ID: 1027489763

View in Genome Browser
Species Human (GRCh38)
Location 7:78808549-78808571
Sequence ATGAAAATACAGCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 814}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027489763_1027489768 5 Left 1027489763 7:78808549-78808571 CCCAGCCTCAGCTGTATTTTCAT 0: 1
1: 0
2: 2
3: 71
4: 814
Right 1027489768 7:78808577-78808599 AGAATAATTAAAAATAATGACGG 0: 1
1: 1
2: 14
3: 138
4: 1682
1027489763_1027489769 26 Left 1027489763 7:78808549-78808571 CCCAGCCTCAGCTGTATTTTCAT 0: 1
1: 0
2: 2
3: 71
4: 814
Right 1027489769 7:78808598-78808620 GGAAAGATAAGCAAAAACAAAGG 0: 1
1: 1
2: 7
3: 114
4: 1404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027489763 Original CRISPR ATGAAAATACAGCTGAGGCT GGG (reversed) Intronic
900664558 1:3806026-3806048 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
901140098 1:7023167-7023189 ATCTATATACAGCTTAGGCTTGG - Intronic
901552404 1:10005356-10005378 AAATAAAAACAGCTGAGGCTGGG - Intronic
901760829 1:11470138-11470160 ATAATAATACAGCTGAGGCCAGG + Intergenic
902049202 1:13548598-13548620 ATGAAAATACAGGCCAGGCGCGG + Intergenic
902159874 1:14521164-14521186 ATGCAAATAAAGATCAGGCTTGG + Intergenic
902234799 1:15050535-15050557 TTAAAAATAAACCTGAGGCTTGG - Intronic
902720190 1:18298865-18298887 AAGAAGATATAGCTGAGCCTTGG - Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903186343 1:21631388-21631410 TTAAAAATCCAGATGAGGCTGGG + Intronic
903211180 1:21819775-21819797 ATAAAAAAACACCTGAGACTGGG + Intronic
903458887 1:23507220-23507242 AAGAAAATACCACTCAGGCTGGG + Exonic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904381106 1:30111807-30111829 ATGAAAATAAAACTGCGACTGGG + Intergenic
904510788 1:31005488-31005510 AAAAAAATAAAGCTGATGCTGGG - Intronic
905129261 1:35740712-35740734 AAGAAAATACAGTATAGGCTGGG - Intronic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905411113 1:37768692-37768714 AAGAAAATACAGTTTAGGCCAGG - Intergenic
905765999 1:40601559-40601581 ATAAAGAAACACCTGAGGCTGGG - Intergenic
905788376 1:40776028-40776050 AAGAAAATACATCTAAAGCTTGG + Intergenic
906101260 1:43264658-43264680 ATGAAAAAACTGGTTAGGCTGGG - Intronic
906183249 1:43839659-43839681 ATGAAAAAACATCTGAGACTGGG + Intronic
906219761 1:44069315-44069337 ATGAAGAAATACCTGAGGCTGGG + Intergenic
906785905 1:48615779-48615801 ATGATAAAATACCTGAGGCTGGG + Intronic
908521800 1:64951268-64951290 ATGAAAATACTGCTTATGCTAGG - Intronic
908649348 1:66314706-66314728 ATGAAAACACAGTGGAGGTTGGG - Intronic
908894626 1:68884409-68884431 ATAAAAATATACCTGAGACTGGG - Intergenic
909357611 1:74727232-74727254 ATGAAGAAACACCTGAGACTGGG + Intronic
909518209 1:76536295-76536317 ATGAAGAAATACCTGAGGCTGGG + Intronic
909864819 1:80654247-80654269 ATAAAGATATATCTGAGGCTGGG + Intergenic
909934010 1:81530205-81530227 ATGAAGATAAAGCTGAAGCCTGG - Intronic
910795906 1:91097182-91097204 AAGAAAATATAGCAGAGGCCAGG - Intergenic
910951920 1:92657713-92657735 ATGAAGAAATACCTGAGGCTGGG + Intronic
911453958 1:98099797-98099819 AGGTAAATACAGTTCAGGCTGGG + Intergenic
911727483 1:101257591-101257613 AACAAAAAAAAGCTGAGGCTAGG + Intergenic
911762064 1:101627702-101627724 ATGAATAAACACCTGAGACTGGG - Intergenic
911824920 1:102470698-102470720 ATGAAGAAACACCTGAGACTAGG + Intergenic
912006297 1:104904935-104904957 ATGAAAACATACCTGAGACTGGG + Intergenic
912109897 1:106328969-106328991 ATGAAGAAACACCTGAGACTGGG + Intergenic
912197421 1:107414884-107414906 ATGTAAATAGAGCTCAGGCTGGG - Intronic
912327656 1:108784260-108784282 ATGAATAAATAGCTGAGACTGGG + Intronic
912973019 1:114301784-114301806 ATGAAGAAATACCTGAGGCTGGG - Intergenic
913546450 1:119873403-119873425 ATGAAAATAGTCCTGAGGGTTGG + Intergenic
915414083 1:155726585-155726607 AGGAAAGTAAAGCTGAGGCCGGG - Intronic
915712437 1:157913640-157913662 ATGAAAATGCAGCTGAGGTAAGG - Intergenic
915719312 1:157972610-157972632 ATGAAGAAATACCTGAGGCTGGG + Intergenic
916015039 1:160742273-160742295 ATGCAAAGACATCTGAGTCTTGG + Intronic
916679420 1:167090431-167090453 CTGCCAATCCAGCTGAGGCTGGG - Exonic
917113235 1:171574406-171574428 AAGAAAATACAGCTGAAACCAGG + Intronic
917276953 1:173341184-173341206 ATGAAAAAATACCTGAGACTGGG - Intergenic
918387475 1:184024644-184024666 AAAAAAAAAAAGCTGAGGCTGGG - Intronic
918670391 1:187207855-187207877 ATGAAGAAATAGCTGAGACTGGG + Intergenic
918831680 1:189406237-189406259 ATGAAAATGTACCTGAGACTGGG + Intergenic
919107023 1:193166434-193166456 ATGAAAACACACTTAAGGCTGGG - Intronic
919616564 1:199815381-199815403 ATAAAAAGATAGCTGAGACTGGG - Intergenic
919938662 1:202271509-202271531 CAGAAAATACAGGGGAGGCTGGG + Intronic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
920859676 1:209695244-209695266 ATGAAGATATACCTGAGACTGGG - Intronic
920962386 1:210674908-210674930 TTCAAAAGACAGCTGTGGCTTGG - Exonic
921145143 1:212347839-212347861 ATAAGAATTCAGCTGAGGCTGGG - Intronic
921363356 1:214351066-214351088 ATGAAAAGGCAGCAGAGGCTGGG + Exonic
921619513 1:217310542-217310564 GGGAAAATCCAGGTGAGGCTGGG + Intergenic
921775572 1:219096340-219096362 ATGAAGATATATCTGAGACTGGG - Intergenic
921775821 1:219098095-219098117 ATGAAGAAACACCTGAGACTGGG - Intergenic
922322945 1:224503725-224503747 TTGAAAACACAGCTGTGGCAAGG + Intronic
922535607 1:226378550-226378572 AAGAAAAGCCAGCTGGGGCTGGG + Intronic
923067583 1:230532977-230532999 ATAAAGAAACACCTGAGGCTGGG - Intergenic
923523788 1:234757090-234757112 AGGAAAATCCAGGTGAGTCTGGG + Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
923686650 1:236158126-236158148 ATTAAACCACAGCTGGGGCTGGG + Intronic
923979282 1:239302630-239302652 ATGAAGAAATATCTGAGGCTAGG - Intergenic
923980595 1:239317956-239317978 ATAAAAATAAAATTGAGGCTTGG - Intergenic
924110069 1:240690316-240690338 TTGAAAATACATTTGAGGCAGGG + Intergenic
924159841 1:241219452-241219474 ATAAAGACACACCTGAGGCTGGG - Intronic
924315377 1:242789990-242790012 ATGAAGAAATACCTGAGGCTGGG + Intergenic
924352809 1:243134788-243134810 GTGAAAAAATAGCTGAGTCTGGG - Intronic
924473813 1:244366457-244366479 ATTAAAATAAACATGAGGCTGGG - Intronic
924901982 1:248410955-248410977 ATGAAAATATAGAAGTGGCTTGG + Intergenic
1063896414 10:10686777-10686799 ATGAAGACACATCTGAGACTGGG - Intergenic
1064300124 10:14115849-14115871 ATGAAGAGATACCTGAGGCTGGG - Intronic
1064418994 10:15174002-15174024 AAAAAAAAACAGCTAAGGCTGGG - Intergenic
1064461608 10:15540098-15540120 ATGAAAACATACCTGAGACTGGG - Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065209047 10:23385089-23385111 ATAAATAGCCAGCTGAGGCTGGG - Intergenic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1065915571 10:30351924-30351946 ATAAAAAAATACCTGAGGCTGGG - Intronic
1066098916 10:32099498-32099520 ATGAAAAAATACCTGAGACTGGG + Intergenic
1066133435 10:32417417-32417439 GAGAAAATAAAGCTGAGGGTAGG - Intergenic
1066746507 10:38606835-38606857 ATAAAAAGAAACCTGAGGCTGGG - Intergenic
1068229074 10:54147306-54147328 ATGAAAATAAATGTGAAGCTAGG + Intronic
1068288210 10:54966862-54966884 ATAAAGATATACCTGAGGCTGGG - Intronic
1068653867 10:59554445-59554467 ATGAAGATATACCTGAGACTGGG - Intergenic
1069554421 10:69388134-69388156 TTGAAAATATAGCTGCGGGTTGG + Intronic
1069740476 10:70683963-70683985 ATAAAAAAATAACTGAGGCTGGG + Intronic
1070393114 10:75988520-75988542 ATGAAAAGAGAGCTGGGGGTGGG - Intronic
1070897623 10:79998398-79998420 TGGAAAATATAGATGAGGCTGGG - Intergenic
1071222303 10:83483363-83483385 ATGAAGAAATATCTGAGGCTGGG + Intergenic
1071365189 10:84892228-84892250 ATAAAGAGATAGCTGAGGCTGGG + Intergenic
1071396368 10:85227864-85227886 ATGGAAATACAGCTGAGAAATGG + Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1071973833 10:90935089-90935111 ATAAAAATATACCTGAGACTGGG - Intergenic
1072086523 10:92084872-92084894 GTTAAAATACAGATGAGGCCGGG - Intronic
1072276876 10:93832533-93832555 ATGAAGAGACATCTGAGACTGGG + Intergenic
