ID: 1027468816

View in Genome Browser
Species Human (GRCh38)
Location 7:78548383-78548405
Sequence AGCAATCTTAAAATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027468816_1027468819 -8 Left 1027468816 7:78548383-78548405 CCTCCATGTATTTTAAGATTGCT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1027468819 7:78548398-78548420 AGATTGCTTTCATGTCGGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 94
1027468816_1027468824 30 Left 1027468816 7:78548383-78548405 CCTCCATGTATTTTAAGATTGCT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1027468824 7:78548436-78548458 CTGTAATCCCAGCACTTTGGAGG 0: 3622
1: 6134
2: 5512
3: 5661
4: 8166
1027468816_1027468822 27 Left 1027468816 7:78548383-78548405 CCTCCATGTATTTTAAGATTGCT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1027468822 7:78548433-78548455 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
1027468816_1027468820 0 Left 1027468816 7:78548383-78548405 CCTCCATGTATTTTAAGATTGCT 0: 1
1: 0
2: 1
3: 12
4: 218
Right 1027468820 7:78548406-78548428 TTCATGTCGGCCAGGCACAGTGG 0: 2
1: 3
2: 63
3: 589
4: 3391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027468816 Original CRISPR AGCAATCTTAAAATACATGG AGG (reversed) Intronic
900318909 1:2072951-2072973 TCCAATCATAAAAAACATGGGGG - Intronic
901409907 1:9075565-9075587 AATAATCTTAAACTAAATGGTGG + Intronic
902459113 1:16558397-16558419 AGCAATCTTGAAATGCAAGAAGG - Intergenic
902493042 1:16849537-16849559 AGCAATCTTGAAATGCAAGAAGG + Intronic
903152307 1:21419091-21419113 AGCAATCTTGAAATGCAAGAAGG - Intergenic
906091337 1:43181940-43181962 ATAAATTTTAAAATGCATGGAGG - Intronic
907232874 1:53016645-53016667 AGAAATTTGAAAATACAAGGAGG + Intronic
909171881 1:72306304-72306326 AGAAATCTTAAAATTCATATTGG - Intergenic
910919020 1:92323171-92323193 AACAATTTTAAAATAATTGGGGG + Intronic
911326385 1:96474120-96474142 AGCAATCTCACAGTACCTGGGGG - Intergenic
912913199 1:113784158-113784180 AACAGTCTTCAAATACTTGGAGG + Intronic
913205358 1:116533522-116533544 ACCAATCTTGAAATACCTGCAGG - Intronic
914374186 1:147058837-147058859 AGCAATCTTGAAACGCAAGGAGG + Intergenic
915675996 1:157531667-157531689 AGCAATATAAAAAGACCTGGAGG + Intronic
915685876 1:157633471-157633493 AGCAATATGAAAAGACCTGGAGG + Intergenic
916151349 1:161794779-161794801 AACAGTCTTAAAGGACATGGAGG - Intronic
916698261 1:167263217-167263239 AGCTATTTTAAAAAACATGTCGG + Intronic
918699134 1:187585101-187585123 AGCAATATTAAAATACTTTAAGG + Intergenic
919061419 1:192638580-192638602 AGAAATCTTAGAATACAGGCGGG + Intronic
919143400 1:193602187-193602209 AGCAAACTTAAAGTAAATGGAGG - Intergenic
920457953 1:206115694-206115716 AACAATTTTAAAATACTAGGTGG - Intronic
921690569 1:218144336-218144358 AACAATCCTAAAATACATATGGG + Intergenic
922319950 1:224478362-224478384 AGCTATTTGAAAATACACGGAGG - Intronic
923331381 1:232928001-232928023 AGGAAACTTGAGATACATGGAGG + Intergenic
