAGCTGCAGAGTTTGGAAAAGG + Exonic
922362947 1:224839752-224839774 AAAGCTGATGAGAAGGGCATTGG - Intergenic
922578941 1:226682764-226682786 AAAGAAGCTGAAAGTGGTATAGG + Intronic
924484319 1:244465757-244465779 AAATCTGCTGAGATTTTGATTGG + Intronic
1065337864 10:24673148-24673170 AAATCTGCTGAGATTTTGATTGG - Intronic
1067188749 10:44052555-44052577 AAAGCAGCTAGGATTGGTGTGGG + Intergenic
1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG + Intergenic
1067835925 10:49641664-49641686 AAAGATGCTGAGATAGGATTGGG + Intronic
1068389924 10:56382183-56382205 AATGCTGTTGAGATTTTTATTGG + Intergenic
1069029889 10:63584327-63584349 AAACCTGCTTAGATGGGCATGGG + Intronic
1070820445 10:79351016-79351038 AAAGCTGCTGGGCTGGGTAAGGG + Intronic
1071366998 10:84909570-84909592 AAAGCAGCTGAGTTGGGTGTTGG - Intergenic
1073972296 10:109058630-109058652 AAAGCTGATGGGTTTGGTCTGGG + Intergenic
1077682550 11:4256713-4256735 AAGGCTTCAGAGATTGGTGTGGG - Intergenic
1077687483 11:4310025-4310047 AAGGCTTCAGAGATTGGTGTGGG + Intergenic
1077692650 11:4361214-4361236 AAGGCTTCAGAGATTGGTGTGGG + Intergenic
1077949237 11:6937467-6937489 AAAGCAGCTGAGATTTTGATAGG - Intronic
1078553137 11:12294068-12294090 AAAAGTGCTGAGAATGGTAGAGG + Exonic
1080557791 11:33432535-33432557 AAAGCTGCTGAGATTCTGAAGGG + Intergenic
1081082597 11:38761596-38761618 AAAGTTGGAGAGATTGGAATAGG + Intergenic
1083797586 11:65026419-65026441 GAAGCTGCTGAGATGGGAAAGGG - Intronic
1084581230 11:70024693-70024715 CAAGCTGCTGAGAGTGGTGGTGG - Intergenic
1087602691 11:100336996-100337018 AAAGCAGCTGAGATGTGTGTGGG - Intronic
1087645158 11:100800371-100800393 AAATGTGCTGAGCTTGGTTTTGG + Intronic
1091380605 12:55836-55858 AAAGCTGCTGTGATTATTAATGG - Intergenic
1092187515 12:6491974-6491996 AAAGTTGGTGAGAATGTTATTGG - Exonic
1093023469 12:14223723-14223745 AAATCTGCTGAGGTTAGTTTTGG + Intergenic
1093370917 12:18364093-18364115 AAAGATGCAGAGATAGGTAGGGG - Intronic
1093574520 12:20711415-20711437 AGAGATGCTGAGAGTGGAATTGG - Exonic
1094303990 12:28997304-28997326 AAAGCAGCAGAGACTGGTGTTGG + Intergenic
1095125983 12:38477849-38477871 ACAGCTTCTGTGATTTGTATGGG + Intergenic
1095159686 12:38902477-38902499 AAAGCAGCTCAGATTTGAATAGG - Intronic
1099727150 12:86446321-86446343 AAAGCTGCTCCAATTGGCATTGG + Intronic
1100853804 12:98740417-98740439 CAAGCTCCTGAGAATGTTATGGG - Intronic
1101386530 12:104263056-104263078 AGTTCTACTGAGATTGGTATTGG + Intronic
1103267421 12:119642757-119642779 AAAAATGCTGAAATTTGTATTGG - Exonic
1104702133 12:130914693-130914715 AAATCTGCTGAGATTTTTATTGG - Intergenic
1105508049 13:21027802-21027824 AAACCTGCTGAGATTGTATTTGG + Intronic
1105719360 13:23099105-23099127 AGAGCTCCTGAGATTGTTATGGG - Intergenic
1107112300 13:36711323-36711345 AAAGATGCAGAGAAAGGTATTGG - Intergenic
1107867937 13:44721631-44721653 AAATCTGCTGCCATTGGTTTTGG + Intergenic
1109240902 13:59886499-59886521 AAACCTGCTGAGATTTTGATTGG + Intronic
1109328005 13:60893249-60893271 AAACCTGTTGAGATTGTTCTTGG - Intergenic
