ID: 1027496681

View in Genome Browser
Species Human (GRCh38)
Location 7:78895903-78895925
Sequence CATGATGGATTATAAGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027496679_1027496681 -5 Left 1027496679 7:78895885-78895907 CCTTCTAAAATATATACGCATGA 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1027496681 7:78895903-78895925 CATGATGGATTATAAGTAAGTGG 0: 1
1: 0
2: 2
3: 12
4: 141
1027496678_1027496681 -4 Left 1027496678 7:78895884-78895906 CCCTTCTAAAATATATACGCATG 0: 1
1: 1
2: 1
3: 16
4: 246
Right 1027496681 7:78895903-78895925 CATGATGGATTATAAGTAAGTGG 0: 1
1: 0
2: 2
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027496681 Original CRISPR CATGATGGATTATAAGTAAG TGG Intronic
909857978 1:80564166-80564188 AATTATGTATTATAAGTAAATGG + Intergenic
909911659 1:81265864-81265886 TATAATGGATTATGAGCAAGGGG + Intergenic
910081151 1:83343148-83343170 CCTGAGGGATTATACCTAAGGGG + Intergenic
910125701 1:83839483-83839505 CAAGATCGATTATTTGTAAGTGG + Intergenic
910665683 1:89723858-89723880 CATCATGGAGCATAAGTAAGAGG - Intronic
911772387 1:101762820-101762842 GATGATGAGTTATAAGAAAGAGG - Intergenic
916040955 1:160961018-160961040 GATGATGAATTGTAAGTAGGTGG - Intergenic
918552506 1:185759397-185759419 CATGAAGGGTCATAAGTAAAGGG + Intronic
921442184 1:215200554-215200576 ATTGAAGGATTTTAAGTAAGTGG + Intronic
1065555394 10:26910511-26910533 CAAAATGGATTTTAAGAAAGTGG - Intergenic
1066976220 10:42370110-42370132 TATGATGAAAAATAAGTAAGAGG - Intergenic
1068566506 10:58581705-58581727 CATACTGTATTATAAATAAGAGG + Intronic
1068606460 10:59010295-59010317 CATGATGGATTTTCAGTACCTGG + Intergenic
1070515257 10:77199566-77199588 CATGATGGATGCTATGTCAGTGG + Intronic
1071042502 10:81330674-81330696 CATGATGTATTTTAAGGAATAGG - Intergenic
1074061355 10:109969013-109969035 CTTGAAGGATTATCAGTATGTGG + Intergenic
1074829298 10:117237550-117237572 CATGAGGGTTTATAAGGGAGGGG + Intergenic
1078128504 11:8592792-8592814 CATGATGGATTTTGAGCTAGAGG + Intronic
1086733218 11:90274182-90274204 AATGAGTGATTTTAAGTAAGTGG - Intergenic
1091061523 11:132467481-132467503 CAAGGTGGAATATAATTAAGGGG - Intronic
1091096192 11:132824548-132824570 GAAGATGGATTGAAAGTAAGTGG - Intronic
1092122629 12:6055259-6055281 AATGATGCATTATCAGTATGTGG - Intronic
1093239333 12:16649795-16649817 CAAGATGCATTAAAAGTAAAGGG + Intergenic
1093733526 12:22592772-22592794 GATTGTGGTTTATAAGTAAGAGG + Intergenic
1095718001 12:45369592-45369614 CATGAAAGAATATAAGTAAGGGG + Intronic
1096613145 12:52816144-52816166 CAAGATGGCCTCTAAGTAAGTGG + Intergenic
1098007600 12:66015062-66015084 AATGATGGATTAGAAGGAATAGG + Intergenic
1098146906 12:67506705-67506727 CATGAGGGTTGATAAGGAAGTGG + Intergenic
1099756166 12:86852322-86852344 CATGATGGAATATAAACAAGTGG - Intergenic
1102483292 12:113238790-113238812 CATGATGGATTGTGAGAAAATGG + Intronic
1102552647 12:113702880-113702902 AAAGATGGATTATAATTCAGAGG - Intergenic
