ID: 1027466154

View in Genome Browser
Species Human (GRCh38)
Location 7:78516843-78516865
Sequence ATAAACAATACCAAGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027466149_1027466154 -10 Left 1027466149 7:78516830-78516852 CCTTTTGTGCCTAATAAACAATA 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 212
1027466147_1027466154 -2 Left 1027466147 7:78516822-78516844 CCAAAGGCCCTTTTGTGCCTAAT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 212
1027466148_1027466154 -9 Left 1027466148 7:78516829-78516851 CCCTTTTGTGCCTAATAAACAAT 0: 1
1: 0
2: 1
3: 21
4: 289
Right 1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027466154 Original CRISPR ATAAACAATACCAAGACTGG GGG Intronic
902129704 1:14248994-14249016 AAAATCAATACAAAGGCTGGGGG - Intergenic
905961046 1:42042522-42042544 AGACACAATACTAATACTGGAGG + Intergenic
907880798 1:58547682-58547704 ATAAACCCTACGAAGACTGAAGG - Intergenic
908466347 1:64399801-64399823 ATAGACAACACCCAGACTGAGGG - Intergenic
909484126 1:76155009-76155031 ATAAAAAATAAAAAGATTGGTGG - Intronic
909751280 1:79164880-79164902 ATAGACATATCCAAGACTGGGGG - Intergenic
911024758 1:93424928-93424950 ATTAACAATACCAGGCATGGTGG - Intergenic
911394047 1:97283904-97283926 AAAAACAATACCAAGGCCTGAGG - Intronic
911440431 1:97920370-97920392 ATAAACAATACTATGACTAGAGG + Intronic
912186583 1:107283648-107283670 ATAAAAAATACCAAGTCTCTGGG - Intronic
914976325 1:152366833-152366855 ATAAACAATATCAAGATTATTGG - Intergenic
915484341 1:156209893-156209915 ATAAATACTAACAAGAGTGGTGG - Intronic
916182754 1:162101371-162101393 AACAACAATAACAAGACTGGAGG - Intronic
916476109 1:165170530-165170552 ATAAACTATACCAAGCCAGCAGG + Intergenic
917069177 1:171130464-171130486 AAAAAAAATACCAAAACTGAGGG + Intergenic
917320569 1:173776858-173776880 AGCAACAAGACCAAAACTGGAGG - Intronic
918227431 1:182496912-182496934 ATAAATCCTACCAAGACTGAAGG - Intronic
919286570 1:195569336-195569358 ATCAACAATTCCAAAAGTGGGGG + Intergenic
920453496 1:206079055-206079077 ATAAAGAAACTCAAGACTGGGGG - Intronic
920903907 1:210140936-210140958 AAAAACAATAACAAGGTTGGAGG - Intronic
921773373 1:219070017-219070039 ACAAACAATACCAAGGGTTGAGG + Intergenic
922901637 1:229141647-229141669 ATAAATACTACCAAGACCTGGGG + Intergenic
1062862983 10:824557-824579 TTAAACAAAACCAAAAATGGTGG + Intronic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1068517530 10:58042800-58042822 GCAAACAAAGCCAAGACTGGAGG + Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1069321655 10:67179328-67179350 ATAAATATTACCAAGATTTGAGG + Intronic
1069505034 10:68989848-68989870 AAAAAAATTACCAAGAATGGTGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1078035835 11:7804210-7804232 ATAAAAAATACTTAGACTGGGGG - Intergenic
