ID: 1027467433

View in Genome Browser
Species Human (GRCh38)
Location 7:78533471-78533493
Sequence AGGTTCCAGTGTAATCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027467433 Original CRISPR AGGTTCCAGTGTAATCTCTG AGG Intronic
902223907 1:14984430-14984452 AGGTACCAGGGTTCTCTCTGTGG + Intronic
905909973 1:41647069-41647091 AGGTCCCAGTGGAATCTCAAGGG - Intronic
908759380 1:67498013-67498035 TGGGTCCAGTGTAATCACAGGGG + Intergenic
912623774 1:111191306-111191328 AGGTTCCACTGTTGTCTATGTGG + Intronic
913524848 1:119681035-119681057 AGTCTCAAGTGAAATCTCTGTGG + Intronic
915117612 1:153610538-153610560 AGGTGGCAGAGTCATCTCTGGGG - Intronic
918299214 1:183186818-183186840 AGGTTCCTTTGCAATCTTTGTGG - Intronic
919686598 1:200488702-200488724 AGGAGCCAGAGGAATCTCTGTGG - Intergenic
921774843 1:219085261-219085283 AGTTTACAGGGTAATCACTGCGG - Intergenic
923349740 1:233092402-233092424 AATGTACAGTGTAATCTCTGGGG - Intronic
1062844808 10:695865-695887 AGGATCCTGTGTGACCTCTGGGG + Intergenic
1062844834 10:695982-696004 AGGATCCTGTGTGATCTCTGGGG + Intergenic
1062844842 10:696016-696038 AGGATCCTGTATGATCTCTGGGG + Intergenic
1062844878 10:696214-696236 AGGATCTTGTGTGATCTCTGGGG + Intergenic
1062844889 10:696297-696319 AGGGTCCTGTGTGATCTTTGAGG + Intergenic
1064982535 10:21179065-21179087 AGGATCCAGTGTAATCACAAGGG + Intergenic
1065672882 10:28140823-28140845 TGGTTCCAGTGCCATCTCTGGGG - Intronic
1068734225 10:60393798-60393820 AAGTGACAGTGTCATCTCTGTGG - Intronic
1073287603 10:102398162-102398184 AGCTCCCGGTGGAATCTCTGGGG - Intronic
1075962649 10:126582555-126582577 AGATTCCATTGTAATGTCTGTGG + Intronic
1076182610 10:128422266-128422288 GGGTTCCAGAGTGGTCTCTGGGG - Intergenic
1076476556 10:130757740-130757762 AGGGCCCAGTGTAATCACAGGGG - Intergenic
1078760947 11:14251469-14251491 AGGTTCCAGGGTAATGTGTTAGG + Intronic
1079521765 11:21336163-21336185 AGGTTCTAGTTTAATGTCTAAGG - Intronic
1087925662 11:103915772-103915794 AGATTGCAGTGTAATTTCTGAGG - Intronic
1091563039 12:1629331-1629353 AGGCTCCAGTGGAATCTCTCTGG - Exonic
1096613674 12:52819293-52819315 GGGCTGCAGTATAATCTCTGAGG + Intergenic
1096849554 12:54426922-54426944 AGGTTGCAGTGTAATAAGTGGGG - Intergenic
1098611540 12:72464483-72464505 ATGTTGAAATGTAATCTCTGTGG - Intronic
1102429263 12:112868894-112868916 AGGCTCCAGTGTGATCTTGGTGG - Intronic
1104125863 12:125845275-125845297 AGTTTCCAGTGTAATCTGGGAGG - Intergenic
1112163969 13:96897907-96897929 TGGACCCAGTGTTATCTCTGGGG + Intergenic
1115607873 14:35023387-35023409 AGGATCCACTGGATTCTCTGGGG - Intronic
1117218102 14:53572819-53572841 GAGTTCCAGTATAAGCTCTGTGG - Intergenic
1121343295 14:93117349-93117371 AGGTTCCAGGGTCAGCTCTGTGG + Intergenic
1128347294 15:66862498-66862520 AGGTTACAGTGGATTCCCTGCGG + Intergenic