1072369176 10:94746037-94746059 ATGAAGAAACATCTGAGGCTGGG - Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072926889 10:99623595-99623617 ATCAAAATACTGCTGAAGCTAGG - Intergenic
1072994580 10:100231551-100231573 ATGAAAAAAAAACTGAGACTCGG - Intergenic
1073672283 10:105605737-105605759 ATAAAAATAGAGCTGAAGCTAGG - Intergenic
1074237723 10:111602797-111602819 ATGAAAACATACCCGAGGCTGGG - Intergenic
1074304570 10:112264813-112264835 ATGAAAAAAAAACAGAGGCTGGG + Intergenic
1074378460 10:112958318-112958340 ATGAAAATAAATTTGAGGCCTGG + Intronic
1075452234 10:122559327-122559349 ATGATAATGCAGCTGGGTCTGGG - Intergenic
1075546705 10:123360500-123360522 TTGGTAATACTGCTGAGGCTGGG + Intergenic
1076419687 10:130322139-130322161 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1076912356 10:133397433-133397455 AAGAAAAGACAGCTGTGCCTGGG - Intronic
1077265055 11:1644553-1644575 AAGAAAAGACAGCTGAGCCCGGG - Intergenic
1077513874 11:2989142-2989164 ACAAAAATTCAGCTGAGGCCAGG + Intronic
1077706594 11:4492829-4492851 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1077736946 11:4801298-4801320 ATAAAAAAATATCTGAGGCTGGG + Intronic
1077827636 11:5827577-5827599 ATAAAAATATACCTGAGACTGGG - Intronic
1077946225 11:6903136-6903158 ATAAAAGAACACCTGAGGCTGGG + Intergenic
1078087971 11:8245783-8245805 ATAAAGACATAGCTGAGGCTGGG + Intronic
1078183654 11:9032920-9032942 TGGGAAATAAAGCTGAGGCTGGG + Intronic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1079017800 11:16884335-16884357 ATAAAATTTCAGCTTAGGCTGGG + Intronic
1079283294 11:19107095-19107117 ATGAAAAGAAAGCTGAGGGTGGG - Intergenic
1079563057 11:21847089-21847111 ATTAAAATACAGGTTAAGCTTGG - Intergenic
1079574804 11:21990228-21990250 ATGACAAAATACCTGAGGCTGGG + Intergenic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1080593982 11:33751956-33751978 AAGAAAATACAGCTATGACTAGG + Intronic
1080819761 11:35794161-35794183 ATGAAATGTCAGCTGAGGCATGG - Intronic
1080958416 11:37129516-37129538 ATGAAGACATAGCTGAGACTGGG - Intergenic
1081393702 11:42560112-42560134 ATGAAGACATATCTGAGGCTGGG - Intergenic
1081442270 11:43093461-43093483 ATAAAAACATAGCTGAGACTGGG - Intergenic
1081687715 11:45054276-45054298 ATGCAAATACAGCTTATGCATGG + Intergenic
1081739503 11:45428282-45428304 TGGAAAACAGAGCTGAGGCTTGG + Intergenic
1082191160 11:49246928-49246950 ATGACAATGTATCTGAGGCTGGG + Intergenic
1082689102 11:56277999-56278021 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1083153583 11:60809147-60809169 ATGCCAGTACTGCTGAGGCTGGG + Intergenic
1083503033 11:63128865-63128887 AAGAAAAGACAGCTGTGCCTGGG - Intronic
1084202852 11:67573392-67573414 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084496219 11:69505170-69505192 ATAAAGAAACACCTGAGGCTGGG + Intergenic
1084551543 11:69846139-69846161 ATAAGAATACATGTGAGGCTGGG - Intergenic
1084727271 11:70949878-70949900 ATGCCAAAACACCTGAGGCTGGG + Intronic
1084728497 11:71058188-71058210 ATGAAAATGCATAAGAGGCTGGG - Intronic
1085315536 11:75542594-75542616 ATGAAAATGAGGCTCAGGCTGGG + Intergenic
1085615826 11:77997700-77997722 ATAAAAATAAAGTTGAGGCCAGG + Intergenic
1085986165 11:81791385-81791407 ATGAAGAAACACCTGAGACTGGG + Intergenic
1085986541 11:81794231-81794253 ATTAAGAAACATCTGAGGCTGGG - Intergenic
1086380616 11:86248721-86248743 ATGAAAAAAGAGTTGTGGCTGGG + Intronic
1086674959 11:89594110-89594132 ATGACAATGTATCTGAGGCTGGG - Intergenic
1087064349 11:94013018-94013040 ATGACACTTCAGCTAAGGCTAGG + Intergenic
1087239994 11:95763894-95763916 ATGAAACCAAGGCTGAGGCTTGG - Intergenic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1088050145 11:105503374-105503396 ATGAAAGAATAGCTGAGACTGGG + Intergenic
1088166433 11:106943908-106943930 ATAAAAAAACAGGTTAGGCTGGG + Intronic
1088256397 11:107907762-107907784 ATGAAAATACATGTAGGGCTGGG - Intronic
1088942219 11:114471073-114471095 ATGAAAATACAACCCAGGCTGGG - Intergenic
1089927024 11:122269309-122269331 ATGAAAAGAGAGCTGAGATTGGG - Intergenic
1090328127 11:125906529-125906551 ATCAAAATATAGCTCAGGCCAGG + Intronic
1090358131 11:126154309-126154331 TGGAAGATACAGCTGAGGCAGGG + Intergenic
1090477204 11:127034130-127034152 ATGAAAATACAGAGTAGGGTGGG - Intergenic
1091487762 12:906430-906452 AAGAAAATGCAGCTGAGGCAGGG - Intronic
1091552730 12:1549068-1549090 ATAAAGATACACCTGAGACTGGG - Intronic
1092071800 12:5637289-5637311 ATGAAAGTATTGATGAGGCTGGG + Intronic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1093502782 12:19831646-19831668 CTAAAAATGCAGCTGAGGCCTGG - Intergenic
1093504909 12:19853848-19853870 ATAAAAACACAGGTTAGGCTGGG - Intergenic
1094282582 12:28755899-28755921 ATGAAGAAACACCTGAGACTGGG + Intergenic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1094653102 12:32397014-32397036 ATTAGAATTCAGCAGAGGCTGGG - Intergenic
1095557192 12:43522066-43522088 ATGAAGAAATACCTGAGGCTGGG + Intronic
1095785592 12:46105630-46105652 TTGAAAAGAAACCTGAGGCTGGG - Intergenic
1096066170 12:48742565-48742587 ATAAAAATGAAGCTGAGGCCGGG - Intergenic
1096382255 12:51168777-51168799 ATAAAAATACAGTTGGGGATAGG - Intronic
1096433616 12:51569732-51569754 TTGTAAAGACCGCTGAGGCTAGG - Intergenic
1097323310 12:58248603-58248625 ATGAAGACACACCTGAGACTGGG + Intergenic
1097487810 12:60227973-60227995 ATAAAAACACATCTGAGACTAGG + Intergenic
1098004764 12:65984400-65984422 CTGAAACTATAGCTGAGACTTGG - Intergenic
1098146560 12:67503608-67503630 ATGAGAATATAGCAAAGGCTTGG - Intergenic
1098472833 12:70865277-70865299 ATAAAGATACACCTGAGACTGGG - Intronic
1098609374 12:72435617-72435639 ATGAAAATAGATCCCAGGCTGGG + Intronic
1098837600 12:75441144-75441166 ATAAAAACACACCTGAGACTGGG - Intergenic
1099519944 12:83648378-83648400 TTGAACATACAGTTGATGCTTGG - Intergenic
1099559604 12:84155267-84155289 ATGGAAAGGCAGCTAAGGCTCGG + Intergenic
1099861100 12:88227251-88227273 ATGAAGAAATACCTGAGGCTTGG + Intergenic
1100069523 12:90695260-90695282 ATGAAGAAATAGCTGAGACTGGG + Intergenic
1100367063 12:93931673-93931695 AGGAAAATACAACACAGGCTGGG - Intergenic
1101010695 12:100446240-100446262 TTGAAAATAAAGTTGAGGCTGGG + Intergenic
1101327868 12:103732507-103732529 AAGAAAATACAGGTCAGGATGGG + Intronic
1101559596 12:105843945-105843967 ATGAAATTAAAACTGAGGCTTGG - Intergenic
1101570544 12:105949385-105949407 ATAACAAAACACCTGAGGCTGGG - Intergenic
1102758925 12:115368078-115368100 ATGAAGACATACCTGAGGCTGGG - Intergenic
1103099955 12:118164712-118164734 TTTAAAGTACAGCTGAGGCTGGG - Intronic
1103580366 12:121910377-121910399 AAGAAAATACAGCATAGGCCGGG - Intronic
1103709979 12:122905273-122905295 TTAAAAATACAGCAGAGGCTGGG - Intergenic
1104032723 12:125076900-125076922 TTTAAAATAAAGTTGAGGCTGGG + Intronic
1104364258 12:128162748-128162770 ATAAAGATATACCTGAGGCTGGG - Intergenic
1105287177 13:19013920-19013942 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1106001463 13:25727428-25727450 ATGCAAATACAGCTCTGGCATGG - Intronic
1106330806 13:28737833-28737855 ATGAAAATAGAGGCTAGGCTAGG + Intergenic
1106360885 13:29029582-29029604 ATGAAAGAATACCTGAGGCTGGG + Intronic
1106732816 13:32559526-32559548 ATAGAAATACACTTGAGGCTGGG + Intergenic
1106972772 13:35163356-35163378 ATTAAAAAACAGTTCAGGCTAGG + Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107628536 13:42317171-42317193 ATAAAAATAAAAATGAGGCTGGG - Intronic
1107697559 13:43015085-43015107 AAGGAAATACAGCTGAGGAGTGG - Intergenic
1107744582 13:43490990-43491012 ATAAAGAAACATCTGAGGCTGGG + Intronic
1107834279 13:44401093-44401115 TTTAAAATACAGGTGAGGCCAGG + Intergenic
1108236094 13:48406993-48407015 ATGTAACTACACCTTAGGCTGGG - Intronic
1108288217 13:48929661-48929683 TTTAAAATAAAACTGAGGCTGGG - Intergenic
1108906651 13:55483473-55483495 ATGAAAAAACACATGAGACTGGG - Intergenic
1108927310 13:55769130-55769152 ATGAAGAAATATCTGAGGCTAGG - Intergenic