1079993925 11:27275270-27275292 AGAAAGACAACCAAGACTGGAGG + Intergenic
1080058338 11:27931077-27931099 ATAAACAATACAAAGACAGAAGG + Intergenic
1080181694 11:29433600-29433622 ATAAATAATACCAATACGGCCGG + Intergenic
1084636303 11:70395166-70395188 AAAAACAAAAACAAAACTGGTGG - Intergenic
1085811142 11:79682112-79682134 AGAATCAAAACCAAGACTTGAGG - Intergenic
1087264538 11:96045919-96045941 AAAAACAATAACAGGAATGGGGG - Intronic
1089144928 11:116320744-116320766 TTAAAGAAGACCAAAACTGGTGG + Intergenic
1090975455 11:131676300-131676322 TAAAACAAAACCAAGACTGATGG + Intronic
1095623844 12:44290626-44290648 ATAAAAAAGAACAAAACTGGAGG - Intronic
1095634358 12:44415295-44415317 ATAAACAATAGCAAAAAAGGTGG - Intergenic
1099680352 12:85820083-85820105 ATGAACCATACAAAAACTGGTGG - Intronic
1099909811 12:88815804-88815826 AGAACCAATACAAAGACTGTTGG + Intergenic
1100553080 12:95665262-95665284 ATAAACAAAACAAAAACTGTAGG - Intronic
1100558883 12:95727078-95727100 ACAAACAATAACAAGTCTTGGGG - Intronic
1102795230 12:115683522-115683544 ATAAACACTTCCAGCACTGGAGG - Intergenic
1106718135 13:32412472-32412494 ACAAACATTAGCCAGACTGGTGG + Intronic
1109301440 13:60593697-60593719 TTAAAAAATAATAAGACTGGAGG + Intergenic
1109993515 13:70090357-70090379 ATAATGAGTAACAAGACTGGGGG + Intronic
1115909918 14:38244240-38244262 ATAAACAATTACAGCACTGGAGG + Intergenic
1115935859 14:38551528-38551550 ACAAACAACACATAGACTGGGGG + Intergenic
1116003804 14:39271420-39271442 ATAAACAAAAACAACGCTGGGGG - Intronic
1116148366 14:41104307-41104329 ATCAAAAAGAACAAGACTGGGGG - Intergenic
1116718625 14:48462503-48462525 ACAAAAAATACAAATACTGGTGG + Intergenic
1116915058 14:50517015-50517037 GTAAATAATAACTAGACTGGTGG - Intronic
1119081762 14:71701197-71701219 ATAAACAATAGGAAGACCTGGGG - Intronic
1120696625 14:87652182-87652204 ATAAATTATATCAATACTGGGGG + Intergenic
1120895042 14:89522523-89522545 AAAAACAATAACATGAATGGTGG + Intronic
1121442178 14:93956285-93956307 ATAAACAAAACAAAGGCTGTGGG + Intronic
1126677121 15:51170024-51170046 AGAAACAATTGCAGGACTGGGGG + Intergenic
1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG + Intronic
1128179358 15:65587985-65588007 ATAAAAAATAATAAGACGGGAGG + Intronic
1128506153 15:68274307-68274329 AAAAACAAAACCAAGGCTGGAGG - Intergenic
1128652058 15:69424030-69424052 ATAAATAATACGAAGACCTGTGG + Intronic
1128695092 15:69755803-69755825 AGAAACAGTTTCAAGACTGGTGG + Intergenic
1128955180 15:71933816-71933838 ATACCCATTACCAAGACTGTAGG + Intronic
1130571544 15:85049698-85049720 ATAAACAAAGCCAGGAGTGGTGG - Intronic
1132169993 15:99640982-99641004 ATAAACATCAACTAGACTGGTGG - Intronic
1133884232 16:9810763-9810785 ATAACCAATAACAAGCATGGTGG - Intronic
1138334955 16:56245813-56245835 AGACACAGTACCAAGTCTGGAGG + Intronic