1102888925 12:116543050-116543072 CAGGGTGGATAATTAGTAAGAGG - Intergenic
1103129051 12:118450975-118450997 AATGATGGATTTTAAGCAGGAGG - Intergenic
1103256263 12:119543969-119543991 TGTGATGGATTATAAGTAAGGGG + Intergenic
1107009820 13:35658314-35658336 CAGGATGGATTCTATGGAAGTGG - Intronic
1107138272 13:36969072-36969094 CAAGATGAATTATAAATATGTGG + Intronic
1109621126 13:64906752-64906774 CTTTATGTATTAAAAGTAAGTGG + Intergenic
1110898705 13:80792183-80792205 CATCATGTATTATAAGGAATTGG - Intergenic
1111860428 13:93697834-93697856 GTTGATGGATTATAAGAAAAGGG - Intronic
1113061287 13:106324813-106324835 CATGATGCATTTCAGGTAAGTGG - Intergenic
1117613589 14:57509106-57509128 AATGATGGATTGTATATAAGAGG - Intergenic
1120853470 14:89191814-89191836 CATTATGGAATGTAAGTAACAGG - Intronic
1120895839 14:89531322-89531344 CATGATGCTTTATAGGAAAGTGG + Intronic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1124996374 15:34727024-34727046 CATGATTTATTATAAGGAATTGG + Intergenic
1125460641 15:39903728-39903750 CATCATGAATTTTAAGTAGGGGG + Intronic
1129308609 15:74687810-74687832 TATGATGGATTATAAATGATAGG - Intronic
1131087886 15:89592570-89592592 CATGTTGGATTCTTAGTAATCGG - Intronic
1131222421 15:90596056-90596078 CTTGAAGGATAAGAAGTAAGAGG + Intronic
1133576813 16:7099498-7099520 CTTGTTGGTTTATAAGTAATAGG - Intronic
1138913176 16:61428125-61428147 AATGATAGAATATAAGCAAGTGG + Intergenic
1144357364 17:14458986-14459008 GATGAGGGATGATAAGTGAGAGG + Intergenic
1148426350 17:47600518-47600540 CAATGTGGATTATAGGTAAGAGG - Intronic
1151561435 17:74872008-74872030 AATGATGGACTATGAGTAAGTGG + Intronic
1167930745 19:52862203-52862225 CCTGATGGATGGTGAGTAAGTGG + Intergenic
929910445 2:46085179-46085201 CATCATGGATTGCAGGTAAGAGG + Intronic
930298342 2:49583270-49583292 CATGATGGATGATAATAAAGGGG + Intergenic
932130177 2:69180388-69180410 ATGGATGGATTATAAGGAAGTGG - Intronic
933048850 2:77576026-77576048 AATCATGGAGTATAAGTAAATGG + Intronic
934742292 2:96733155-96733177 ACTGATGGATTAAAAGTCAGGGG + Intronic
939520923 2:143229623-143229645 CCTGATGGATGATAAGGAAAGGG + Intronic
940034135 2:149295526-149295548 CATGCTGGGTTATAAGTGAGTGG + Intergenic
940084597 2:149844746-149844768 CATGAAGGATTAAAAGACAGAGG + Intergenic
940218342 2:151324041-151324063 CATGTTGTATAATCAGTAAGTGG + Intergenic
940666789 2:156618618-156618640 CATGATGGGTTAGAAATGAGAGG - Intergenic
1169852753 20:10070407-10070429 CATGGTGGGTTATAAGCAACTGG + Intergenic
1177625080 21:23648671-23648693 CATGATGGATTTGAAGGATGAGG - Intergenic
1179414571 21:41187879-41187901 CCTGATGGATTACATGGAAGTGG - Intronic
949212128 3:1515491-1515513 CAAAATGGATTGTAATTAAGGGG - Intergenic
952050692 3:29380907-29380929 CATGATGGATTGGAGATAAGTGG + Intronic
958159371 3:89797410-89797432 TATGATTTATTATAAGTAATTGG + Intergenic
961054107 3:123773218-123773240 CATTATGGATATTAAGTAACTGG - Intronic
963218708 3:142781513-142781535 CACAATGAATTATAAATAAGAGG - Intronic