1109294294 13:60512047-60512069 ATGAAGATATACCTGAGACTAGG + Intronic
1109341147 13:61060575-61060597 ATGAAAATACAGGTCAGGCACGG - Intergenic
1109384159 13:61606526-61606548 ATAAAGAAATAGCTGAGGCTGGG + Intergenic
1109442410 13:62393201-62393223 ATGACAAAATAGCTGAGACTAGG + Intergenic
1109550095 13:63884412-63884434 AAGAAAACAGAGCTTAGGCTGGG + Intergenic
1109655623 13:65387185-65387207 ATAAAAATATACCTGAGACTAGG - Intergenic
1109677586 13:65699002-65699024 ATTAAAACTCACCTGAGGCTGGG - Intergenic
1109721228 13:66278337-66278359 ATAAAGATATACCTGAGGCTGGG - Intergenic
1110024933 13:70524918-70524940 ATGTAAATGCATGTGAGGCTGGG - Intergenic
1110263509 13:73512894-73512916 ATGAAGAAACACCTGAGACTGGG - Intergenic
1110338391 13:74359695-74359717 ATGAAAAAATACCTGAGACTGGG - Intergenic
1110339196 13:74369222-74369244 ACCAAAATACACATGAGGCTGGG + Intergenic
1111127748 13:83934328-83934350 ATGAAAATCCAAAAGAGGCTGGG + Intergenic
1111154706 13:84307736-84307758 ATAAAAATCCAATTGAGGCTGGG + Intergenic
1111198221 13:84900862-84900884 ATAAAAAGATACCTGAGGCTAGG + Intergenic
1111358679 13:87145446-87145468 ATGAAGAAATAGCTGAGACTGGG - Intergenic
1111609623 13:90586988-90587010 TTAAAAACACACCTGAGGCTAGG + Intergenic
1111634160 13:90881733-90881755 ATGAAGAAATAGCTGAGCCTGGG - Intergenic
1111656538 13:91161093-91161115 ATGAAGAAATACCTGAGGCTGGG - Intergenic
1111737934 13:92165383-92165405 ATGAAAAAATACCTGAGACTGGG + Intronic
1111750786 13:92329158-92329180 ATAAAGAAATAGCTGAGGCTGGG + Intronic
1111939180 13:94591288-94591310 ATTAAAATATATCTTAGGCTGGG + Intronic
1112697595 13:101968376-101968398 AAAAAAATACAGCTTAGGCTGGG + Intronic
1112893563 13:104269380-104269402 ATGAAAGAATACCTGAGGCTGGG - Intergenic
1113067694 13:106388673-106388695 AAGAGAATACATCTGTGGCTGGG - Intergenic
1113137729 13:107112570-107112592 AAAAAAATACAACAGAGGCTGGG - Intergenic
1113775453 13:112942498-112942520 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1113831885 13:113302156-113302178 AAGAAATTACATCTTAGGCTGGG - Intronic
1114344375 14:21780287-21780309 ATCAAGATACGGTTGAGGCTGGG + Intergenic
1114468994 14:22945914-22945936 ATAATAAAGCAGCTGAGGCTGGG - Intergenic
1114917258 14:27284527-27284549 ATAAAAAAACACCTGAGACTGGG - Intergenic
1115741629 14:36395129-36395151 GTGAAAATGCCACTGAGGCTGGG + Intergenic
1115887632 14:37991355-37991377 ATGAAAAAATACCTGAGACTGGG - Intronic
1116043489 14:39714724-39714746 ATCAAAATACAACTTAGGATGGG - Intergenic
1116188123 14:41625496-41625518 ATGAAGAAATAGCTGAGGCTTGG - Intronic
1116302065 14:43195496-43195518 ATTAAAAAATACCTGAGGCTGGG - Intergenic
1117013417 14:51493619-51493641 ATAAAGACACAGCTGAGACTGGG - Intronic
1117221423 14:53610384-53610406 AGGAAAACACAGATGAGGTTTGG + Intergenic
1118775353 14:68970450-68970472 ATCAAAATAAACCTGAGCCTCGG + Intronic
1118932132 14:70252674-70252696 ATGAAGATACAGTTGAGTGTGGG - Intergenic
1119346788 14:73931893-73931915 GTGAAAAGACAGCTGAGTCTGGG - Exonic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120792697 14:88599719-88599741 ATGAAAATAATGCTGAAGGTGGG - Intronic
1121089678 14:91172372-91172394 ATGAAAATAAAATTGAGGCTGGG - Intronic
1121179405 14:91917281-91917303 ATGAAAAAACAAATTAGGCTGGG + Intronic
1121316838 14:92966285-92966307 ATAGAAATACAGTTGAGGCCAGG - Intronic
1121373703 14:93385481-93385503 ATAAAAATGCTGCTGAGGCCAGG + Intronic
1121513028 14:94527121-94527143 ATAAAAACACACCTGAGACTTGG - Intergenic
1121757937 14:96418812-96418834 ATGAAAATCCTACTGAGGCTAGG - Intronic
1122233924 14:100321595-100321617 GGGCAAATACAGCTGAGACTTGG - Intergenic
1122585382 14:102802531-102802553 ATGAAAAAATACCTGAGGCTGGG + Intronic
1122755943 14:103980202-103980224 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1202891128 14_KI270722v1_random:159012-159034 AAGAAAATACAGCTGGGCCCAGG - Intergenic
1123437710 15:20267667-20267689 ATAAAAATAGAGATGGGGCTGGG + Intergenic
1124073325 15:26415856-26415878 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
1124121995 15:26895515-26895537 TTGAAAATATAAATGAGGCTGGG + Intronic
1124598881 15:31114957-31114979 GTTAAAATAGATCTGAGGCTGGG + Intronic
1124663058 15:31566967-31566989 ATGAAGAAATATCTGAGGCTGGG - Intronic
1124733265 15:32218695-32218717 ATGAAGAAATACCTGAGGCTGGG + Intergenic
1125170904 15:36765349-36765371 ATGAAAATTAAGCTCAGGCTGGG - Intronic
1125364400 15:38898620-38898642 ATGAAGAAATACCTGAGGCTGGG + Intergenic
1125402323 15:39317562-39317584 ATTAAAATCAAGTTGAGGCTGGG + Intergenic
1126436228 15:48641214-48641236 AAGAAAACACAGCAGAAGCTGGG + Intronic
1126533431 15:49734587-49734609 ATGAAAAAATACCTGAGACTAGG + Intergenic
1126750309 15:51870232-51870254 TTAAAAACACAGCTGTGGCTGGG - Intronic
1126792808 15:52236376-52236398 TTGAAAATGCAGCAGAGGCTGGG + Intronic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1127683962 15:61323670-61323692 ATAAAAATACTCTTGAGGCTGGG - Intergenic
1127721772 15:61708998-61709020 ATAAAAATATACCTGAGACTGGG + Intergenic
1128963710 15:72036440-72036462 AAGAAAAAACAGATGAGTCTTGG + Intronic
1129310869 15:74708052-74708074 TTGAAAAGACATCTGAGGCTGGG + Intergenic
1129583122 15:76832919-76832941 ATGAAAAAATACCTGAGACTTGG - Intronic
1129836926 15:78714522-78714544 ATGTAAATGTAGCTGGGGCTGGG - Intronic
1130170699 15:81509992-81510014 ATCAAAATCCATCTGAGGCAAGG + Intergenic
1130705474 15:86229218-86229240 ATGAAGAAATACCTGAGGCTGGG + Intronic
1130812378 15:87393565-87393587 ATGAAAGAACACCTGAGGCCGGG + Intergenic
1131450406 15:92534762-92534784 ATGAAGAAACACCTGAGACTGGG - Intergenic
1131815664 15:96218588-96218610 ATAAAGATACACCTGAGACTGGG - Intergenic
1133177470 16:4026127-4026149 ATGAAACTAAAGTAGAGGCTGGG + Intronic
1133329023 16:4959669-4959691 ATGAAATGACAGCAGTGGCTTGG - Intronic
1133702756 16:8324578-8324600 ATAAACATACACCTGAGACTGGG - Intergenic
1133925080 16:10185683-10185705 TTTAAAATACAGATGTGGCTGGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135521396 16:23181416-23181438 ATAAAAAGGCAGCTGAAGCTAGG + Intergenic
1135725466 16:24850683-24850705 AGGAAAACAAAGCTGAGGCCGGG - Intronic
1135816577 16:25639775-25639797 ATTAAAGAACACCTGAGGCTGGG + Intergenic
1135850690 16:25960333-25960355 ATAAAGAAACACCTGAGGCTGGG - Intronic
1135984097 16:27171002-27171024 ATTAAAGTACAGTTGAGGCTGGG - Intergenic
1136106714 16:28035304-28035326 TAAAAAATACAGCTGAGGATAGG - Intronic
1136294814 16:29295470-29295492 ATAAAAATAAAGATGAGGATTGG - Intergenic
1136846865 16:33583188-33583210 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1137385598 16:48039720-48039742 ATGGAAATACCGTTCAGGCTTGG - Intergenic
1137770535 16:51012743-51012765 ATTAGAATACAACTGAGGTTTGG - Intergenic
1137811000 16:51352434-51352456 ATGAAAAAATATCTGAGACTAGG + Intergenic
1138453206 16:57106009-57106031 AAGAAACTACAGCTTAGGCTGGG - Intronic
1140580869 16:76229292-76229314 ATGAAAACATATCTGAGACTGGG - Intergenic
1141345636 16:83242850-83242872 ATGAGAATCCAGCTGAGTCAGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141434096 16:83989354-83989376 ATGAGAAGACAGCTAAGGCGTGG - Intronic
1141727894 16:85801681-85801703 ATGAAAACCCAGCTCAGGCTAGG - Intronic
1142100705 16:88269481-88269503 ATAAAAATAAAGATGAGGATTGG - Intergenic
1203108573 16_KI270728v1_random:1431843-1431865 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1142546233 17:705439-705461 ATTAAAAATCAGCTGGGGCTGGG + Intronic
1142751757 17:1992944-1992966 ATGAAACTACAGGTGAGGGCCGG + Intronic
1144069360 17:11653926-11653948 ATGGAAATACAGCTGATGGATGG - Intronic
1144159345 17:12542512-12542534 ATTAAAAAATACCTGAGGCTGGG + Intergenic
1144189340 17:12829831-12829853 ATTAAAATAAAGCAGAGGATGGG - Intronic
1144399523 17:14883065-14883087 ATGAAGAAACATCTGAGACTGGG + Intergenic
1145200854 17:20943434-20943456 ATGAAAACACAGATTAGGCCGGG - Intergenic
