ID: 1027457504

View in Genome Browser
Species Human (GRCh38)
Location 7:78411835-78411857
Sequence ATTTAAATGAATAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027457501_1027457504 -6 Left 1027457501 7:78411818-78411840 CCCTGATTCTTGACTTCATTTAA 0: 1
1: 0
2: 3
3: 23
4: 384
Right 1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG No data
1027457502_1027457504 -7 Left 1027457502 7:78411819-78411841 CCTGATTCTTGACTTCATTTAAA 0: 1
1: 0
2: 1
3: 41
4: 370
Right 1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027457504 Original CRISPR ATTTAAATGAATAAGGAGAA AGG Intronic
No off target data available for this crispr