1109441680 13:62382359-62382381 AATGGTGCTGAGAATAGTATTGG + Intergenic
1110420320 13:75300363-75300385 AAAGCTGTCTATATTGGTATGGG + Intronic
1114039650 14:18665287-18665309 AAAGCTGTTGAGATTTTTATTGG + Intergenic
1114044692 14:18863838-18863860 ATAGCTGTTGAGATTTTTATTGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114119531 14:19655687-19655709 ATAGCTGTTGAGATTTTTATTGG - Intergenic
1114625179 14:24124220-24124242 GAAGCTTCTGAAATTGGTAAGGG - Exonic
1115283550 14:31691810-31691832 GAAGCTGCAGAGGTTGGTAAAGG - Intronic
1116522402 14:45866318-45866340 AAAGTAGCTGAGAGTGTTATTGG + Intergenic
1118263093 14:64266820-64266842 ATAGCTATTGAGATAGGTATGGG - Intronic
1120625494 14:86820550-86820572 AAAGTTGCTGAGCTTTGTAAAGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126184320 15:45816411-45816433 AAAGCTTCTAATATTGGTAAAGG - Intergenic
1127139206 15:55956839-55956861 AAACTTGCTGAGATTTTTATTGG + Intronic
1127257333 15:57303333-57303355 ACAGCTGCAGCGATTGGTTTAGG + Intergenic
1127426042 15:58858118-58858140 AAAGCAGCTAAAATTGGCATTGG + Exonic
1128524054 15:68399026-68399048 AAATTTGCTGAGATTTTTATTGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133173624 16:3997650-3997672 AAACCTGCTGGGAATGGAATAGG - Intronic
1134769061 16:16789212-16789234 AAGCCTGCTGAGATTTTTATAGG + Intergenic
1135730524 16:24891266-24891288 AAAGCTGCTGATATTTGCAAAGG + Intronic
1137921847 16:52497506-52497528 AAGGCTGCAGAAAATGGTATTGG + Intronic
1138540967 16:57687231-57687253 AAAGCTGGTGAGATAAGTACGGG - Intronic
1139223786 16:65214078-65214100 AAAGCTGCTGTGAATGGTTTGGG + Intergenic
1140197150 16:72864728-72864750 ATAGCTGTTGGGATTGGAATTGG - Intronic
1140957847 16:79883470-79883492 ACTGCTGCTGAGATTGTCATAGG + Intergenic
1141549853 16:84798850-84798872 AAAGCTGCTGGGATTTTGATTGG - Intergenic
1141581093 16:84999412-84999434 AAAGCTGCTGTGAACAGTATCGG - Intronic
1143424881 17:6827630-6827652 AAACCTGCTGAGATTTTCATTGG + Intronic
1143969212 17:10781419-10781441 AACCCTGCTGAGATTTTTATTGG + Intergenic
1145964949 17:28910394-28910416 AAAGCAGCTGAGATGGGAAGTGG + Intronic
1146072415 17:29695146-29695168 AAAGATGATGAGATTTGGATTGG - Intronic
1146781488 17:35677641-35677663 AAAAATGCTGAGATTTTTATTGG + Intronic
1150036960 17:61812064-61812086 AAAGTTGCTGATTTTGGTACAGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155349184 18:24889697-24889719 AAAGATGATGAGTTTGGTTTTGG + Intergenic
1157439904 18:47702703-47702725 AAAGAGGCTGAGATTGGGAAAGG + Intergenic
1157692504 18:49695088-49695110 AAAGCTGCAGAGATGGGTGTGGG + Intergenic
1158269588 18:55698121-55698143 AAAGCTGCTGAGCTGGTTCTGGG + Intergenic
1158760290 18:60376934-60376956 AGAGCTGGTGAGTTTGGAATGGG + Intergenic
1165368096 19:35382304-35382326 AAGGCTGCTGAGATGGGAAAGGG + Intergenic
1165636177 19:37342099-37342121 AAGGCTTCTGAGATTCTTATGGG - Intronic
1166848568 19:45745907-45745929 AAAGCCACTGAGACTGATATTGG - Intronic
1166905561 19:46106180-46106202 AAAGGTGCTGAGATAGGTAACGG + Intergenic