924880346 1:248154730-248154752 AGAAATTTTAAAATACATACTGG - Intergenic
1063023275 10:2151493-2151515 AGCAATTTCAAAATGTATGGTGG + Intergenic
1064786073 10:18896634-18896656 AGTAATATGAAAATAAATGGAGG - Intergenic
1067265711 10:44742538-44742560 AGCTAACTTTAAATACAAGGAGG + Intergenic
1067356514 10:45533573-45533595 AATATTCTTAAAATAAATGGTGG - Intronic
1068817838 10:61337503-61337525 AGCTATCTTCAAATACCTGAAGG - Intergenic
1069104809 10:64370603-64370625 TGCAATCTTTAAAAACAAGGAGG - Intergenic
1069414111 10:68183152-68183174 AGAAATATTATTATACATGGTGG - Intronic
1071174311 10:82906331-82906353 AGCAATGTTAAAATACCTTGTGG + Intronic
1075415744 10:122261877-122261899 AGGAATCTTAAAATTCATATGGG - Intergenic
1079768053 11:24419212-24419234 AGCAATCTCAAAGAATATGGGGG + Intergenic
1081370443 11:42294070-42294092 ACCAAGCCTAAAAGACATGGAGG - Intergenic
1086097357 11:83063889-83063911 AGCAATATGCAAATACATGGGGG + Intronic
1087304231 11:96470265-96470287 TGCAATGTTAAAATACATTTAGG + Intronic
1091021150 11:132101194-132101216 ATCAATATTAAAATAAAGGGTGG - Intronic
1094165682 12:27440565-27440587 GGCAATATTAAAATAAATTGAGG + Intergenic
1096315087 12:50557444-50557466 AACAATCTAAGAAGACATGGAGG - Intronic
1096851935 12:54445341-54445363 AGCAATCATAAAATACAGTGGGG + Intergenic
1097648412 12:62263847-62263869 AACAATTTTCAGATACATGGTGG + Intronic
1098283243 12:68882902-68882924 AGTAAAATAAAAATACATGGGGG + Intronic
1098563014 12:71899507-71899529 AGCATTCTCAAAATACATTTGGG - Intronic
1098718541 12:73864129-73864151 ACCACTCTGAAAATAAATGGAGG - Intergenic
1098813579 12:75127713-75127735 AGCCATATAAAAATACATAGTGG + Intronic
1099339093 12:81404424-81404446 AGCAATATCAAATTACATGTTGG + Intronic
1099593625 12:84628025-84628047 AGCAATCTTGATATACCTAGGGG + Intergenic
1101058967 12:100950890-100950912 AGCAAACATGAAATTCATGGGGG + Intronic
1101281248 12:103258984-103259006 AGCAATTTTTAAAAACAAGGTGG + Intronic
1102686301 12:114727420-114727442 AGCAGACTTGAAAAACATGGAGG - Intergenic
1105281862 13:18968950-18968972 AGAAATCTTCAATTACATGAGGG + Intergenic
1105882785 13:24618259-24618281 AGCAATCATCAAAACCATGGTGG - Intergenic
1106960499 13:34991820-34991842 AGCACTTTTAAAAAACATGCTGG + Intronic
1108151422 13:47539735-47539757 ATCAACCTGAAAAGACATGGAGG + Intergenic
1108557471 13:51608842-51608864 AGAAATGGTAAAATACATTGTGG - Intronic
1109715919 13:66221941-66221963 AGGAATCTTAAAATCCATTAAGG - Intergenic
1112653131 13:101419752-101419774 AGAAATTTGAAAATCCATGGAGG + Intergenic
1117840255 14:59853438-59853460 AGCTGTCTAAAAATACATGAAGG - Intronic
1120011487 14:79420650-79420672 AGCAAGCAAAAAACACATGGTGG + Intronic
1120277762 14:82398852-82398874 AGCATTTTTAAAATGCATGTAGG + Intergenic
1120773052 14:88402291-88402313 AACAATCGTAAAATTCATGTGGG + Intronic
1121357529 14:93228415-93228437 AGGAGTATTAATATACATGGTGG - Exonic
1124149574 15:27165488-27165510 AGCAATCTTCAAATATTTGAAGG - Intronic