1145742083 17:27283544-27283566 ATAAAAATTGAGATGAGGCTGGG + Intergenic
1145876435 17:28321720-28321742 AAAAAAATAAAGCTGACGCTGGG - Intronic
1147238524 17:39075252-39075274 ATGAAAAAGAAGCAGAGGCTGGG - Intronic
1147836783 17:43338508-43338530 AAGAAAAGACAGCTGGGGCTGGG + Intergenic
1148711142 17:49681874-49681896 ATGTAATTAGAGCAGAGGCTGGG + Intergenic
1149145116 17:53480969-53480991 ATGAAGAAATAGCTGAGACTGGG - Intergenic
1149203708 17:54218200-54218222 ATAAAAATACAGGGGAGGGTGGG + Intergenic
1149414860 17:56448694-56448716 GTGAAAATCCAGTTGAGACTCGG + Intronic
1149677407 17:58478136-58478158 TTGAAAATACATTTGAGGCCAGG + Intronic
1150347913 17:64418774-64418796 AAGAAAAAAAAGCTGAGGCCAGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150914541 17:69423181-69423203 ACTTAAAAACAGCTGAGGCTTGG - Intronic
1151023466 17:70647816-70647838 ATGAAAATTCAGCTTAGGGATGG - Intergenic
1151042056 17:70873998-70874020 TTAAAAATCGAGCTGAGGCTGGG + Intergenic
1151639607 17:75381430-75381452 ATGAAAATAAAGATACGGCTGGG + Intronic
1152790431 17:82275710-82275732 ATCAAGAAACACCTGAGGCTGGG + Intergenic
1152936312 17:83139314-83139336 CTTAAAATTCAGCTGAGGCCAGG - Intergenic
1152991101 18:364620-364642 ATGAAAATGCAGCTCTAGCTTGG + Intronic
1153254706 18:3158907-3158929 ATGAAAATTGAAATGAGGCTGGG - Intronic
1153718732 18:7879874-7879896 ATGAAGAAACACCTGAGGCTCGG + Intronic
1153867672 18:9287849-9287871 ATGAAATTCCAGCTGTGGCTGGG - Intergenic
1154144602 18:11856633-11856655 ATGACAATACAGGTGGGGCGTGG + Intronic
1155107929 18:22686261-22686283 ATGAAGAAATACCTGAGGCTGGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155842997 18:30669080-30669102 ATGAAAAAATACCTGAGACTGGG + Intergenic
1155945102 18:31840066-31840088 ATGAAAATAGAGGTCAGGCAGGG + Intronic
1155964334 18:32021373-32021395 TTGAAAATACAGCTACGGCCGGG - Intronic
1156794526 18:41027072-41027094 ATGAAAGAATACCTGAGGCTGGG - Intergenic
1157555555 18:48610782-48610804 ATGGAAACAGAGCTGGGGCTTGG - Intronic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1157779384 18:50423933-50423955 ATAAAGAAACACCTGAGGCTGGG - Intergenic
1158185661 18:54768618-54768640 ATGAATAAATAGCTGAGACTGGG + Intronic
1158799330 18:60888037-60888059 ATGAAAAAATACCTGAGACTGGG + Intergenic
1159103831 18:63983184-63983206 ATGACAATAGCGGTGAGGCTTGG + Intronic
1159181047 18:64905441-64905463 AGGAATATACAGCTGATACTTGG - Intergenic
1159521186 18:69527268-69527290 ATGAAGAAACACCTGAGACTGGG + Intronic
1159756486 18:72371763-72371785 ATGAAGAAACACCTGAGACTGGG - Intergenic
1159833516 18:73307659-73307681 ATGCTAATGCAGCTGAGTCTAGG + Intergenic
1160207309 18:76845553-76845575 AAAAAAATGCAGCTGGGGCTGGG + Intronic
1160255741 18:77247326-77247348 ATAAAGAAACACCTGAGGCTGGG + Intergenic
1160307234 18:77751365-77751387 AGGAAAGGAAAGCTGAGGCTGGG + Intergenic
1160599758 18:80003702-80003724 ATGAAAAAACACCTGAGAATAGG + Intronic
1160785940 19:900354-900376 GTGAACATACAGGTGAGGGTAGG - Intronic
1161070946 19:2260659-2260681 GTGAAAATGCTGTTGAGGCTGGG - Intronic
1161546876 19:4886408-4886430 ATGAAACAGCGGCTGAGGCTGGG - Intergenic
1161866842 19:6839194-6839216 ACAAAAAAACAGCTGCGGCTGGG - Intronic
1161894019 19:7066746-7066768 AAGAAAAGACAGCTGGGACTGGG + Intergenic
1162196582 19:8989554-8989576 TTGAAAGGGCAGCTGAGGCTGGG + Intergenic
1162242595 19:9367023-9367045 TTCAAAAGTCAGCTGAGGCTGGG + Intronic
1162290526 19:9776658-9776680 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1162389876 19:10383092-10383114 AAGAAAATACAGCAGAGCCCAGG - Intergenic
1163075607 19:14888468-14888490 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1163863878 19:19756345-19756367 ATAAAAAAACACCTGAGACTGGG + Intergenic
1164567827 19:29340573-29340595 AGAAAAATAAAGCTTAGGCTGGG + Intergenic
1165005873 19:32806188-32806210 ATACACAGACAGCTGAGGCTGGG + Intronic
1165033688 19:33017562-33017584 ATAAAAATAGAGATGCGGCTGGG + Intronic
1165353311 19:35288982-35289004 AATAAAATGCAGATGAGGCTGGG + Intergenic
1165854559 19:38871636-38871658 ATGAACACACAGGTGAGGCACGG - Exonic
1165879696 19:39033175-39033197 ATAAAAATACAATTGTGGCTGGG + Intergenic
1166021758 19:40037569-40037591 TTAAAAATACAGCTTTGGCTGGG - Intronic
1167061188 19:47147746-47147768 AAAAAAATACAGTTGAGGCTGGG - Intronic
1167206817 19:48108076-48108098 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1167392833 19:49207852-49207874 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1167979178 19:53258542-53258564 AAGAAAAGACAGCTGTGTCTGGG - Exonic
1168226399 19:54998311-54998333 ATCAAAATACAACTCAGGCCGGG - Intronic
1168416118 19:56169852-56169874 ATAAAGATACAACTCAGGCTGGG + Intergenic
925830890 2:7894510-7894532 ATGAAGAAATAGCTGAGACTGGG - Intergenic
925948443 2:8888730-8888752 ATTAAAAAACAGTTAAGGCTGGG + Intronic
926392112 2:12403900-12403922 ATAAAGATACACCTGAGACTGGG - Intergenic
927190477 2:20513685-20513707 ATGAAAAGTCTGCTGTGGCTGGG - Intergenic
927675243 2:25100785-25100807 AAGAAAATACAGGGGAGGCCGGG - Intronic
928018091 2:27678247-27678269 ATAAAAAGACCTCTGAGGCTGGG + Intronic
928454456 2:31406429-31406451 ATAAAGAAACACCTGAGGCTGGG - Intronic
928494509 2:31818600-31818622 ATAAAGACACATCTGAGGCTGGG + Intergenic
928592941 2:32835666-32835688 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
929203414 2:39262807-39262829 ATGAAAATGCAGTCCAGGCTGGG + Intronic
929260875 2:39865044-39865066 ATGAAGATATACCTGAGACTGGG - Intergenic
929504507 2:42517888-42517910 AAGAAAATACAGTAGAGGCTGGG + Intronic
930223456 2:48768345-48768367 ATGAAAATACAACACAGGGTGGG + Intronic
930401951 2:50901238-50901260 AAGAAAACAAAGATGAGGCTGGG + Intronic
931613969 2:64136608-64136630 TTAAAAATACAAATGAGGCTGGG + Intronic
931640161 2:64374818-64374840 ATGAAGAAGCAGCTGAGGCAAGG + Intergenic
931870209 2:66448303-66448325 TTTAAAACACAGCTGTGGCTGGG + Intronic
931983898 2:67722955-67722977 ATGAAAAAACACCTGAGCCTGGG - Intergenic
932368523 2:71168668-71168690 ATGACAAAACACCTGAGACTAGG - Intergenic
932403403 2:71497595-71497617 ATGAAGATATACCTGAGACTGGG - Intronic
932637061 2:73399322-73399344 ATGAAGAAACACCTGAGGCTGGG + Intronic
932809082 2:74808940-74808962 ATAAAAGTACAACTGTGGCTGGG + Intergenic
932829994 2:74980161-74980183 ATGGAATTACAGTTCAGGCTAGG - Intergenic
933033161 2:77358154-77358176 ATGAAAGAACATCTGAGCCTGGG + Intronic
933156931 2:78986449-78986471 ATGAAAATATACCTGAGACTGGG + Intergenic
933320739 2:80772723-80772745 ATAAAACTACAGCTGAGTCATGG - Intergenic
933638015 2:84728255-84728277 ATGAAGACATAGCTGAGACTGGG - Intronic
933661438 2:84930669-84930691 ATGAAAATACAGGTCAGGCGCGG + Intergenic
933857164 2:86427159-86427181 ATAACAAAGCAGCTGAGGCTGGG + Intergenic
934160277 2:89243258-89243280 AGGAGAATCCAGCTGAGCCTTGG + Intergenic
934206998 2:89939175-89939197 AGGAGAATCCAGCTGAGCCTTGG - Intergenic
934624904 2:95838363-95838385 ATAAAAAAATAGCTGAGACTAGG + Intronic
934828833 2:97494213-97494235 ATAAAAAAATAGCTGAGACTAGG + Intronic
935033284 2:99343249-99343271 ATAAAAATACAACCCAGGCTGGG - Intronic
935172697 2:100622855-100622877 ATGAAGAAACACCTGAGGCTGGG - Intergenic
935489045 2:103694941-103694963 AAAAAAAAACAGCTCAGGCTGGG + Intergenic
936039332 2:109137894-109137916 AGGAAAGTACTCCTGAGGCTGGG + Intronic
936329521 2:111535739-111535761 ATGAAGAAATATCTGAGGCTGGG + Intergenic
936993578 2:118390990-118391012 ATAAAAACATACCTGAGGCTGGG - Intergenic
937142555 2:119614392-119614414 ATGAAGAAATACCTGAGGCTGGG + Intronic
937171461 2:119874794-119874816 ATAAAAATAATGCTGAGTCTTGG + Intronic
937763074 2:125628600-125628622 ATGAAGACACAACTGAGACTGGG - Intergenic
937864485 2:126738652-126738674 AAGAAATTGCAGCTGAGGCCGGG + Intergenic
938199548 2:129361896-129361918 ATGACTATACTGCTGATGCTGGG + Intergenic
938327101 2:130416501-130416523 ATGGAAGAACACCTGAGGCTTGG - Intergenic
938362838 2:130704976-130704998 ATGGAAGAACACCTGAGGCTTGG + Intergenic
