ID: 1027468105

View in Genome Browser
Species Human (GRCh38)
Location 7:78540253-78540275
Sequence CTGTAGCCACTGTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027468095_1027468105 13 Left 1027468095 7:78540217-78540239 CCTGTCTGAGCTCAGCCTGTCCT 0: 1
1: 2
2: 12
3: 53
4: 318
Right 1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG No data
1027468099_1027468105 -2 Left 1027468099 7:78540232-78540254 CCTGTCCTTGAGCGGGGCTTGCT 0: 1
1: 0
2: 10
3: 44
4: 131
Right 1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG No data
1027468100_1027468105 -7 Left 1027468100 7:78540237-78540259 CCTTGAGCGGGGCTTGCTGTAGC 0: 2
1: 2
2: 34
3: 201
4: 492
Right 1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027468105 Original CRISPR CTGTAGCCACTGTTGGGGAT GGG Intronic
No off target data available for this crispr