1126463067 15:48934432-48934454 AGCAAACTGAAAATAAATGTTGG + Intronic
1126467522 15:48974374-48974396 AATAATCTTAAAATACATGGGGG + Intergenic
1130989334 15:88866506-88866528 AGCAAACCCAAAATGCATGGAGG - Intronic
1137611105 16:49818226-49818248 AGCCATATAAAAATACCTGGAGG + Intronic
1140253127 16:73312253-73312275 AGCTATCTTTAAATATTTGGAGG + Intergenic
1142909347 17:3073844-3073866 AGCAATCCTAAAACACACGCTGG + Intergenic
1142925213 17:3230394-3230416 AGCAATCCTAAAACACACGCTGG - Intergenic
1153792354 18:8590246-8590268 GGAGATCTTAAAATACTTGGAGG + Intergenic
1156554675 18:38053769-38053791 AACAATCTTAAATTTCATGAAGG + Intergenic
1158024838 18:52884404-52884426 GGCTATTTGAAAATACATGGAGG - Intronic
1158092642 18:53732927-53732949 ATCAATCTTTGAATCCATGGAGG - Intergenic
1158326430 18:56318462-56318484 AGCAGTCTTAAAATATCTGAGGG - Intergenic
1159275708 18:66219127-66219149 AGTAATCTAATAATCCATGGAGG + Intergenic
1159425722 18:68283402-68283424 AGCACTCTTAAAATACGTCTAGG - Intergenic
1160627364 18:80220111-80220133 AGGAAACTTACAATTCATGGTGG + Intronic
1164404178 19:27927925-27927947 AAAAGTGTTAAAATACATGGAGG + Intergenic
1165647721 19:37457273-37457295 ACCAATTTTAAAATAAATTGAGG + Intronic
1165720206 19:38073668-38073690 AGCAATCTTAGAAAACAGGGAGG + Intronic
1202675360 1_KI270711v1_random:579-601 AGCAATCTTGAAATGCAAGAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927330776 2:21860894-21860916 ATCAATCATAAAATGAATGGAGG - Intergenic
929363583 2:41124362-41124384 ATCAATGTGAAAATTCATGGGGG - Intergenic
930525140 2:52519437-52519459 AGGAAACTTAAAATTCATAGAGG - Intergenic
930936663 2:56961009-56961031 AACAAACTTAAAATACATTAAGG - Intergenic
931163465 2:59719466-59719488 TCCTTTCTTAAAATACATGGTGG + Intergenic
931548730 2:63418592-63418614 AAGAGTCTTAAAATACATGTTGG + Intronic
933386794 2:81621175-81621197 AACATTCTTAAAATACAAGATGG + Intergenic
935252315 2:101274628-101274650 AGCAATGTGGAAAAACATGGTGG + Intronic
937775654 2:125772604-125772626 AGCAATGTGAAAATATTTGGTGG + Intergenic
939822925 2:146979529-146979551 AGCAATTTTAGAACACATTGAGG + Intergenic
940504988 2:154542028-154542050 ACAAATCTTAAAAGACATGAGGG + Intergenic
941126738 2:161593090-161593112 ATCAAAATTATAATACATGGAGG - Intronic
942114604 2:172715471-172715493 AGTAAACTTGAAATACATAGTGG - Intergenic
942706677 2:178781390-178781412 AGCAATCTTATAATCTATTGTGG - Intronic
942782398 2:179660210-179660232 AGCAGACTTAAGATACAAGGAGG - Intronic
942784164 2:179681603-179681625 TGCAATTTTAAAATACCTGGGGG - Intronic
943112882 2:183627855-183627877 TGCAATCTTCAAATACAAGCAGG - Intergenic
943732189 2:191313817-191313839 AGCAATCTTAAAAGCCATGTGGG - Intronic
944982265 2:205134790-205134812 AGCATTATTAAAACAGATGGAGG + Intronic
945960650 2:216131193-216131215 AGCAAACTAAAAATACAGGATGG + Intronic
946514191 2:220393642-220393664 TCCAATCTTAAAATACAATGGGG + Intergenic
947335152 2:229074444-229074466 AGCAACATCAAAATACATAGGGG + Intronic