938364524 2:130724307-130724329 ATGAAGAAATACCTGAGGCTGGG - Intergenic
938439225 2:131311589-131311611 ATGGAAGAACACCTGAGGCTTGG + Intronic
938919005 2:135975496-135975518 ATAAAAACAAATCTGAGGCTGGG + Intronic
939094633 2:137820756-137820778 ACAAAGATACACCTGAGGCTGGG + Intergenic
939151053 2:138473070-138473092 ATGTAAAAATAACTGAGGCTGGG - Intergenic
939176026 2:138747889-138747911 GAGAAAATAGAGCTGAGGCAAGG - Intronic
939360385 2:141163806-141163828 ATAAAAATATACCTGAGACTGGG - Intronic
939454490 2:142416407-142416429 ATCAAGATACAGCTGAGGACCGG + Intergenic
939634342 2:144562873-144562895 ATGAAAATATAGGTCAGGCCGGG - Intergenic
940082757 2:149823282-149823304 ATAAAAATATACCTGAGACTGGG + Intergenic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941373819 2:164702803-164702825 TTGAAAACACAATTGAGGCTGGG - Intronic
941519507 2:166521785-166521807 TTAAAAATAAAGTTGAGGCTGGG + Intergenic
942342197 2:174960545-174960567 ATTAAAACACAGCTGGGGCCGGG + Intronic
942503413 2:176616451-176616473 ATGAAAAAATACCTGATGCTGGG + Intergenic
943152062 2:184126278-184126300 ATGCAAGAACACCTGAGGCTGGG + Intergenic
943277579 2:185887259-185887281 ATGAAGGAACACCTGAGGCTAGG - Intergenic
943406618 2:187495016-187495038 ATCAAAATTCACTTGAGGCTGGG - Intronic
943882034 2:193158026-193158048 ATAAAGAAACACCTGAGGCTGGG - Intergenic
943966297 2:194338166-194338188 TTTAAAATCCAGCTGAGGCCGGG + Intergenic
944846976 2:203678901-203678923 ATAAAAAGACAGCAGAGGCCAGG + Intergenic
944891974 2:204127181-204127203 ATGAAGATATACCTGAGACTGGG - Intergenic
945013170 2:205486462-205486484 ATGAAGAAATACCTGAGGCTGGG + Intronic
945092979 2:206193381-206193403 AAGAAAACACAGCTGGGGCCAGG - Intronic
945718839 2:213392549-213392571 ATGAAAATAGTGTTGAGGCTGGG + Intronic
945822056 2:214676074-214676096 ATTAAAATACAGTGGGGGCTGGG + Intergenic
945930295 2:215848147-215848169 ATGAAGAAATATCTGAGGCTGGG - Intergenic
946002111 2:216491085-216491107 GTAAAAATACATCTAAGGCTGGG + Intergenic
946355689 2:219182909-219182931 ATGAGAATAGAGATGAGGCAGGG - Exonic
946803544 2:223446862-223446884 ATGAAAAAATACCTGAGACTGGG - Intergenic
947274988 2:228380465-228380487 ATGAAGAAATACCTGAGGCTGGG - Intergenic
947334386 2:229066974-229066996 ATGAAAAAACACCCGAGACTGGG + Intronic
948682529 2:239645644-239645666 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
948799704 2:240426753-240426775 ATGAAGAAACACCTGAGGCTGGG + Intergenic
948805270 2:240451205-240451227 ACACACATACAGCTGAGGCTGGG - Intronic
1168743098 20:211693-211715 AAAGAAATAAAGCTGAGGCTAGG + Intergenic
1169051938 20:2586413-2586435 ATGAAGAAATACCTGAGGCTGGG + Intronic
1169578182 20:6989578-6989600 ATGAATTTACAGCAGATGCTAGG - Intergenic
1169599126 20:7236857-7236879 ATGAGAAAAAAGCTCAGGCTTGG + Intergenic
1169827744 20:9788650-9788672 ATGAAAGTACAACAGTGGCTTGG - Intronic
1169830018 20:9814871-9814893 ATAAAAGTATACCTGAGGCTGGG + Intronic
1170661858 20:18349570-18349592 ATGTCAATAGAGCTGAGGTTGGG + Intergenic
1170828680 20:19820614-19820636 GTGGAAACACACCTGAGGCTGGG - Intergenic
1171063020 20:21984826-21984848 ATAGAAATACAACTTAGGCTGGG + Intergenic
1172047317 20:32089663-32089685 GTGAAAAAACTGCTTAGGCTGGG - Intronic
1173108286 20:40159291-40159313 ATAAAAAGAGAACTGAGGCTGGG - Intergenic
1173307919 20:41868564-41868586 ATGAAAAGATAACTGAGGTTTGG - Intergenic
1174238921 20:49117255-49117277 GGGAAAAGAGAGCTGAGGCTAGG + Intronic
1174757360 20:53173311-53173333 ATAATAATAAAGCGGAGGCTGGG + Intronic
1175796027 20:61771326-61771348 AAAAAAATGCAGTTGAGGCTGGG + Intronic
1175893532 20:62325923-62325945 ATCAGAAGACAGCTCAGGCTGGG + Intronic
1177108865 21:16999210-16999232 ATAAAAACATACCTGAGGCTGGG + Intergenic
1177315983 21:19461759-19461781 ATGAAAACACACCTGAGACTGGG + Intergenic
1177714852 21:24826362-24826384 ATAAAGAAACAGCTGAGGGTTGG + Intergenic
1177763736 21:25433258-25433280 ATGAAAATACTTCTGAGGTAGGG + Intergenic
1177970778 21:27786938-27786960 ATGAAGAAATACCTGAGGCTGGG - Intergenic
1178363789 21:31971580-31971602 CTTAAAATACATCTGGGGCTAGG - Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178484785 21:33012090-33012112 ATAAAGAAACACCTGAGGCTGGG - Intergenic
1178507860 21:33177384-33177406 ATGAAGAAACACCTGAGACTGGG - Intergenic
1178571246 21:33739087-33739109 ATTAAAAAATATCTGAGGCTTGG - Intronic
1178707136 21:34885672-34885694 ATCAAGACCCAGCTGAGGCTTGG + Intronic
1178954695 21:37011669-37011691 ATGAAAATATGGCTGGGGCCGGG + Intronic
1179074474 21:38107112-38107134 ATGAAAAAATACCTGAGACTGGG + Intronic
1179303803 21:40136618-40136640 ATAAAAATACAGCTGAGGGGAGG + Intronic
1179329022 21:40380766-40380788 TTGAAAATAGAACTGAGGCCGGG + Intronic
1179567642 21:42259111-42259133 AAGAAAATCCAGCTAAGGCTGGG - Intronic
1180255887 21:46627225-46627247 ATGAAGAAACACCTGAGGCTGGG + Intergenic
1181011691 22:20044614-20044636 GTGAGAATGCTGCTGAGGCTGGG + Intronic
1181574656 22:23786218-23786240 ATGAAATTGCAGCTGTGGCTGGG - Intergenic
1181743859 22:24942287-24942309 ATTAAAATACATTTGAGGCCGGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182402117 22:30086490-30086512 GGGAAAATAGAGCTGAGGCTAGG + Intronic
1182866985 22:33612395-33612417 ATAAAGAAACAACTGAGGCTGGG - Intronic
1183949557 22:41345174-41345196 TAGCAAAGACAGCTGAGGCTCGG + Intronic
1184498198 22:44855831-44855853 ATGAAGAAATACCTGAGGCTGGG + Intronic
949358395 3:3205664-3205686 ATGAAAACATAACTAAGGCTGGG - Intergenic
949384700 3:3488226-3488248 ATGTAGATACAGCAGAGACTGGG + Intergenic
949608197 3:5677063-5677085 ATAAACAAACACCTGAGGCTGGG - Intergenic
949974252 3:9440484-9440506 ATGAGAATACAACTGAGGGCTGG + Exonic
950031913 3:9859294-9859316 ATAAAAATATACCTGAGACTGGG - Intergenic
950698463 3:14722756-14722778 ATGAGAATACAGTGGAGACTGGG + Intronic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
952139317 3:30460219-30460241 ATAAAGAAACACCTGAGGCTTGG - Intergenic
952671393 3:35973786-35973808 ATGAAGAAACACCTGAGACTCGG + Intergenic
952672607 3:35988600-35988622 ATTAAAATGCAAATGAGGCTGGG - Intergenic
952865270 3:37851086-37851108 TTGAAAAGACAGATTAGGCTGGG + Intergenic
953507542 3:43501054-43501076 ATGAAGAAATACCTGAGGCTGGG + Intronic
953521010 3:43643324-43643346 TTGAAAATACATCTCAGGCAGGG - Intronic
953619447 3:44520483-44520505 ATGAAAAGACAGCAAAGGCAGGG + Intergenic
954691331 3:52397146-52397168 ATGAAAAGACAGCTGATGGAGGG - Intronic
955261486 3:57395647-57395669 ATCAAAATAAATCTTAGGCTGGG + Intronic
955294010 3:57718992-57719014 TTGAAAATCTAGCTTAGGCTGGG + Intergenic
955571766 3:60314787-60314809 AAGAGAATTCAGCAGAGGCTGGG + Intronic
956140626 3:66143059-66143081 AATAAAAGACAGCTTAGGCTGGG - Intronic
956145861 3:66190014-66190036 AAGAAACTACAGTTGAGGCTGGG + Intronic
956720882 3:72116612-72116634 ATGAAATTAAAGCTGAGGGATGG - Intergenic
956891241 3:73616279-73616301 ATGAAGAAATACCTGAGGCTGGG - Intronic
956915585 3:73867628-73867650 ATTAAAATGCAGTTGCGGCTAGG - Intergenic
958569350 3:95860175-95860197 AAAAAAATACATATGAGGCTGGG - Intergenic
958583041 3:96051506-96051528 ATAAAAATATACCTGAGACTGGG + Intergenic
958639058 3:96780849-96780871 ATAAAGATACACCTGAGACTGGG - Intergenic
959891977 3:111567162-111567184 ATAAAAAGACAGTTAAGGCTAGG + Intronic
960223264 3:115142365-115142387 AAAAAAATTCAACTGAGGCTGGG + Intronic
961061526 3:123832839-123832861 ATGACAAAATACCTGAGGCTGGG - Intronic
961503657 3:127355808-127355830 ATGAAGAAACACCTGAGACTGGG + Intergenic
962117111 3:132522254-132522276 ATGAAAATTCATGTGAGGCATGG - Intronic
962254179 3:133859266-133859288 ATAAATTTACAGCTGAGGGTGGG - Intronic
962354381 3:134681166-134681188 ATGAAAAGAGAGCTGGGGGTCGG + Intronic
962775118 3:138651925-138651947 ATGAAAATACAGGTTTGGCTGGG + Intergenic
962816220 3:139003545-139003567 ATAAAAATAAATCTGAGGCCAGG + Intergenic
963199311 3:142569938-142569960 ATAAAAAAACAGTTGGGGCTGGG - Intronic
963574659 3:147045204-147045226 ATGAAGAAACACCTGAGACTGGG + Intergenic