1167733162 19:51273750-51273772 AAAGCTGCTAAAATTGGGCTGGG - Intergenic
929451145 2:42038339-42038361 ACTGCTCCTGAGATTGTTATAGG + Intergenic
930507412 2:52301647-52301669 AAATCTGCAGAGATTTTTATTGG + Intergenic
931982643 2:67710958-67710980 AAAGCTGCTGAAATGTGTCTGGG - Intergenic
932774648 2:74520560-74520582 AAAGCTGGAGAGGTAGGTATAGG + Intronic
937046440 2:118854547-118854569 AGAGCTGCTGAGGTGGGTCTTGG - Intergenic
937286638 2:120758247-120758269 AAAGCTGCTGAGATTGTGTGTGG - Intronic
938186073 2:129233093-129233115 AAAGCTGCTGAGAGGCGAATAGG + Intergenic
938270906 2:129970317-129970339 AAAGCTGTTGAGATTTTTATTGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939582792 2:143970290-143970312 AATCCTGCTCACATTGGTATTGG - Intronic
939627915 2:144501209-144501231 AAAGTTCCTGAGATTGGGAGTGG - Intronic
941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG + Intergenic
942512362 2:176716196-176716218 AAAGCGACTTAGATTGGCATGGG - Intergenic
943525358 2:189009267-189009289 AAAGCTGCTTAGATTAGAATGGG + Intronic
944365274 2:198911943-198911965 ATAGCTGCTCAAATTGGTGTAGG - Intergenic
945118055 2:206428867-206428889 AGAGCTGCTGAAATTTATATCGG + Intergenic
945608091 2:211962003-211962025 AAAGCATTTGAGATTGGGATAGG + Intronic
1170301190 20:14886260-14886282 AAAGGCCCTGAGATAGGTATGGG + Intronic
1173218109 20:41106435-41106457 AAAACTGTTGAGATTTTTATTGG + Intronic
1173484031 20:43427296-43427318 AAAGATGATGAGATTAGTTTTGG - Intergenic
1175515942 20:59569844-59569866 AAAGCTGCAGTGTTTGGTTTGGG - Intergenic
1175590387 20:60185305-60185327 AACGCTGCTGGGATTTTTATAGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1176969140 21:15245941-15245963 AACCCTGATGAGATTGGTAGAGG - Intergenic
1178369459 21:32015273-32015295 AAAGCTGATCAGATTGTTTTAGG - Intronic
1180463215 22:15586395-15586417 ATAGCTGTTGAGATTTTTATTGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1184026958 22:41865067-41865089 AAAGCTGCTGAGACCGGTTGTGG - Intronic
1185005152 22:48271518-48271540 AGAGCTCCTGAGCTTGGCATGGG - Intergenic
1185106619 22:48873679-48873701 AATCCTGCTGGGATTTGTATTGG + Intergenic
1185201175 22:49506351-49506373 AAACCTGCTGAGCTGGGTAAAGG + Intronic
950962950 3:17124227-17124249 TATGTTGCTGAGATTGGTTTTGG - Intergenic
952094970 3:29939910-29939932 AAAGCTCATGAGATTAGTTTGGG - Intronic
952216287 3:31281000-31281022 AAAGCCCCTGAGATTGGGATGGG - Intergenic
955167431 3:56528146-56528168 AAAGCTGAAGACATGGGTATAGG + Intergenic
955525057 3:59811548-59811570 AAATTTTCTGAGATTAGTATGGG - Intronic
956638773 3:71394737-71394759 AAAACTGCTGGGATTTGTTTGGG + Intronic
957954449 3:87166398-87166420 AAAACTGCTGAGATTGTTACAGG + Intergenic
958517697 3:95139903-95139925 AAACCTGCTAAGATTTTTATTGG + Intergenic
959589719 3:108065015-108065037 AAAGCTTCTGAAACTGGTACTGG + Intronic
959625844 3:108449651-108449673 AAAGTTTCTGACATTGGTTTTGG + Intronic
960141261 3:114153803-114153825 AAAGGTGCTGAGACTAGAATGGG - Intronic