1130685876 15:86037115-86037137 TGCTTCCAGTGCCATCTCTGTGG + Intergenic
1136144478 16:28308136-28308158 AGGTTCAAATCTAATCTCTCTGG + Intronic
1143351375 17:6290762-6290784 AGCTTCCTCTCTAATCTCTGGGG - Intergenic
1152581760 17:81168452-81168474 TGGTTCCAGCGAAATCTCAGAGG - Intergenic
1156260783 18:35443562-35443584 AGGCTTCAGTACAATCTCTGGGG + Intergenic
1156590281 18:38480299-38480321 AGAATCCAGTGCAAACTCTGAGG + Intergenic
1157121262 18:44913405-44913427 AGATTCAAGTGTAAACTCTCTGG + Intronic
1158370524 18:56797313-56797335 AGGTCCAAATGTAATCTCTTTGG - Intronic
1158920302 18:62185193-62185215 TGGTTCCATTTTAATCTCTCTGG + Intronic
1162002822 19:7758154-7758176 AAGTTCCAGAGTAATCTCCTTGG - Intergenic
1166252285 19:41579426-41579448 AGGTTCCAGTGTTATTTGTGTGG - Exonic
1166255995 19:41605027-41605049 AGGTTCCAGAGTCATCTGTGGGG - Intronic
1166347150 19:42173755-42173777 AGGTTGCAGTGTCATCTTTGGGG - Intronic
1167548749 19:50145005-50145027 AGGTTCCAGGGATATCTCTGGGG - Intergenic
1168421792 19:56208856-56208878 CTCTTTCAGTGTAATCTCTGCGG + Exonic
925578449 2:5384935-5384957 AGTCTCCAGTGTAAGCTCTGTGG - Intergenic
929005217 2:37387165-37387187 AGGATCCAGTGTCATTTCTATGG + Intergenic
929625407 2:43401746-43401768 AGGATTCAGTGAAAACTCTGAGG + Intronic
931009878 2:57898113-57898135 TGGCTCCTGTGTACTCTCTGGGG + Intergenic
931219585 2:60277148-60277170 AGGTTCCAGGATAAGTTCTGGGG + Intergenic
931767692 2:65471347-65471369 TGGTGCCACTGTTATCTCTGGGG - Intergenic
934575909 2:95401528-95401550 AGGTTCCATTTCAATATCTGTGG + Intergenic
936437744 2:112522722-112522744 AGGTTCGAGCTTAGTCTCTGGGG - Intronic
937152597 2:119696231-119696253 TGGTTCTAGTTTAATCCCTGAGG - Intergenic
938824491 2:134991441-134991463 AGGGTCAAGTGTAATTGCTGAGG + Intronic
943362004 2:186931007-186931029 AATTTCCAGAGTAATCTCTAGGG - Intergenic
945306518 2:208264532-208264554 AGCTTACAGTTTAATTTCTGTGG - Intronic
947666822 2:231911138-231911160 AGGGTCCAGGGTCGTCTCTGAGG + Intergenic
1169683839 20:8248174-8248196 ATGTTCCAGAGTACTCTATGAGG - Intronic
1172240375 20:33408926-33408948 AGGTTGGGGTGTAGTCTCTGAGG - Intronic
1174301215 20:49583976-49583998 AGCATCCAGTCAAATCTCTGTGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1178140879 21:29681971-29681993 AGGTGCCAGGGTAACCTCTTGGG + Intronic
1179290683 21:40015353-40015375 AGGTGTCAGTGAAACCTCTGAGG - Intronic
1182498420 22:30727558-30727580 AGGTATCAGTGTCCTCTCTGGGG - Intronic
1184652479 22:45925539-45925561 AGGTCCCAATATACTCTCTGGGG - Intronic
1184835397 22:47018068-47018090 AGGTGCCTGAGCAATCTCTGGGG - Intronic
1185419372 22:50726969-50726991 AGCTTCCAGTGCATCCTCTGCGG - Intergenic
949118270 3:355462-355484 AGGTTCCAGTGGAAGATTTGGGG - Intronic
949516245 3:4809755-4809777 TGGAGCCTGTGTAATCTCTGCGG + Intronic