963765584 3:149332794-149332816 ATGAAAAAAAAGCAGAGACTTGG - Intronic
963849333 3:150194544-150194566 ATGAAGAAATACCTGAGGCTGGG + Intergenic
964524734 3:157606465-157606487 ATGAAAATCCCACTGTGGCTGGG - Intronic
964717034 3:159733338-159733360 ATGTATATACAGCTGGGGTTGGG + Intronic
964996043 3:162882219-162882241 ATAAAGATACATCTGAGGTTGGG - Intergenic
965127753 3:164651215-164651237 ATGAAAAAATACCTGAGACTGGG - Intergenic
965218139 3:165891909-165891931 ATAAAGAAATAGCTGAGGCTGGG + Intergenic
965267978 3:166572016-166572038 ATAAAGATACACCTGAGACTGGG - Intergenic
965640958 3:170828629-170828651 ATTAAAAATCAGCTTAGGCTAGG - Intronic
965863940 3:173182483-173182505 ATAAAGATACACCTGAGACTGGG - Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966754202 3:183353429-183353451 ATAAAAATATATCTGAAGCTGGG + Intronic
967259124 3:187624669-187624691 AGGAAAATACATCTGAGGACAGG - Intergenic
967324361 3:188224530-188224552 ATAAAGAAATAGCTGAGGCTCGG + Intronic
967513508 3:190340294-190340316 ATGAAAACATACCTGAGACTGGG + Intronic
968061227 3:195727395-195727417 AAGCAAATACAGCGAAGGCTTGG + Intronic
968685769 4:1957581-1957603 ATAAAAATGCACCTGAGGCCGGG - Intronic
970063828 4:12068245-12068267 ATGGAAATACATTTTAGGCTGGG + Intergenic
970121624 4:12759619-12759641 ATAAAAACATACCTGAGGCTAGG - Intergenic
970424199 4:15931420-15931442 ATAAAGATATACCTGAGGCTGGG + Intergenic
970935407 4:21564638-21564660 ATGAAGAGATACCTGAGGCTGGG + Intronic
971018731 4:22513806-22513828 ATGAAAATAAAGTTAAGGTTGGG - Intronic
971201448 4:24512704-24512726 ATGAAAAAAATGCTGATGCTTGG + Intergenic
971755800 4:30706570-30706592 ATAAAAAAATACCTGAGGCTGGG - Intergenic
971768076 4:30859959-30859981 ATGAAAATGTGACTGAGGCTGGG + Intronic
971802391 4:31308843-31308865 ATGAAAATACAGTTAAGGCTGGG - Intergenic
971902231 4:32676462-32676484 ATAAAAAACCACCTGAGGCTGGG + Intergenic
971948070 4:33306981-33307003 ATGAAAAAATATCTGAGGCTGGG + Intergenic
971969306 4:33601228-33601250 ATAAAAACATACCTGAGGCTGGG - Intergenic
972244083 4:37226139-37226161 AAGAAATGACAGCTGAGGTTAGG - Intergenic
972764650 4:42141277-42141299 CTCCAAATAGAGCTGAGGCTTGG - Intronic
972960783 4:44449003-44449025 TTTAAATGACAGCTGAGGCTCGG - Intergenic
973303221 4:48613658-48613680 ATGTAAATGCATTTGAGGCTGGG + Intronic
973319061 4:48791351-48791373 ATAAAAACACACCTGAGACTGGG - Intergenic
973560805 4:52133373-52133395 GTGAAGAAACACCTGAGGCTGGG - Intergenic
973807438 4:54539742-54539764 ATGAGCATGCAGCTGAGCCTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974240023 4:59235311-59235333 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
974245906 4:59317186-59317208 TTGAAAATCCTGCTGAGACTGGG - Intergenic
974290084 4:59918395-59918417 ATGAAAACATACCTGAGACTGGG - Intergenic
974493450 4:62596023-62596045 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
974563317 4:63552066-63552088 ATTAAGACACACCTGAGGCTGGG + Intergenic
975578699 4:75887986-75888008 GGGAAAATAAAGCAGAGGCTGGG + Intronic
976414401 4:84755772-84755794 ATTAAAATACTGCTGAGAATGGG - Intronic
978147877 4:105397923-105397945 ATGAAAGAACTGCTGAGGCTGGG - Intronic
978308059 4:107353912-107353934 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
978640782 4:110868702-110868724 ATAAAGAAACATCTGAGGCTGGG - Intergenic
978885955 4:113766673-113766695 CTGAAAATAAGGCTGATGCTGGG - Intergenic
979055041 4:115983008-115983030 ATGAAAATAAAACAGACGCTGGG + Intergenic
979249138 4:118545737-118545759 GTGAAAAAATAGCTGAGTCTGGG + Intergenic
979411627 4:120385697-120385719 ATGAAGACACACCTGAGACTGGG - Intergenic
979681391 4:123463946-123463968 ATGCAAATAGAGCTGATCCTAGG - Intergenic
979849329 4:125556785-125556807 ATAAAGATATACCTGAGGCTGGG + Intergenic
980203833 4:129691859-129691881 ATGAAAATTCAGATGAGATTTGG + Intergenic
980335442 4:131468077-131468099 ATAAAGATATAACTGAGGCTGGG - Intergenic
980370288 4:131861096-131861118 ATAAAGACACAGCTGAGACTGGG + Intergenic
980746324 4:137021795-137021817 AATAGAATACAGCTGGGGCTGGG - Intergenic
981277369 4:142916572-142916594 ATGAATATACAGAATAGGCTGGG + Intergenic
982424010 4:155235441-155235463 ATGAAAATAAAAATGAGGGTTGG - Intergenic
982574034 4:157085785-157085807 ATGAAAATACAGGCCAGGCACGG - Intronic
983483407 4:168303686-168303708 ATAAAAGTACAGCATAGGCTGGG + Intronic
983483702 4:168307633-168307655 AGGAAAATATATCTGAGCCTAGG - Intronic
983794376 4:171842456-171842478 ATGAAGAAATACCTGAGGCTGGG + Intronic
983967304 4:173828673-173828695 ATGAAAAGACAGCTATGTCTTGG - Intergenic
984300002 4:177903682-177903704 ATAAAAGTACAGCTTGGGCTGGG + Intronic
984414682 4:179442756-179442778 TTAAAAATACAGCAGTGGCTGGG - Intergenic
984762202 4:183372256-183372278 ATGAAAAAACACCTGAGACTGGG + Intergenic
985291301 4:188390948-188390970 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
985420770 4:189783085-189783107 AGGAACATACAGCTGAGCGTGGG + Intergenic
985436724 4:189937378-189937400 ATGAAGAAATACCTGAGGCTGGG - Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986169219 5:5302150-5302172 GTGCAAAACCAGCTGAGGCTTGG + Intronic
986500198 5:8390646-8390668 ATGAAGACATAGCTGAGACTGGG - Intergenic
986884653 5:12218124-12218146 CTAAAAATACAGTTTAGGCTGGG + Intergenic
986960455 5:13203827-13203849 ATAAACACATAGCTGAGGCTCGG + Intergenic
987102400 5:14604034-14604056 ATAAAAATACAACAGAGGCCAGG + Intronic
987294632 5:16538990-16539012 TTCAAAATAAAACTGAGGCTAGG + Intronic
987427691 5:17792380-17792402 ATGAAGAAATACCTGAGGCTGGG - Intergenic
987531650 5:19129745-19129767 ATAAAGATATACCTGAGGCTGGG + Intergenic
987717696 5:21593300-21593322 ATGAAGAAATACCTGAGGCTGGG - Intergenic
988262905 5:28911975-28911997 ATAAAAAAATACCTGAGGCTGGG - Intergenic
988358989 5:30211479-30211501 ATGAAAAAATACCTGAGACTGGG - Intergenic
989163820 5:38415707-38415729 ATGAAGAAACACCTGAGACTGGG + Intronic
989572184 5:42954865-42954887 ATAAAAATACAGCCGAGATTAGG + Intergenic
990044725 5:51415335-51415357 ATGAAAATATAGCAGTGGATAGG - Intergenic
990143264 5:52730273-52730295 ATGAAGAAATACCTGAGGCTGGG - Intergenic
990278717 5:54227094-54227116 ATAAAGATATACCTGAGGCTGGG - Intronic
990740785 5:58910629-58910651 ATGAAGATATACCTGAGACTGGG + Intergenic
991643640 5:68778901-68778923 ATAAAGAAATAGCTGAGGCTGGG + Intergenic
992326534 5:75665548-75665570 GTGGAAGTAAAGCTGAGGCTGGG + Intronic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993384379 5:87246878-87246900 AGGAGAATACATCAGAGGCTGGG - Intergenic
993708728 5:91200919-91200941 AAAAAAATACACCTGAGGCCAGG + Intergenic
993860238 5:93127030-93127052 TTAAAAATACAGTTTAGGCTTGG + Intergenic
994516214 5:100775538-100775560 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
994590882 5:101770042-101770064 ATAAAGATATACCTGAGGCTAGG + Intergenic
994625850 5:102217767-102217789 ATGAGAAGACAGATTAGGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994782279 5:104105456-104105478 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
994809015 5:104489064-104489086 ATAAAAATACAGCATAGGCCGGG - Intergenic
995392956 5:111659824-111659846 ATGAAGAAACACCTGAGACTGGG + Intergenic
995939829 5:117568449-117568471 ATGAAGATACAGCAAAGTCTTGG - Intergenic
995987424 5:118195506-118195528 ATTAAAATAGAGTTGGGGCTCGG + Intergenic
996184317 5:120457853-120457875 AAGAAAAGACAGCTGGGTCTAGG + Intergenic
996715547 5:126585001-126585023 TTCAAAGTACAGCTAAGGCTGGG + Intronic
997038082 5:130217319-130217341 AAGAAAATAAAGCAGGGGCTAGG + Intergenic
997380010 5:133428933-133428955 TGGAAACTACAGCTGAGACTTGG - Intronic
997456004 5:134018046-134018068 ATGAAGAAATACCTGAGGCTGGG + Intergenic
997828190 5:137126372-137126394 ATGAAGGAACACCTGAGGCTGGG - Intronic
998101026 5:139434615-139434637 AAGAAAATATAGTTGAGGCTGGG - Intronic
998449408 5:142222752-142222774 GTGAAAATAGAGCTGATGATTGG - Intergenic