961022881 3:123524091-123524113 AGAGATGCTGAGATTGGGTTAGG + Intronic
961760469 3:129163500-129163522 AAAGCTGCTGTGATTTACATCGG + Intergenic
962463724 3:135638070-135638092 AAAGCTACTGAGATGGGAGTAGG - Intergenic
962909980 3:139839107-139839129 AAATATGCTGAGGTTGGTTTGGG + Intergenic
964552022 3:157895609-157895631 TAAGCTGCTGATATTTGTACTGG - Intergenic
968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG + Intergenic
969910016 4:10435721-10435743 AACCCTGCTGAGATTTTTATTGG - Intergenic
970819973 4:20200262-20200284 AAAGTTGTTGAGATTGATAATGG + Intergenic
971936018 4:33148559-33148581 AAAGCAGCTGAGATTTGAATAGG - Intergenic
974125131 4:57686879-57686901 AAAGCTGCTGATTATGGCATTGG + Intergenic
974714789 4:65654050-65654072 AATGCTGCTGACATGGCTATCGG + Intronic
978508343 4:109485736-109485758 AAAGTGGCTGAAATTGGTGTGGG + Intronic
980894351 4:138847527-138847549 GAGGCTGCAGAGATTGGTTTAGG + Intergenic
981671050 4:147287338-147287360 ACAGATGCTGAGTTTGCTATGGG - Intergenic
982352504 4:154431101-154431123 AAATCTGCTGAGATTTTTCTTGG + Intronic
982454281 4:155589618-155589640 AAAGCATCTGACATTGGTAGGGG + Intergenic
982780024 4:159480945-159480967 AATGCTGCTGAGATTCTTCTTGG + Intergenic
987745278 5:21963018-21963040 GAAGCGGCTGAAATTTGTATAGG - Intronic
990294540 5:54387343-54387365 AAACATGCTGAGATTTGTAAAGG + Intergenic
993409058 5:87551377-87551399 ACAGCTGTTGAGATTGGGATTGG + Intergenic
994159303 5:96537788-96537810 AAATGTGCTGAGACTGGTCTTGG - Intronic
996819302 5:127608423-127608445 GAAGCTGCTGAGACAGGTAAGGG - Intergenic
997320227 5:132971975-132971997 AAAGTTGCTGAAATTGTTAGAGG + Intergenic
997836788 5:137200843-137200865 AAACCTCCTGAGGTTGGAATTGG + Intronic
999833685 5:155345866-155345888 AAAGCTGCTAAGATTTTTACTGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1001454876 5:171852851-171852873 AATGCTGCTGGGATGGGTCTGGG + Intergenic
1001858625 5:175033897-175033919 AAAGATGCTGACATTGGCCTGGG + Intergenic
1003481226 6:6535129-6535151 AAAGCTGCTGAAACTGTAATTGG + Intergenic
1004305177 6:14494346-14494368 AAACCTGCTGAAATTTTTATTGG + Intergenic
1010539945 6:77080696-77080718 AATGCTTATGAGATTGGTCTGGG + Intergenic
1011014021 6:82735370-82735392 AAAGCTGCAAAGTTTGGTTTTGG + Intergenic
1013200038 6:107885603-107885625 AAAGCTGCTGAAATTTACATTGG - Intronic
1013740826 6:113282275-113282297 AAACCTGCTGAAATTAGTAAGGG - Intergenic
1014136946 6:117900671-117900693 AAACCTGCTGAGATTTTTATAGG + Intergenic
1014591788 6:123281814-123281836 AATGCTGATGAGGTTGATATAGG - Intronic
1015430692 6:133127689-133127711 AGAGCTGGTGAGATTGGTCCTGG + Intergenic
1016794007 6:148098134-148098156 AAAGATGCTGATATTAGTTTTGG + Intergenic
1018622095 6:165739554-165739576 AAAGCTTTTGAAATTGGTCTGGG + Intronic
1018881030 6:167880999-167881021 AAACCTTCTGAGATTGTGATTGG + Intronic
1020701787 7:11493273-11493295 AAAGTTGGTGAGTTTGGGATGGG + Intronic
1021678056 7:23100815-23100837 AAAGCTGCTGAGTGTGGAAAGGG + Intergenic
1021924213 7:25519276-25519298 AGAGCTGCTGAGCTTGTTACAGG + Intergenic