1141260406 16:82448376-82448398 CTTGACAATACCAAGAGTGGAGG - Intergenic
1141878278 16:86841347-86841369 ATAAATAAGAGAAAGACTGGTGG - Intergenic
1144683242 17:17209103-17209125 ATAAACAAAAATAAAACTGGGGG + Intronic
1145082577 17:19907317-19907339 ATAAAAAATACCAGAAATGGGGG - Intronic
1145377713 17:22366460-22366482 ACAAACAAAACCAAGGATGGTGG + Intergenic
1145841935 17:28002486-28002508 ATAAAAAATACCATGACTAGTGG - Intergenic
1150030207 17:61726039-61726061 ATAAACTATAACACGAATGGTGG - Intronic
1150897869 17:69235112-69235134 ATAAACAACACCATTTCTGGAGG + Intronic
1150999420 17:70357269-70357291 ATTACAAATACAAAGACTGGAGG - Intergenic
1153665648 18:7365812-7365834 ATGAAAACTACCCAGACTGGGGG + Intergenic
1154098382 18:11442864-11442886 ATAAACAATGATAAGATTGGTGG - Intergenic
1154471187 18:14703321-14703343 ATTAACATTAACAAGACTGGTGG + Intergenic
1155030913 18:21982928-21982950 ATAAAATATACCAAGATTTGTGG + Intergenic
1155731663 18:29167341-29167363 AGAAAAAAGACCAAAACTGGAGG - Intergenic
1155753413 18:29458196-29458218 AAAAGCATGACCAAGACTGGGGG - Intergenic
1156156545 18:34309440-34309462 AAAAACAACAACAAGACTGTAGG - Intergenic
1157090903 18:44635723-44635745 ATAAAGAATACCAGGAATGTGGG - Intergenic
1157955564 18:52093806-52093828 ATAAACAAAACCAAGACTTTTGG + Intergenic
1159463832 18:68754175-68754197 AAAAACAATAGCAAGACTTTTGG + Intronic
1159516210 18:69461599-69461621 ATAAATAATATAAAGATTGGAGG - Intronic
1163239969 19:16055511-16055533 AGAAAAAATAACAAAACTGGAGG - Intergenic
1163529267 19:17840306-17840328 ATCAACAAGCTCAAGACTGGGGG - Exonic
1164872506 19:31657601-31657623 GTACACAATACACAGACTGGGGG - Intergenic
1166922414 19:46238639-46238661 ATAAAGAATAGCATGGCTGGAGG - Intergenic
925797871 2:7566357-7566379 AGAAACAGCACCAAGAATGGTGG + Intergenic
929478252 2:42275879-42275901 AGTAACAATACAAAGTCTGGTGG - Intronic
930125203 2:47790834-47790856 ATAAACAATTCCAAGTCTTCTGG - Intronic
930174499 2:48288082-48288104 ATAGACATACCCAAGACTGGCGG + Intergenic
930489627 2:52051810-52051832 ATATACAATACCAAGATTTGGGG + Intergenic
932993728 2:76821604-76821626 ATAACCAATATCAACACTGCTGG + Intronic
934889597 2:98055729-98055751 ATAATCAAAAACAATACTGGAGG + Intergenic
936409817 2:112247787-112247809 ATATATAATACGAAGTCTGGAGG + Intronic
937540842 2:122950910-122950932 AAAAAAAACACCAAGGCTGGAGG - Intergenic
937555383 2:123148193-123148215 AGATACAAAAACAAGACTGGCGG + Intergenic
939792971 2:146602845-146602867 ATAAACAAAACATAGTCTGGAGG + Intergenic
944575552 2:201087938-201087960 AAAAACAAAAACAAGACAGGTGG - Intergenic
947189916 2:227493127-227493149 CAAAACAATACCAAGATTGAAGG + Intronic
947467327 2:230362895-230362917 AAAAAGAATAACATGACTGGAGG + Intronic
948403480 2:237701207-237701229 AGAAACACAACCAACACTGGTGG - Intronic