999127098 5:149253859-149253881 ATGAAGATATACCTGAGACTGGG + Intronic
999128208 5:149262457-149262479 ATGAAAATACAGATGCTGATTGG - Intergenic
999376773 5:151092224-151092246 ATGTAAAGAGAGCTGAGACTGGG + Intronic
999686684 5:154109405-154109427 ATTAAAACACAGCTGTGGCCAGG - Intronic
999871534 5:155756654-155756676 ATGAAATTGCAACTGTGGCTGGG - Intergenic
1001606100 5:172960865-172960887 ATATCAATAGAGCTGAGGCTAGG - Intronic
1002060908 5:176625555-176625577 ATTCAAACCCAGCTGAGGCTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1003343049 6:5240126-5240148 AATAGGATACAGCTGAGGCTAGG - Intronic
1003671155 6:8161647-8161669 ATAAAGAAATAGCTGAGGCTGGG + Intergenic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004303210 6:14476931-14476953 AAGAAAATACAGCTGGAGCTGGG + Intergenic
1004323771 6:14654771-14654793 ATAAAGATACACCTGAGGCTGGG + Intergenic
1004477017 6:15982648-15982670 ATAAAGAAACACCTGAGGCTGGG - Intergenic
1005953576 6:30648218-30648240 AAGAATATCCAGCTGAAGCTAGG - Intronic
1006062849 6:31438347-31438369 ATGAAGAAATACCTGAGGCTGGG - Intergenic
1006233550 6:32607045-32607067 ATGAAAATACAAATGGGGTTTGG + Intergenic
1006329425 6:33379571-33379593 GAGAATATACAGTTGAGGCTGGG + Intergenic
1007082642 6:39118954-39118976 ATGAAGAAACACCTGAGACTGGG - Intergenic
1009383523 6:63062315-63062337 ATAAAAACACATCTGAGACTGGG - Intergenic
1009496218 6:64351090-64351112 ATGAAGAAATACCTGAGGCTGGG - Intronic
1009518433 6:64650677-64650699 ATGATACTAGAGCTCAGGCTTGG - Intronic
1009925625 6:70117273-70117295 GTGAAAATGCAGCTAAGACTAGG + Intronic
1010726063 6:79335190-79335212 CTGAAAATATAACTGTGGCTGGG - Intergenic
1010881391 6:81178140-81178162 ATAAAAATATACCTGAGACTGGG - Intergenic
1011669424 6:89668664-89668686 ATGAAGATATATCTGAGGATGGG + Intronic
1012205054 6:96450970-96450992 ATCAAACTACAGCTGTGTCTAGG - Intergenic
1012635573 6:101535446-101535468 ATGTAAATAAAGTAGAGGCTAGG + Intronic
1013300561 6:108801311-108801333 ATAAAGAAACACCTGAGGCTGGG + Intergenic
1013470334 6:110458351-110458373 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1013503614 6:110776632-110776654 GAGAAGATACAGCTGAGGCTGGG - Intronic
1013525222 6:110967982-110968004 TTTAAAATACAGTTTAGGCTGGG + Intergenic
1013539713 6:111095881-111095903 ATGAAGAAATATCTGAGGCTGGG - Intronic
1013936426 6:115600948-115600970 ATGACATTGCAGCTGAGACTTGG - Intergenic
1015407613 6:132855383-132855405 ATAAAGAAACACCTGAGGCTGGG - Intergenic
1015446227 6:133308155-133308177 ATGAAGAAACACCTGAGACTGGG - Intronic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1016013013 6:139158205-139158227 ATAAAAAGTCAGCTGGGGCTGGG + Intronic
1016318263 6:142813859-142813881 ATTAAAAAACATCTGAGGCCAGG - Intronic
1016652587 6:146479793-146479815 ATAAAGATATAGCTGAGACTGGG - Intergenic
1018080669 6:160257059-160257081 ATGTAAAGAAAACTGAGGCTGGG - Intronic
1018190430 6:161305215-161305237 ATTAAAAACCAGCTGAGGCCGGG + Intergenic
1018359471 6:163052693-163052715 ATAAAGAAACATCTGAGGCTGGG - Intronic
1018608457 6:165623411-165623433 ATAAAGAAACACCTGAGGCTGGG - Intronic
1018754963 6:166840984-166841006 AAAAAAAGAAAGCTGAGGCTGGG + Intronic
1018866310 6:167749055-167749077 TTGAAAACACAGGCGAGGCTTGG + Intergenic
1019005223 6:168790937-168790959 GTGAAGAAACACCTGAGGCTGGG - Intergenic
1019253196 7:31478-31500 TTGAAAAACCAGCTGAGGCCGGG + Intergenic
1019469783 7:1213041-1213063 TTAATAAAACAGCTGAGGCTAGG + Intergenic
1020034136 7:4953764-4953786 ATGAAAATGAGACTGAGGCTGGG - Intronic
1020183977 7:5944661-5944683 AAAAAAAGACTGCTGAGGCTGGG + Intronic
1020298941 7:6780116-6780138 AAAAAAAGACTGCTGAGGCTGGG - Intronic
1020329175 7:7000740-7000762 AAGAAAATACTGCTAAGGCTGGG + Intergenic
1020906527 7:14070322-14070344 ATGAAGAAACACCTGAGGCTGGG - Intergenic
1021083275 7:16388577-16388599 ATAAAATAACAGTTGAGGCTGGG + Intronic
1022249042 7:28588770-28588792 AAGAAAATACAGCAGGGGCAAGG - Intronic
1022293394 7:29025192-29025214 ATAAAAACATACCTGAGGCTGGG + Intronic
1022680032 7:32536076-32536098 ATGAAAAAACACCTGAGACTGGG - Intronic
1023481037 7:40634988-40635010 ATGAAAATGGGACTGAGGCTGGG + Intronic
1023552022 7:41380673-41380695 ATGGAAATACACCTGAGGGAGGG + Intergenic
1023927563 7:44681096-44681118 TTGTCAATACTGCTGAGGCTGGG + Intronic
1024384745 7:48738681-48738703 ATGTAAACACCCCTGAGGCTTGG - Intergenic
1024424862 7:49213528-49213550 ATAAAGACATAGCTGAGGCTGGG + Intergenic
1025191980 7:56902690-56902712 ATAAAAATATAGCTTGGGCTGGG + Intergenic
1025679972 7:63674241-63674263 ATAAAAATATAGCTTGGGCTGGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1027489717 7:78808222-78808244 ATAAAAATACAGCTGAAGGCTGG - Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1027728247 7:81834978-81835000 ACTAAACTACAGCTGATGCTTGG + Intergenic
1027845001 7:83361445-83361467 ATGTAAAGCCAGCTAAGGCTAGG - Intergenic
1027877929 7:83795535-83795557 ATGGAAATACACCTAAGGCCTGG - Intergenic
1028031793 7:85924508-85924530 GCAAAAATACAGTTGAGGCTAGG + Intergenic
1028084122 7:86616033-86616055 ATGAAGACATACCTGAGGCTGGG - Intergenic
1028330839 7:89589599-89589621 TTAAAAAGTCAGCTGAGGCTGGG - Intergenic
1028400382 7:90419126-90419148 AATAAAATGCAACTGAGGCTGGG + Intronic
1028597305 7:92559114-92559136 TTTAAAATACAGCAAAGGCTGGG + Intergenic
1029099683 7:98118609-98118631 ATGAAAATACTGTGGATGCTGGG - Intronic
1029200585 7:98836655-98836677 ATAAAAATCCAGTTGAGGCCGGG - Intergenic
1029542870 7:101194794-101194816 TTAAGAACACAGCTGAGGCTGGG - Intergenic
1030025447 7:105319699-105319721 CTGTAAATACAGCTGAGTCCTGG + Intronic
1030559207 7:111064061-111064083 ATGAAGACATACCTGAGGCTGGG + Intronic
1030728034 7:112949397-112949419 ATGAAAACACATCTCATGCTTGG - Intergenic
1030831849 7:114233715-114233737 AATAAAATACAGCAGTGGCTGGG + Intronic
1030841639 7:114360306-114360328 ATGAAGAAACACCTGAGACTGGG - Intronic
1030919858 7:115369347-115369369 ATAAAAGAATAGCTGAGGCTGGG - Intergenic
1031279988 7:119786895-119786917 GTCAAAATACAGCCGATGCTGGG - Intergenic
1031299346 7:120043706-120043728 ATAAAGATACACCTGAGACTGGG - Intergenic
1031796156 7:126176400-126176422 ATAAAGAAACAGCTGAGACTGGG - Intergenic
1032743693 7:134765019-134765041 ATGAAAACAAAGTTCAGGCTGGG + Intronic
1033453767 7:141484029-141484051 ATTAAAATACTTCTTAGGCTGGG - Intergenic
1034005494 7:147467734-147467756 AAGAAAGAACAGCTGTGGCTGGG + Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1035235352 7:157494351-157494373 ATGAAGGAACACCTGAGGCTGGG + Intergenic
1035585762 8:772194-772216 TTAAAATTACAGATGAGGCTGGG - Intergenic
1035673831 8:1440765-1440787 ATGAACCTGCAGATGAGGCTGGG + Intergenic
1036141996 8:6217236-6217258 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
1037060082 8:14497150-14497172 ATGAAGAAATACCTGAGGCTGGG + Intronic
1037340547 8:17839994-17840016 ATGAAAATACAGATGTGGGCCGG + Intergenic
1037642016 8:20753463-20753485 ATGAAAAAATACCTGAGACTGGG - Intergenic
1037701962 8:21283481-21283503 ATGAAGAAACACCTGAGACTGGG + Intergenic
1038074619 8:24057703-24057725 ATGAGAAGACAGCTGGGGCCTGG - Intergenic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1038818997 8:30935068-30935090 AGAAAAATACAGCTCAGGCCTGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1038955604 8:32464877-32464899 ATGGAAATTCAGCTGTGGCCAGG + Intronic
1040420982 8:47240346-47240368 ATGAGGATACAGGTCAGGCTTGG + Intergenic
1040733717 8:50481085-50481107 ATAAACATACAGCACAGGCTGGG + Intronic
1041061472 8:54038908-54038930 ATGAGAAGACAGCTGAGACGGGG - Intergenic
1041682744 8:60609668-60609690 TAGAAAATCCAGGTGAGGCTGGG + Intronic
1041946882 8:63454893-63454915 ATAAAGATATACCTGAGGCTGGG + Intergenic
1042891578 8:73617771-73617793 ATGAAGCTACAACAGAGGCTGGG + Intronic
1042989359 8:74621402-74621424 ATGAAAAAATACCTGAGACTGGG + Intronic
1043043587 8:75293387-75293409 ATGAAAATACAGAAGTGGCCGGG + Intergenic
1043335981 8:79177594-79177616 ATGAAAAAATACCTGAGACTGGG - Intergenic