950727027 3:14923227-14923249 AGGCTCCAGTGGCTTCTCTGTGG + Intronic
952828116 3:37540782-37540804 AGGTGCCAGTGTTTTCTGTGTGG + Intronic
952898386 3:38094311-38094333 AGAGTCCTGTGTAATGTCTGGGG - Intronic
953245304 3:41185510-41185532 AGTTTTCAGTGTAGCCTCTGTGG - Intergenic
959585043 3:108018018-108018040 AGGATGCATTGTAATCTCTAAGG - Intergenic
962936799 3:140088791-140088813 AGCTTGCAGTGGAATATCTGAGG + Intronic
964178611 3:153856561-153856583 AGTTTCCAGTGTATGCTCTTTGG - Intergenic
966862386 3:184237554-184237576 GGGGCCCAGTGTGATCTCTGTGG - Intronic
968747703 4:2369418-2369440 AGGTCCCAGAGTAGGCTCTGGGG - Intronic
969087740 4:4669156-4669178 AGGTTCCAATGTGTTTTCTGAGG + Intergenic
969188987 4:5501853-5501875 AGGTCCCAGTGTTTTCTCAGGGG + Intergenic
971375360 4:26051647-26051669 TGGTTCCAGTGCAAGCTTTGGGG + Intergenic
971933371 4:33115724-33115746 AGATCCCAGTTTCATCTCTGGGG + Intergenic
975182258 4:71360245-71360267 AGGTACCAGTATAGTCACTGAGG - Intronic
976080633 4:81351102-81351124 AGGTGCCAGTGCAAACACTGTGG - Intergenic
977507460 4:97920519-97920541 AGGTGTCAGTGGATTCTCTGAGG + Intronic
979053801 4:115970867-115970889 TGGGTCCAGTGTAATTCCTGAGG + Intergenic
982331805 4:154189179-154189201 AGATTCCAGTGTATTATTTGGGG - Intergenic
983572824 4:169228566-169228588 TGAGTCCAGTGTAATCACTGGGG - Intronic
986012264 5:3726574-3726596 AGATTCCAGGGTCATCACTGAGG - Intergenic
993669657 5:90744926-90744948 AAGTTCCATTGTGATTTCTGAGG - Intronic
995476063 5:112549321-112549343 AGGTTTCAGTTTCAGCTCTGCGG + Intergenic
996230425 5:121057375-121057397 AGATTCCAGTGGGATCTCTGGGG - Intergenic
996783354 5:127212684-127212706 AGGTTGCAGTGGGATCCCTGGGG - Intergenic
997779183 5:136640034-136640056 GGGTTGCACTATAATCTCTGAGG - Intergenic
999332334 5:150683660-150683682 AGGTTCTGGTGTTTTCTCTGTGG - Intergenic
1000718146 5:164672685-164672707 AGGTTCCAGAATAATTTCTTGGG - Intergenic
1001123259 5:168997199-168997221 AGGTCCCAGTGTGACCTCTCAGG - Intronic
1001208409 5:169786691-169786713 AAGTTCCAGTATAATCCCTTGGG + Intronic
1001875388 5:175195704-175195726 AGAGTCCAGTGCAGTCTCTGGGG - Intergenic
1003929353 6:10908756-10908778 AGGATTCAGTATAATCTCAGTGG + Intronic
1005420862 6:25649379-25649401 TGGTTCTAGTGTAATCCCTAGGG + Intergenic
1005662530 6:28013745-28013767 AGGTTCTAGTGACATCTTTGGGG - Intergenic
1006288366 6:33115388-33115410 AGTTTCCAGTGTCATCTCTAAGG - Intergenic
1006408050 6:33856551-33856573 AGGTTCCACTGTAACCTCAGAGG - Intergenic
1007126849 6:39432877-39432899 AGGCTCCAGTGTGGTCTCTGTGG - Intronic
1009638406 6:66297713-66297735 AAGTTCCAGCATAATATCTGGGG + Intergenic
1009983491 6:70754267-70754289 AGGTTTCAGTGTCATCTATGAGG - Intronic
1010704232 6:79088851-79088873 TGGTTCCAGTGTAGACTCTGGGG - Intergenic