1169448776 20:5693758-5693780 TGCAATCTGGAAATACCTGGGGG - Intergenic
1169715676 20:8614863-8614885 AGCAACCATTAAAAACATGGTGG - Intronic
1172402710 20:34663599-34663621 ATCAATTTTATAATTCATGGTGG + Intronic
1174997159 20:55583130-55583152 AGCAATATTTAAATGAATGGAGG - Intergenic
1175110796 20:56646527-56646549 AGCAGCCTAAAAATACATGAAGG - Intergenic
1175778116 20:61665715-61665737 AGCTGTCTTACAATACACGGGGG + Intronic
1175929320 20:62486150-62486172 TCCAATTTTAAAAAACATGGTGG - Intergenic
1177593493 21:23204728-23204750 AGCTCTAATAAAATACATGGTGG - Intergenic
1178596377 21:33957165-33957187 AAAAAACATAAAATACATGGGGG + Intergenic
1179458738 21:41518777-41518799 AACATTCTGAAAATAGATGGCGG + Intronic
1180202294 21:46231626-46231648 AGCTATCTAAAGAGACATGGGGG + Intergenic
1184634581 22:45816846-45816868 AGGAATCTTAGAATAAATGTAGG + Intronic
950799496 3:15538631-15538653 AGCAATGTCAAAGTACAAGGAGG - Intergenic
952084727 3:29804471-29804493 ATCCATCTTAAAATACATAAAGG - Intronic
954350818 3:50042425-50042447 AGGATTCTTAAAATACTGGGAGG - Intronic
955810471 3:62782643-62782665 AGAAATATTAGATTACATGGGGG + Intronic
956725451 3:72152941-72152963 TGCAATCGTAAAATGCATCGTGG - Intergenic
957575994 3:82009111-82009133 TGCGTTCTTAAAATAAATGGGGG + Intergenic
957963206 3:87287712-87287734 AGCAATATTCAAATATATGATGG + Intergenic
959536214 3:107488302-107488324 AACAATTTTAAAATAATTGGAGG - Intergenic
959937756 3:112047378-112047400 AGCAATCAGGAAATACGTGGAGG - Intronic
961761616 3:129173629-129173651 AACAATCTAAAAATAAATTGAGG + Intronic
963363828 3:144309400-144309422 AGCAATCTGAAAATATAAAGTGG - Intergenic
964632434 3:158826230-158826252 AGCAATCTTAATAAATATGAAGG - Intronic
966081318 3:176005277-176005299 AGCAATAATAAATTATATGGTGG + Intergenic
966465296 3:180225109-180225131 AGCAAACCTGAAATACAAGGGGG - Intergenic
967750765 3:193113773-193113795 AGGACTCTTAAAATACTTTGAGG + Intergenic
968788626 4:2643501-2643523 AAAAATTTTAAAGTACATGGTGG - Intronic
968956139 4:3720706-3720728 AGCAATGTTTAAATAGGTGGAGG + Intergenic
968989271 4:3898028-3898050 AGTGTTCTTAAAATACAAGGAGG + Intergenic
969132601 4:5002781-5002803 AACAATCTTTGAAAACATGGAGG + Intergenic
970743136 4:19261748-19261770 AGTATTTTTGAAATACATGGAGG - Intergenic
971465106 4:26949373-26949395 AACTATGTTAAAATACATAGAGG - Intronic
971794188 4:31205008-31205030 AGCAATCTTAAACTACCTTGGGG - Intergenic
972113582 4:35597920-35597942 AGTAATCTAAAAATACCTGTAGG + Intergenic
972987685 4:44784626-44784648 AGCCATCTTATAATACATTGGGG - Intergenic
973957774 4:56080038-56080060 AACAATGTTAAAAGAAATGGCGG + Intergenic
974290189 4:59920073-59920095 AATAAGCTTCAAATACATGGTGG + Intergenic
974857774 4:67481398-67481420 AGCAATCCTAAAATTCATTATGG + Intronic
977220640 4:94333616-94333638 AGGAATCTTAAAGTTCATGATGG - Intronic
977690135 4:99896944-99896966 AGCCATCTGGAAATACATAGGGG - Exonic
978658151 4:111091272-111091294 AAGAATATTAAAATACATGAGGG + Intergenic