1044212100 8:89562047-89562069 ATGAAAATACACATGATGTTGGG - Intergenic
1044613029 8:94113408-94113430 ATGAAAAAGGAGCTGAGGGTAGG + Intergenic
1045996115 8:108364264-108364286 ATGAAGAAACACCTGAGACTGGG + Intronic
1046008768 8:108519682-108519704 ATAAAAATGCAGCTAGGGCTAGG + Intergenic
1046067545 8:109214294-109214316 AAGAAAAGACAGCTGGGTCTGGG - Intergenic
1046178011 8:110604938-110604960 ATAAAGAAACATCTGAGGCTAGG + Intergenic
1046638952 8:116703807-116703829 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046685308 8:117219605-117219627 ATAAAGAAACACCTGAGGCTGGG + Intergenic
1046697707 8:117360514-117360536 ATGAAAAATCAGAAGAGGCTGGG + Intergenic
1046838156 8:118825944-118825966 ATGAAGAAATACCTGAGGCTGGG - Intergenic
1046904199 8:119554655-119554677 ATAAAAATACATCTGAGGCTGGG - Intergenic
1047087884 8:121539479-121539501 ATAAAAAAAAACCTGAGGCTGGG + Intergenic
1047321042 8:123783492-123783514 ATGTACATACATCTGAGGATAGG - Intronic
1047325866 8:123835226-123835248 ATGAAGAAACACCTGAGACTGGG - Intergenic
1047613161 8:126540441-126540463 ATGAAAAAATACCTGAGACTGGG - Intergenic
1048687528 8:136920400-136920422 ATGAAGAACCACCTGAGGCTGGG + Intergenic
1048744073 8:137593652-137593674 ATGAAGAAATATCTGAGGCTGGG - Intergenic
1049846516 8:144804599-144804621 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1049881412 8:145066687-145066709 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1050218513 9:3358699-3358721 ATGAAAAAATACCTGAGACTGGG + Intronic
1050703739 9:8370883-8370905 AAGAAAAAACAGCAGAGGCCAGG - Intronic
1051984354 9:23064536-23064558 ATGAAGAAACACCTGAGACTGGG + Intergenic
1052643064 9:31194154-31194176 ATGAAGAAATAGCTGAGACTGGG + Intergenic
1052662800 9:31457410-31457432 ATGAAAAAATACCTGAGACTGGG - Intergenic
1053634871 9:39987582-39987604 ATAAAGACACAGCTGAGACTGGG + Intergenic
1053771055 9:41476752-41476774 ATAAAGACACAGCTGAGACTGGG - Intergenic
1054209016 9:62263115-62263137 ATAAAGACACAGCTGAGACTGGG - Intergenic
1054315795 9:63585024-63585046 ATAAAGACACAGCTGAGACTGGG + Intergenic
1054549789 9:66388557-66388579 ATAAAGACACAGCTGAGACTGGG - Intergenic
1055695028 9:78874159-78874181 ATGAAGAAATACCTGAGGCTGGG - Intergenic
1055890795 9:81121903-81121925 ATAAAAATATACCTGAGACTGGG - Intergenic
1056205363 9:84314781-84314803 ATAAAAATACAGCATGGGCTGGG + Intronic
1056482874 9:87023807-87023829 ATGAAGAAATAGCTGAGACTGGG + Intergenic
1057116294 9:92525593-92525615 ATAAAAATACAGCACAGGCTGGG + Intronic
1058307592 9:103463060-103463082 ATGAAAAAATACCTGAGACTGGG + Intergenic
1059069342 9:111119483-111119505 ATGAAAAAACACTTGAGACTGGG + Intergenic
1059371560 9:113843778-113843800 ATAAAAAAACTTCTGAGGCTGGG + Intergenic
1059998134 9:119933639-119933661 ATAAAGATATATCTGAGGCTGGG - Intergenic
1060020415 9:120125552-120125574 ATGAAAACATACCTGAGACTGGG - Intergenic
1060468162 9:123926265-123926287 ATTAAAATAAACATGAGGCTGGG + Intronic
1060652678 9:125342897-125342919 AGGAAAATACAGCTGGGGGTTGG + Intronic
1061567407 9:131451102-131451124 TAGAAAATACAGCTGAGGCCGGG + Intronic
1061750201 9:132771819-132771841 ATAAAAACACACCTGAGACTGGG + Intronic
1061785590 9:133026049-133026071 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1062484322 9:136767184-136767206 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1062588420 9:137261775-137261797 ATGAAAAGACAGCTGGGCCCGGG + Intronic
1185557457 X:1032613-1032635 ATAAAGATACAACCGAGGCTGGG + Intergenic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1185918988 X:4068069-4068091 ATGAAAAAATACCTGAGACTGGG - Intergenic
1186149357 X:6657781-6657803 ATAAAAGAATAGCTGAGGCTGGG - Intergenic
1186158626 X:6752323-6752345 ATGAAAATACAGCAATGGCCAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186233157 X:7478104-7478126 ATGAAGAAACACCTGAGACTGGG + Intergenic
1186704466 X:12127239-12127261 ATGAAAAAATACCTGAGACTGGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1187652875 X:21429602-21429624 ATAAAAATTAACCTGAGGCTGGG + Intronic
1188041576 X:25375665-25375687 ATGAAGAAACACCTGAGACTGGG - Intergenic
1188888990 X:35586478-35586500 ATAAAGATATAGCTGAGACTGGG + Intergenic
1188957473 X:36450185-36450207 ATGAAAAAATACCTGAGACTGGG + Intergenic
1189011179 X:37047124-37047146 ATAAGAGTACAGCTGATGCTTGG + Intergenic
1189214388 X:39310739-39310761 TGGAAAATAAAACTGAGGCTTGG - Intergenic
1189359931 X:40342123-40342145 TTGAAAATGGAGATGAGGCTGGG - Intergenic
1189656741 X:43252313-43252335 ATAAAAAAATACCTGAGGCTAGG + Intergenic
1189672227 X:43423419-43423441 ATTAAAAAACATCTGAGGCCAGG + Intergenic
1189772348 X:44438911-44438933 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
1190076294 X:47319660-47319682 ATACAAATAAAGCTGTGGCTGGG + Intergenic
1190102686 X:47534430-47534452 TAGAAAATATAGTTGAGGCTGGG + Intergenic
1190235783 X:48614417-48614439 AAAAAAATACAGTTGAGGCCAGG - Intergenic
1190288867 X:48978596-48978618 CAGAAAAAAGAGCTGAGGCTGGG + Intronic
1190310108 X:49111175-49111197 TAGAAAAGAGAGCTGAGGCTGGG + Intergenic
1190721680 X:53153985-53154007 ATGAAGATATACCTGAGACTGGG + Intergenic
1190791271 X:53702841-53702863 TTGAAAATTTAGCTGAGGCCAGG + Intergenic
1192070791 X:67939200-67939222 ATGACAAAACACCTGAGACTGGG + Intergenic
1192173790 X:68873518-68873540 ATGAAATAAAAACTGAGGCTAGG + Intergenic
1192182661 X:68926118-68926140 ATGTCAATAGTGCTGAGGCTGGG + Intergenic
1192484871 X:71516365-71516387 ATTCAAAAACAGCTCAGGCTGGG - Intronic
1192566805 X:72171244-72171266 ATCAAAAGAAAGCTGGGGCTGGG + Intergenic
1193564237 X:83057540-83057562 ATCAAAATATAATTGAGGCTGGG - Intergenic
1193611318 X:83634850-83634872 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1193818256 X:86128822-86128844 TTGAAAATTATGCTGAGGCTGGG - Intergenic
1193944330 X:87713959-87713981 ATGAAAGAATACCTGAGGCTGGG - Intergenic
1194057054 X:89148482-89148504 ATGAAATAATACCTGAGGCTGGG - Intergenic
1194092689 X:89599110-89599132 ATGAAGAAACATCTGAGACTGGG + Intergenic
1194475217 X:94349752-94349774 AAGAAAATAAAGCTTATGCTAGG - Intergenic
1194500693 X:94677510-94677532 ATGAAAAAATAGCTGATACTGGG + Intergenic
1194528400 X:95010731-95010753 ATAAAGGTACACCTGAGGCTGGG - Intergenic
1194687525 X:96940960-96940982 AGGAAAACACAGCTGGGGCCAGG - Intronic
1195024803 X:100865923-100865945 ATGGAAAGATATCTGAGGCTGGG + Intronic
1195458661 X:105099249-105099271 ATTAAAAAATAGCTGAGGCTGGG + Intronic
1196616771 X:117775390-117775412 ATGAAGAAATAGCTGAGACTGGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1196837669 X:119828374-119828396 TTGAAAATCCATATGAGGCTGGG + Intergenic
1196928341 X:120656265-120656287 ATAAAATCACAGCAGAGGCTGGG - Intergenic
1197350884 X:125382021-125382043 ATAAAAAAATACCTGAGGCTTGG + Intergenic
1197835172 X:130686514-130686536 ATAAAGAAACACCTGAGGCTGGG - Intronic
1198471388 X:136950104-136950126 AAGAAATTACAGCTAAGGCCGGG - Intergenic
1198516663 X:137415531-137415553 ATGAAGAAATACCTGAGGCTGGG + Intergenic
1198611566 X:138407123-138407145 ATAAAGAAACACCTGAGGCTGGG + Intergenic
1198996257 X:142577493-142577515 ATGAAGACATACCTGAGGCTGGG - Intergenic
1199035289 X:143043199-143043221 GTAAAACTTCAGCTGAGGCTGGG + Intergenic
1199170784 X:144732584-144732606 ATGAAAAGATACCTGAGACTTGG + Intergenic
1199355099 X:146853308-146853330 ATAAAGAAATAGCTGAGGCTGGG - Intergenic
1199485340 X:148340559-148340581 ATAAAAATATACCTGAGACTGGG - Intergenic
1199795002 X:151186072-151186094 ATGAAGAAATACCTGAGGCTGGG + Intergenic
1200445335 Y:3255214-3255236 ATGAAGAAACATCTGAGACTGGG + Intergenic
1201099688 Y:10662068-10662090 ATGAAATGAGAGCTGAGACTGGG - Intergenic
1201708202 Y:16959829-16959851 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1201748436 Y:17405782-17405804 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1201970700 Y:19790936-19790958 ATAAAAGAACACCTGAGGCTGGG - Intergenic