948628954 2:239289551-239289573 ATAAAGAATAAAAAGACAGGAGG + Intronic
1168855949 20:1009120-1009142 ATGAAAAATACCATAACTGGGGG + Intergenic
1168990591 20:2092606-2092628 AGAAACAATACCAAAAGTAGAGG - Intergenic
1170644425 20:18184471-18184493 AAAAAAAACACCAAAACTGGAGG - Intronic
1172810421 20:37643771-37643793 AGAAAGAACCCCAAGACTGGAGG + Intergenic
1177256616 21:18671287-18671309 AGAAACAAAAACAAAACTGGAGG + Intergenic
1182887511 22:33788058-33788080 ACAAATAATACCAAGTATGGTGG - Intronic
1185382484 22:50516419-50516441 AGAAACAACACAAAGACAGGGGG - Intronic
949478497 3:4471329-4471351 TTAAACAAGACCAGGAGTGGTGG - Intergenic
951506146 3:23446899-23446921 CTAAACTACACCAATACTGGGGG - Intronic
952213161 3:31249842-31249864 ATAAACAATTGCTAGACTGAAGG + Intergenic
953548509 3:43882877-43882899 ATACCCAGGACCAAGACTGGTGG - Intergenic
956932798 3:74064666-74064688 AAAAACAATTCCAATGCTGGTGG + Intergenic
957435898 3:80176065-80176087 ATAAATCATTCCAAAACTGGAGG - Intergenic
959328162 3:104964807-104964829 ATTGACAATACCAACATTGGGGG - Intergenic
960329058 3:116335417-116335439 AAAAACAAAAACAAAACTGGAGG + Intronic
960455567 3:117867036-117867058 ATAAAAAATACCATAAATGGAGG + Intergenic
960933125 3:122874860-122874882 AGAAACAAAACAAACACTGGTGG - Intronic
961950918 3:130748034-130748056 ACAAACAATACAAAAACTAGCGG - Intergenic
962302430 3:134254069-134254091 ACAAACAAAACCAAGAGTGGAGG - Intergenic
964287549 3:155135573-155135595 AGCAACAAGAACAAGACTGGAGG - Intronic
964289871 3:155165871-155165893 AGAAATAATACAAAGACTGAGGG + Intronic
965595413 3:170405990-170406012 ATAAAATATACCAAGACTTACGG - Intergenic
965598298 3:170429649-170429671 ATACTCAAAACCAAGACTGATGG + Intronic
970512562 4:16795629-16795651 ATGAACAATACCATGAATGGAGG + Intronic
971168260 4:24206526-24206548 ATAAAAAATACTAACATTGGAGG + Intergenic
971215276 4:24656845-24656867 AGAAACAAAACAAAAACTGGGGG - Intergenic
972984148 4:44743373-44743395 AAAAACAATAGCATGATTGGAGG + Intergenic
973621907 4:52735321-52735343 AAAAACAAAACAAAGACTAGAGG + Intronic
974257983 4:59487037-59487059 ATAAATAATGCCTAGTCTGGTGG - Intergenic
976024714 4:80673570-80673592 ATCAACAAGACCAAGACAGAAGG - Intronic
978033979 4:103972175-103972197 GTTAACAGTACCAAGATTGGTGG - Intergenic
979511055 4:121554213-121554235 ATAGCCAATACCAATACTTGCGG + Intergenic
980241587 4:130184395-130184417 ATAAAAAATAACAAGCCTTGTGG + Intergenic
980440320 4:132835280-132835302 ATAAACAATCCCACCACTGAAGG - Intergenic
981173728 4:141655383-141655405 AAAAACAATTCTAAGATTGGTGG + Intronic
981185940 4:141803404-141803426 ATATACAAAGCCAGGACTGGAGG + Intergenic
982302968 4:153898990-153899012 ATAAAAAGTACAAAGAGTGGTGG - Intergenic
986520968 5:8617658-8617680 ATACCCAATAACAAGACTGCTGG - Intergenic