1012815314 6:104016855-104016877 AGTTCCCAGTGTTAACTCTGTGG + Intergenic
1013507676 6:110815682-110815704 AAGTTCCAGTGTGCTTTCTGCGG + Intronic
1013527256 6:110985987-110986009 AAGCTGCAGTGTTATCTCTGGGG - Intronic
1014814781 6:125923341-125923363 ACGGTACAGTGTATTCTCTGTGG - Intronic
1015605670 6:134952634-134952656 TGATTCCAGAGTCATCTCTGTGG - Intergenic
1015888913 6:137949441-137949463 AAGTTCCTCTCTAATCTCTGGGG + Intergenic
1015911342 6:138170465-138170487 AAGGTCCAGGGAAATCTCTGGGG + Intronic
1016946871 6:149543227-149543249 AGGTTCCAGTTTAATGTTTTTGG - Intronic
1019791964 7:3020186-3020208 GGGCTCCAGTGTAATCACAGTGG + Intronic
1021055424 7:16041406-16041428 AGGTTCTACTGTAATTCCTGAGG + Intergenic
1022266392 7:28759216-28759238 AGTTTCCAGTACAATCTCTGTGG - Intronic
1024521984 7:50313626-50313648 GGGTTCAAGTGTCAGCTCTGTGG + Intronic
1024863165 7:53870092-53870114 GGGATCTAGTGTAATCTCTTGGG - Intergenic
1026642625 7:72140567-72140589 AGGTTGGGGTGTAATCCCTGAGG - Intronic
1027467433 7:78533471-78533493 AGGTTCCAGTGTAATCTCTGAGG + Intronic
1027584636 7:80043576-80043598 TGGGTCCAGTGTAATCACAGAGG - Intergenic
1028680960 7:93531070-93531092 ACATTCCATTGTAATCTCTGTGG - Intronic
1031387620 7:121171570-121171592 AGGTTCCAGAGAAACCACTGGGG - Intronic
1031396204 7:121277496-121277518 AGGTGCAAGTGTATTCTGTGTGG + Intronic
1035619955 8:1029199-1029221 CGGTTCCAGTGCAGGCTCTGTGG - Intergenic
1036179123 8:6568021-6568043 AGGTTCCCATGTGTTCTCTGTGG + Intronic
1036633053 8:10528984-10529006 AGGGGCCAGTGGAATCACTGAGG - Intronic
1042148067 8:65753418-65753440 AGGGTCCAGTGCAGTCTCTCTGG - Intronic
1042928128 8:73987804-73987826 TGGGTCCATTGTAATCACTGGGG + Intergenic
1045840386 8:106573012-106573034 AGTCTCCAGTGTAATAACTGTGG - Intronic
1048703420 8:137120931-137120953 TGCTTCCATTGCAATCTCTGTGG - Intergenic
1050715728 9:8523068-8523090 AGGAGCCAGTGTAGACTCTGAGG + Intronic
1052400546 9:27994662-27994684 TGGTTCCTGTGTTATCTCTTAGG - Intronic
1052981321 9:34451724-34451746 AGGTCCCAGTGTGGCCTCTGTGG - Intronic
1059738470 9:117126205-117126227 AAGTTTCAGTCTAAGCTCTGAGG + Intronic
1060767745 9:126307743-126307765 CGGCTCCAGTGTGAGCTCTGTGG + Intergenic
1062692717 9:137851965-137851987 GGGCTCCAGTGTGATATCTGTGG - Intronic
1186669709 X:11757204-11757226 AGCTTCCAGGCTAATCTCTGCGG - Intergenic
1186954973 X:14671650-14671672 AGGTACCAGAGAAATCTCTTAGG + Intronic
1189759566 X:44307046-44307068 AGGGGCCAGTGTAACCTCTCAGG + Intronic
1196979809 X:121198991-121199013 AGGTTCAACTGTAGTTTCTGTGG + Intergenic
1197717362 X:129719182-129719204 AGGTTCTAGGGGAACCTCTGGGG - Intergenic
1199064219 X:143395139-143395161 AGGGTTCAGTGGAATCCCTGGGG + Intergenic
1199710260 X:150464022-150464044 AGGTTCCATTGTACTCACTGAGG - Intronic