979320583 4:119319284-119319306 AGCCATTTTAAAACACATGTTGG + Intronic
980079137 4:128325177-128325199 AAGAAACATAAAATACATGGAGG - Intergenic
980418255 4:132521722-132521744 AGAAATCTGATAATACATGTGGG - Intergenic
981136523 4:141216863-141216885 AGAAATCTTAAAATAGAGGCAGG - Intergenic
982628619 4:157802197-157802219 AACAATCTTAAAATTCATATGGG - Intergenic
984360982 4:178731598-178731620 AGCAATTTTAAAACAGTTGGTGG - Intergenic
985396117 4:189546058-189546080 AACAATCTTAAAGAACAAGGAGG + Intergenic
986659909 5:10050169-10050191 AGCAATTCTAAAGCACATGGAGG - Intergenic
987467712 5:18292199-18292221 AGCAATGTAAAAATGTATGGTGG - Intergenic
987549767 5:19363896-19363918 AGAAATTTTAAAATATATGTAGG + Intergenic
989782684 5:45288257-45288279 AGCAATTTAAAAAGAAATGGAGG - Intronic
990854767 5:60252241-60252263 TGTAAGCTAAAAATACATGGGGG + Intronic
991099855 5:62780584-62780606 AGCAAATTAAAAAGACATGGAGG + Intergenic
991982882 5:72251569-72251591 AGCACTCTTATAATACAATGGGG + Intronic
993026006 5:82647409-82647431 AGCTTTCTTAAAATAAATGAAGG + Intergenic
994285984 5:97968094-97968116 AAAAATCTTAAAATTCATTGTGG + Intergenic
995652613 5:114386974-114386996 AGCAATCTTGAAATACTTCCTGG + Intronic
995992365 5:118256439-118256461 AGAAATCTTACAATGTATGGGGG + Intergenic
996211830 5:120819667-120819689 AGCAAACATAAAATACACGTTGG - Intergenic
996594333 5:125184288-125184310 AACAAACTTAAAAAAAATGGTGG + Intergenic
999077148 5:148807130-148807152 AACAATCTTAAAAGAGCTGGTGG + Intergenic
999713873 5:154343443-154343465 AGCACTCTATAAATACAAGGAGG + Intronic
1000045266 5:157517086-157517108 AGCTGTCTTAAAAGACAAGGAGG - Intronic
1000517298 5:162254189-162254211 AGCAATGTCAAAAGACATGGAGG - Intergenic
1004139102 6:12999297-12999319 AATAATCTTAAAATACGTTGAGG + Intronic
1005143171 6:22657621-22657643 AGCCATCTAAAAATACAGAGAGG - Intergenic
1006855769 6:37132268-37132290 AGCAATGGAAAAATACATGGTGG + Intergenic
1007855753 6:44854845-44854867 AGCTATCTTCAAATACCTGAAGG + Intronic
1007879321 6:45145162-45145184 AACAATCCTAAAATTCATAGGGG + Intronic
1008879699 6:56368838-56368860 AGCAGTCTTCAAATATATGCTGG + Intronic
1009771078 6:68143804-68143826 GGCTATTTTAAAATACATAGAGG - Intergenic
1011511462 6:88105592-88105614 AGGAATACTGAAATACATGGTGG + Intergenic
1013572498 6:111443408-111443430 AGTAATTTTTAAATAGATGGTGG + Intronic
1013799721 6:113928904-113928926 AGCATTTTTAATATACATGTTGG + Intergenic
1014027189 6:116662521-116662543 AACAATCTTTAAATACCTGAAGG + Intronic
1014488392 6:122030294-122030316 AGAAATATAAAAATACATGTGGG + Intergenic
1014743727 6:125175215-125175237 AGCACTCTATAAATACATGCGGG + Intronic
1014869325 6:126572292-126572314 AGCAATATCAAAAGAGATGGAGG - Intergenic
1015079633 6:129208105-129208127 AGCATTCTTAAAATAGGGGGTGG + Intronic
1015411825 6:132902527-132902549 AAAAATCTTAAAATACAGGCCGG - Intergenic
1018268615 6:162052104-162052126 AGAGAACTTAAAAAACATGGAGG - Intronic