987733162 5:21803397-21803419 ATACACATTACCAAGAATTGTGG + Intronic
988510631 5:31861730-31861752 AGAAACCATACCAAGTCTGCAGG - Intronic
988609370 5:32710847-32710869 AAAAAAAAAACCAGGACTGGGGG - Intronic
989373359 5:40733127-40733149 ATAAGAAATCCCAAGACTAGGGG + Intronic
990100025 5:52171582-52171604 AAAAACATTACCAAGACTCTTGG + Intergenic
990771425 5:59250733-59250755 ATAAAAAATAACAAAGCTGGAGG + Intronic
991627527 5:68619487-68619509 ATAAAAAATGAGAAGACTGGGGG - Intergenic
992198238 5:74360600-74360622 GAAAACACTCCCAAGACTGGAGG + Intergenic
994645803 5:102467414-102467436 AAAAAAAATAACAAAACTGGTGG + Intronic
994804692 5:104429277-104429299 ATAAACGAAAACAAGTCTGGAGG - Intergenic
995284666 5:110374107-110374129 ATGAAAAATAACAAAACTGGAGG - Intronic
996961092 5:129250807-129250829 ATAAACAATACAAAAACAGAGGG - Intergenic
998438433 5:142134739-142134761 ATGAACAATACCAACACATGTGG - Intronic
1000507288 5:162137020-162137042 ATAAACAACCCCGAGAATGGTGG + Intronic
1004345708 6:14847293-14847315 AAGAATAATACCAGGACTGGTGG + Intergenic
1005587054 6:27287077-27287099 ATAAAGAAAAACATGACTGGGGG + Intronic
1007002342 6:38326043-38326065 AGAAACTTTACCAAGACTAGGGG + Intronic
1008996112 6:57661274-57661296 ATAAAGAAAACCAGAACTGGGGG + Intergenic
1009184641 6:60560053-60560075 ATAAAGAAAACCAGAACTGGGGG + Intergenic
1009492218 6:64305435-64305457 TTGAAAAATAACAAGACTGGTGG + Intronic
1009696242 6:67107563-67107585 ATCAAAAATAACAAAACTGGAGG + Intergenic
1011018636 6:82786389-82786411 ATAAATAATAGCAAGGCAGGTGG - Intergenic
1011974313 6:93275776-93275798 ATAATCAGTAACAAGAATGGTGG + Intronic
1014758813 6:125331919-125331941 ATCAACAAAATCAAGACTGCAGG - Intergenic
1014822103 6:126001580-126001602 ATAAACAGTACAATTACTGGTGG + Intronic
1016022961 6:139255138-139255160 ATAAATAATATCAAGACATGAGG + Intronic
1019974844 7:4572889-4572911 ACAATCAAAACCAAGAGTGGAGG + Intergenic
1020329231 7:7001324-7001346 ATAAACAAGAGCAGGACTGAGGG + Intergenic
1024518724 7:50284161-50284183 ATAAACAATGCCAAGAAGGTGGG + Intergenic
1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG + Intronic
1027886929 7:83920456-83920478 ATAAACAATAGAAACTCTGGAGG + Intergenic
1028185524 7:87780924-87780946 ATAAAAAATAACAAAGCTGGAGG - Intronic
1028974745 7:96899914-96899936 ATTAACAAAACCTAAACTGGGGG + Intergenic
1029801335 7:102950812-102950834 ATAGACAATAAAAAGATTGGTGG + Intronic
1030279993 7:107763924-107763946 ATAAACCAGAACAAGATTGGAGG - Intergenic
1030901422 7:115129809-115129831 AATAAAAATACCAAGACTGGAGG + Intergenic
1032735269 7:134686977-134686999 ATATAAAATACCAAGACTCCTGG - Intergenic
1033081632 7:138304249-138304271 ATAAACAACTCCAATGCTGGAGG - Intergenic
1034310567 7:150084172-150084194 ATAAAGAATTACAAGACTTGAGG - Intergenic