967290311 3:187913379-187913401 CATGGAGGCTTATAAGCAAGTGG + Intergenic
967388933 3:188936655-188936677 CATGATGGATTATTAATGATGGG + Intergenic
970050412 4:11907873-11907895 GATGATAGATGATAAGGAAGAGG - Intergenic
972982654 4:44724887-44724909 GATTATGGATTATATTTAAGTGG - Intronic
974413073 4:61566991-61567013 CATGTTGTATGATAAGGAAGTGG + Intronic
977033308 4:91916276-91916298 TATGTTGGATGAAAAGTAAGTGG - Intergenic
977082571 4:92550720-92550742 CATGATGGGTCATAACTATGAGG + Intronic
977552459 4:98456926-98456948 CATGATGGTTTAAAAGTGTGTGG - Intergenic
977807090 4:101313740-101313762 CATGATTTATTATAAGCAAATGG + Intronic
978516208 4:109571041-109571063 CATGATGGATGAAAAGGAAAAGG + Intronic
978660037 4:111114838-111114860 AATGTTTGGTTATAAGTAAGAGG + Intergenic
979150312 4:117304880-117304902 CAGGATGGGTTAAAAATAAGTGG + Intergenic
980561973 4:134489784-134489806 CATTATGATTTATAAGTAATGGG + Intergenic
980579170 4:134727457-134727479 CATGATGGAGTCAAAGGAAGAGG + Intergenic
981544511 4:145880479-145880501 CCTGGAGGATTATACGTAAGTGG - Intronic
981544516 4:145880504-145880526 CAGGTAGGACTATAAGTAAGTGG - Intronic
982004904 4:151054122-151054144 CATTCTGGATGATAAGTGAGGGG - Intergenic
982544770 4:156720748-156720770 CATGGAGTAATATAAGTAAGGGG + Intergenic
983545128 4:168955276-168955298 TATGATAAATTATAAATAAGGGG + Intronic
984289494 4:177777209-177777231 CTTGATGAAATATGAGTAAGAGG + Intronic
984359724 4:178712691-178712713 CATGATTGTTTATATTTAAGTGG + Intergenic
984496659 4:180506468-180506490 TAAGATGGCTTGTAAGTAAGAGG - Intergenic
984727391 4:183034860-183034882 CATTAGGTATTATAAGTAAATGG + Intergenic
989087199 5:37688578-37688600 CTTGATGGGATATAAGGAAGTGG + Intronic
990298689 5:54429015-54429037 CATGAAGGATTAGAAGTATATGG - Intergenic
991212754 5:64125084-64125106 CAGGATGAATTAAAGGTAAGAGG + Intergenic
992706191 5:79395644-79395666 CATGAAGGATTATTATGAAGGGG + Intronic
995131671 5:108637004-108637026 AATGATCGTTTATAAGTGAGAGG - Intergenic
996459333 5:123723670-123723692 GATGATGGATAACAAATAAGTGG + Intergenic
996610906 5:125379104-125379126 CATAATGGGTTATAAATAATGGG - Intergenic
996940960 5:129005013-129005035 CATGATGGATGGAAAGTTAGCGG - Intronic
1001478782 5:172071676-172071698 CATGATGGTTCCTAAGTAGGTGG - Intronic
1003369389 6:5509902-5509924 CATAATGTATTTTGAGTAAGAGG - Intronic
1003934129 6:10957981-10958003 CATTTGGGATTATAAGTAACAGG - Intronic
1005260560 6:24054724-24054746 GATGACGGATTATAAAAAAGAGG - Intergenic
1006252265 6:32797700-32797722 CTTGATGGATTGTAAGTGAGAGG - Intergenic
1007026160 6:38576894-38576916 AATGATGGATTATACCTAAAGGG + Intronic
1008265604 6:49421954-49421976 CAAAATGGATTGAAAGTAAGGGG + Intergenic
1008557720 6:52690955-52690977 CATGATGGTTAATAAGGAAAAGG + Intergenic
1010486606 6:76421920-76421942 CATGATTTTTTATAAGCAAGGGG - Intergenic
1012360846 6:98377561-98377583 CATTATGGATTATTAGCAAAAGG - Intergenic
1013280530 6:108632283-108632305 CATGACAGAGGATAAGTAAGGGG + Intronic