1018649666 6:165982425-165982447 AACCATCTTGAAAGACATGGAGG + Intronic
1020545744 7:9527853-9527875 AACAATCTTAAAATAGAAAGAGG + Intergenic
1021214414 7:17899322-17899344 ATCAATATTAAAATACAAGAAGG - Intronic
1021811859 7:24409998-24410020 AGCAACAATAAAATACATGATGG + Intergenic
1023592302 7:41793220-41793242 AACAATCTTAAAACAAATGAGGG - Intergenic
1024837741 7:53543602-53543624 AGTAATTTTAAAATACGTGCTGG + Intergenic
1025715065 7:63948115-63948137 AACTATTTTAAAATACATGTGGG + Intergenic
1027468816 7:78548383-78548405 AGCAATCTTAAAATACATGGAGG - Intronic
1027523448 7:79237775-79237797 AGGAATATTTAAATACATTGTGG - Intronic
1028364209 7:90008326-90008348 AACAATCTATAAATACATGAAGG + Intergenic
1031858026 7:126945223-126945245 AGCAATTAATAAATACATGGTGG + Intronic
1032381619 7:131489684-131489706 AGCACTGTAAAAATAAATGGTGG - Exonic
1033022446 7:137739960-137739982 ACCAACCTTCAAAGACATGGTGG - Intronic
1033768563 7:144522764-144522786 AGCAATCTAAAAATACAATAGGG - Intronic
1033945876 7:146716917-146716939 AGGAAAATTAAAATAAATGGGGG + Intronic
1034237232 7:149581557-149581579 ACAAATCTTAAAATTCATAGAGG + Intergenic
1034240250 7:149604972-149604994 ACAAATCTTAAAATTCATGGAGG + Intergenic
1036657313 8:10685194-10685216 AACAAACTTAAAAGACATAGTGG + Intronic
1041567014 8:59290148-59290170 AGCAAAAGTAAAATACATGAAGG - Intergenic
1042300879 8:67279396-67279418 AGGAATGTTAAAATACTTAGTGG - Intronic
1042679434 8:71365839-71365861 ATCATTCTTAAAATAAATAGAGG - Intergenic
1043212175 8:77535395-77535417 AAGAATCTTAAAATGCAAGGTGG + Intergenic
1045566745 8:103324663-103324685 ATCACTTTTAAAATACATGTTGG - Exonic
1045989519 8:108289062-108289084 AACAACCTTAAATTACAGGGAGG - Intronic
1046204692 8:110977878-110977900 AGCATAATTAAAATACATTGTGG - Intergenic
1048615815 8:136074546-136074568 GACAATCTTATAATGCATGGAGG + Intergenic
1050453698 9:5811165-5811187 CTCAATCATAAACTACATGGTGG - Exonic
1052127762 9:24799201-24799223 AGTAATTTTAAAATGGATGGTGG - Intergenic
1052534935 9:29734181-29734203 AGACATATTAAAAGACATGGAGG + Intergenic
1055763941 9:79640881-79640903 CTCAAGCTTAAAATACTTGGTGG + Intronic
1058505972 9:105666444-105666466 TTCAATCCTAAAATACTTGGTGG - Intergenic
1186714989 X:12242082-12242104 AACAACCTTAAAGTATATGGAGG - Intronic
1188073668 X:25748878-25748900 TGCAATATTAAGATACAGGGAGG + Intergenic
1188168045 X:26886752-26886774 AAAAAACTTAAAATATATGGGGG + Intergenic
1190034472 X:47008635-47008657 AGCAATCTTAATAAACAATGGGG - Intronic
1191698055 X:64009511-64009533 AGCAATCTCTAATTAAATGGTGG + Intergenic
1193463329 X:81816639-81816661 ATCAATATTAAAATACAAGAAGG - Intergenic
1193683592 X:84551678-84551700 GGCAATCTGAAAATACACAGAGG - Intergenic
1193696471 X:84712794-84712816 AGCCATCTTAAAGTACTAGGAGG + Intergenic
1198155637 X:133957723-133957745 AGCACTCTTTAAATATATGAGGG + Intronic
1198664943 X:139010039-139010061 AGCAATCTTAAAAGATAAAGAGG + Intronic
1202032347 Y:20590756-20590778 AACAATCTTAATAAACATGTTGG - Intronic