1034796272 7:154016458-154016480 ATAAAGAATTACAAGACTTGAGG + Intronic
1035462528 7:159052224-159052246 ATTGACAATACCAGGACTGAAGG + Intronic
1036966777 8:13307432-13307454 ACAAACATTACCAAAACTGTAGG - Intronic
1037359363 8:18056755-18056777 ATAAACAAGTCAAAGACTTGTGG - Exonic
1038262988 8:26013831-26013853 AGAAACAATGCCATGATTGGTGG - Intronic
1038327908 8:26586520-26586542 AAAAACAAGAACAAGAGTGGGGG - Intronic
1039831534 8:41219119-41219141 AGAAACAATACCATGTATGGAGG - Intergenic
1039880094 8:41620273-41620295 TGAAACAATCCCAAGTCTGGTGG + Intronic
1041029295 8:53719514-53719536 GAAAACATTCCCAAGACTGGGGG + Intronic
1042420653 8:68584731-68584753 ATAAAGAAAACCAAGACCAGAGG - Intronic
1043781953 8:84347238-84347260 ATTAATAATAACAAGATTGGGGG - Intronic
1044017874 8:87068453-87068475 AGAAACAATACCAAGGCTCCAGG + Intronic
1044171982 8:89064965-89064987 AGAAAAAAAACCAAAACTGGAGG - Intergenic
1045368979 8:101502321-101502343 ATGAACATTAGCAAGACAGGAGG + Intronic
1046745361 8:117870188-117870210 ATAAACAAAACTAAAACTGAAGG + Intronic
1046785991 8:118267371-118267393 AGAAATAAAACCAAGAGTGGAGG + Intronic
1047636631 8:126770561-126770583 GTAAGCAATACCAAGAACGGAGG - Intergenic
1051500006 9:17766071-17766093 AGAAATGAGACCAAGACTGGAGG + Intronic
1052085848 9:24264612-24264634 ATGACCAATACCAAGTCTTGGGG - Intergenic
1056161023 9:83894055-83894077 ATAAACCTTATCAAAACTGGAGG + Intronic
1056359109 9:85835209-85835231 ATAAACCTTATCAAAACTGGAGG - Intergenic
1056903056 9:90619144-90619166 AAAAACAAAACAAAGGCTGGGGG + Intronic
1057362195 9:94383607-94383629 TTAAAAAATAACAAGATTGGGGG - Intronic
1057661150 9:97004492-97004514 TTAAAAAATAACAAGATTGGGGG + Intronic
1058457512 9:105151263-105151285 ATAACCCATACCAATGCTGGAGG - Intergenic
1059916495 9:119108595-119108617 ATAAAGAATACTAAAAATGGTGG - Intergenic
1061104944 9:128522777-128522799 ATAAAGAATTCCAGGACTTGCGG + Exonic
1187510231 X:19910947-19910969 ATAAACAAGACTCAGATTGGTGG - Intergenic
1190483262 X:50898751-50898773 ATAAACAAGAGCAATACTTGTGG - Intergenic
1190572480 X:51797988-51798010 ATGAAAAATACTAATACTGGTGG + Intergenic
1191722392 X:64244143-64244165 ACAAACAAAACCAAAGCTGGAGG - Intergenic
1193159438 X:78211541-78211563 AGAAAAAATAACAAAACTGGAGG - Intergenic
1193368615 X:80665357-80665379 AATAACAATACCAAGCATGGAGG - Intergenic
1195888377 X:109666378-109666400 AGAAACAGTAAGAAGACTGGTGG + Intronic
1197796908 X:130307455-130307477 ATAAAAAATAAACAGACTGGTGG - Intergenic
1199308427 X:146294308-146294330 CTAAACAAGAACAAAACTGGAGG - Intergenic
1200423040 Y:2992591-2992613 ATAAACATAACCAAGTATGGAGG - Intergenic
1201321653 Y:12705143-12705165 ATAAAACATACCAAAACTGATGG - Intronic
1201959648 Y:19665235-19665257 ACAAACAATAGCAAGTGTGGTGG - Intergenic