1014043090 6:116851676-116851698 TATGATGGTTTAAAAGTATGTGG + Intergenic
1015088275 6:129323135-129323157 CAAGATGAATTATAAATAAGAGG - Intronic
1016708722 6:147144419-147144441 CATGATGGACGATAGGCAAGGGG + Intergenic
1018577793 6:165277540-165277562 GATAATGCATTATAAGAAAGAGG - Intergenic
1018581522 6:165312061-165312083 CTTGATAGCATATAAGTAAGGGG - Intergenic
1018657929 6:166057767-166057789 CATGAGGGAATATGAGGAAGTGG - Intergenic
1021502480 7:21346086-21346108 AATATTGGATTATAAGTCAGGGG + Intergenic
1021597279 7:22330706-22330728 CATGATGGAATCTAAATACGGGG - Intronic
1026319640 7:69257625-69257647 GATGACGGATGATAGGTAAGTGG + Intergenic
1027298624 7:76805403-76805425 CCTGAGGGATTATACCTAAGGGG + Intergenic
1027496681 7:78895903-78895925 CATGATGGATTATAAGTAAGTGG + Intronic
1028031215 7:85916141-85916163 CATGGTTGATTATAAGTAAGAGG - Intergenic
1029811850 7:103057251-103057273 TATGATGGATTTTTAGAAAGAGG - Intronic
1029847171 7:103424249-103424271 CATAAAGGATTATAAGTGAGGGG - Intronic
1031241494 7:119247997-119248019 GATGAGAGATTATCAGTAAGTGG + Intergenic
1031474224 7:122203699-122203721 CATGTTGGCTTAAAGGTAAGAGG + Intergenic
1038808312 8:30814182-30814204 CCTGATGGTTTACAGGTAAGGGG - Intronic
1039174622 8:34789662-34789684 AATGTTGGATTTCAAGTAAGAGG + Intergenic
1041533698 8:58901775-58901797 CAGGATGGTTTATAAATATGTGG + Intronic
1042381015 8:68114280-68114302 CATTATGGAATATGCGTAAGAGG + Intronic
1043187641 8:77174677-77174699 CAAGATGGTTTATAAGAAATAGG - Intergenic
1043461623 8:80466211-80466233 AATGATGGAGAAAAAGTAAGTGG - Intergenic
1043524203 8:81078949-81078971 CAAGATGGAAGATAAGGAAGTGG - Intronic
1046926657 8:119798050-119798072 CACGGTGGATTATAAGTCTGTGG + Intronic
1048064985 8:130958224-130958246 AATGATGCTTTATAAGCAAGTGG + Intronic
1048277585 8:133078492-133078514 CTTGATGGATTAGAAGAAAAAGG - Intronic
1050619537 9:7438270-7438292 CATTATGAATTATGGGTAAGGGG + Intergenic
1056021481 9:82442390-82442412 CAAGATAGAATTTAAGTAAGAGG + Intergenic
1056102275 9:83311399-83311421 CATGATGGCTTACAAATAAGAGG - Intronic
1057351721 9:94304327-94304349 CAGGAGGGACTATAACTAAGGGG - Intergenic
1062274429 9:135724066-135724088 CATGATGGATAAAAATTCAGAGG - Intronic
1185855713 X:3533052-3533074 CATGATGATTTATAAGGAGGTGG - Intergenic
1187617818 X:21017055-21017077 CATGATGGATCACATGGAAGTGG + Intergenic
1190463657 X:50704553-50704575 CATAATGGATTATAAATAAATGG - Intronic
1190599142 X:52071384-52071406 CATGATGGATTAACAGGAACCGG - Intergenic
1190609682 X:52182689-52182711 CATGATGGATTAACAGGAACCGG + Intergenic
1192862399 X:75089867-75089889 CATAATGAATTATATGTAAACGG + Intronic
1193441883 X:81551487-81551509 CCTGATGGTTTAAAAGTATGTGG - Intergenic
1196577421 X:117335671-117335693 GATCATGGAGTATAAGTAAGTGG - Intergenic
1199504150 X:148542805-148542827 CAGAATGGATTAAAAGGAAGGGG + Intronic
1201724497 Y:17137915-17137937 CATGATGGAAAATAAATTAGAGG + Intergenic