ID: 1027484430

View in Genome Browser
Species Human (GRCh38)
Location 7:78742834-78742856
Sequence CTGGTAAGGGACCCTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027484424_1027484430 17 Left 1027484424 7:78742794-78742816 CCAAAATAAGGCTAGAAAAATCG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1027484430 7:78742834-78742856 CTGGTAAGGGACCCTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027484430 Original CRISPR CTGGTAAGGGACCCTGACCC AGG Intronic
No off target data available for this crispr