1023323593 7:39027535-39027557 AGAGCTGCTCTGATTGGAATTGG - Intronic
1023445379 7:40226143-40226165 AATCCTGCTGAGGTTGGTTTTGG + Intronic
1023535847 7:41208834-41208856 AAGGCGGCTGAGATTTTTATTGG + Intergenic
1023581278 7:41686308-41686330 AGAGCTTCTAAGATTGGTGTGGG + Exonic
1023756191 7:43419196-43419218 AAAGATAGTGAGATTTGTATTGG + Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1027994896 7:85413597-85413619 ACAGCTGCTGAGATAGGGATGGG - Intergenic
1038629177 8:29224510-29224532 AAAACAGCTGTGATTTGTATTGG + Intronic
1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040479806 8:47814772-47814794 AAAACTGCTGAGATTTTGATTGG - Intronic
1040551784 8:48443698-48443720 GAAGCACCTGAGAGTGGTATTGG + Intergenic
1041326793 8:56675723-56675745 AAGTCTGCTGAGATTGGGAGAGG - Intergenic
1041626992 8:60041606-60041628 TAAGCTGGTGAGCTTGGCATGGG - Intergenic
1042117459 8:65447778-65447800 AAAGAAGCTGAGGTTGGTTTTGG - Intergenic
1045553290 8:103191870-103191892 AAAGCTGCAGAGACAGGAATGGG + Intronic
1046194227 8:110837713-110837735 AACCTTGCTGATATTGGTATTGG + Intergenic
1046825532 8:118687406-118687428 AAACCTGCTGAGATTTTGATAGG + Intergenic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1051549528 9:18313754-18313776 AAACCTCCTGACATTGGTCTTGG + Intergenic
1055644079 9:78346498-78346520 AAAGCTGTGGAGAGTGGTCTTGG + Intergenic
1056896714 9:90557953-90557975 AACTGTGCTGAAATTGGTATTGG - Intergenic
1057762865 9:97890626-97890648 AGTGCTGCTGAGGTTGGCATGGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186083411 X:5958598-5958620 AAAGCTCCTGAAGTTGGTAATGG + Intronic
1186751513 X:12626456-12626478 AAATCTGCTGATAGTTGTATTGG - Intronic
1187171040 X:16852366-16852388 AAAGCTTCTGGGATGGTTATGGG - Intronic
1188671558 X:32887786-32887808 AAAGCTTATGACATTGGTCTGGG + Intronic
1190719063 X:53132201-53132223 AAGCCTGCTGAGATTTTTATAGG - Intergenic
1192275252 X:69623205-69623227 AAACGTGCTGAGATTTTTATTGG + Intronic
1192350952 X:70355682-70355704 GAAGCTGCTGGGAATGGTCTTGG + Intronic
1194168054 X:90546409-90546431 AGAGCTGCTGAGATTTTTATTGG - Intergenic
1194611163 X:96047564-96047586 AAAATTGCTGATATTTGTATTGG - Intergenic
1195080172 X:101363054-101363076 AAAGCTGGGGAGATTGGCCTGGG - Intronic
1196370179 X:114968852-114968874 AACCCTGCTGATATTTGTATTGG - Intergenic
1196882641 X:120212563-120212585 AAGGCTGCTGAGATAGGAAAGGG - Intergenic
1197176695 X:123493707-123493729 AAAGCTGCTGACATGGGGAGAGG - Intergenic
1197201870 X:123755306-123755328 ACAATTGCTGAGATTGGTATAGG + Intergenic
1197837079 X:130706319-130706341 AAAGCTGCTGCAATGGGTTTGGG + Intronic
1198488638 X:137114987-137115009 TAAGCTGAGGAGAGTGGTATGGG + Intergenic
1198510439 X:137345270-137345292 TAATCTGCTCAGTTTGGTATTGG + Intergenic
1198602153 X:138295533-138295555 ACAGCTGCTGAGAATGGTAGGGG + Intergenic
1200514304 Y:4124191-4124213 ACAGCTGCTGAGATTTTTATTGG - Intergenic
1201528960 Y:14970779-14970801 AAAGCTGCTGACACTGGACTGGG + Intergenic