ID: 1027499582

View in Genome Browser
Species Human (GRCh38)
Location 7:78932058-78932080
Sequence CAGCCAAAGGAGGCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 670}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027499582_1027499588 16 Left 1027499582 7:78932058-78932080 CCCCTCCTGGCCTCCTTTGGCTG 0: 1
1: 0
2: 7
3: 61
4: 670
Right 1027499588 7:78932097-78932119 TGTATGCCCAAATTCCCCCATGG 0: 1
1: 0
2: 0
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027499582 Original CRISPR CAGCCAAAGGAGGCCAGGAG GGG (reversed) Intronic
900534817 1:3171644-3171666 CAGCCCGAGGAGGGCAGGACAGG - Intronic
900666265 1:3817528-3817550 CAGCTAAAGCGGGACAGGAGTGG - Intronic
900757916 1:4450139-4450161 GAGCCAGGGAAGGCCAGGAGGGG + Intergenic
901344617 1:8528930-8528952 CTGTCACAGGAGGTCAGGAGTGG + Intronic
901575713 1:10199140-10199162 CAGGCACTGGAGGCCAGGAATGG - Intergenic
901815559 1:11791493-11791515 CAGGCAGAGGAGGCCAGGAGCGG - Intronic
902362832 1:15951425-15951447 CAGCTCGAGGGGGCCAGGAGGGG + Intronic
902420497 1:16275716-16275738 AGGACAAAGGAGGCCAGGAGTGG + Intronic
902444893 1:16456313-16456335 CATCCAAATCAGGCCAGGCGCGG - Intronic
902771164 1:18646471-18646493 CTGCCTGGGGAGGCCAGGAGCGG - Intronic
902863712 1:19263597-19263619 CAGCCTTAGGAGGCCAAGATAGG - Intergenic
903253056 1:22070752-22070774 GAGGCAAAGAAGGCCAGGCGTGG - Intronic
904334559 1:29788170-29788192 CAGCCACGGGAGGCCAGGGAGGG - Intergenic
904403594 1:30272612-30272634 TAGCAGCAGGAGGCCAGGAGAGG - Intergenic
905256275 1:36687524-36687546 CAGCCACCGGGGGCCGGGAGAGG + Intergenic
905517067 1:38569781-38569803 CAGGGAAAGGAGGCCAGGCTTGG - Intergenic
905754513 1:40497631-40497653 AAGACAAAGGAGGCCAGGCGTGG - Intergenic
905774518 1:40660056-40660078 GAGCCAATGGTGGCCTGGAGGGG + Intronic
905809137 1:40899241-40899263 CAGCCAAGGGAGGCAAGAGGTGG - Intergenic
905997919 1:42397918-42397940 CAGCCATAGGATGTCAGGACTGG + Intronic
906343117 1:44998158-44998180 CAGCTAAAAGAGGCCAGGCATGG + Intergenic
906609145 1:47190140-47190162 CAGCCAGGGGAGGCCAGGTCTGG - Intronic
906749611 1:48247294-48247316 AAGACAAAGGAGAGCAGGAGGGG - Intronic
906792810 1:48673735-48673757 CAGCCAAGGAAGGCAAGGAAGGG + Intronic
906845822 1:49190691-49190713 CAGTGAAAGGAGGCTGGGAGAGG - Intronic
907526568 1:55057284-55057306 CAGAGAAAGGAGCCCAAGAGAGG - Intronic
908153163 1:61325626-61325648 CTGCCAAAGAAGGCTAGGCGTGG + Intronic
909120751 1:71600522-71600544 CAGCCAAAGGCAGCCAGGAATGG + Intronic
910042864 1:82874388-82874410 CAAGCAAATGAGGCCAGAAGAGG + Intergenic
910297828 1:85669232-85669254 AAGCCAAAAGAGGTCAGGTGGGG + Intronic
911419029 1:97615930-97615952 CAGGCAAAGGAGGGAAGGAAGGG - Intronic
912357168 1:109063865-109063887 CAGCTATAGTAGGCCAGGCGCGG + Intronic
913121882 1:115749857-115749879 CAGCCAACGGTGGCCAGGACTGG - Intronic
913240676 1:116826788-116826810 TAGTCAAAGGAGGCTAGGATAGG - Intergenic
913719285 1:121575162-121575184 CAGGCAAAGAAGGTCTGGAGTGG + Intergenic
914429502 1:147608021-147608043 CAGATAAAGAAGGCCTGGAGAGG + Intronic
914807967 1:151005579-151005601 GAGCCAAAGGAACCCAGGAGTGG + Intronic
914958611 1:152186917-152186939 GAGTGAAAAGAGGCCAGGAGTGG + Intergenic
915607210 1:156960102-156960124 AAGCCAACGGAGGCCCAGAGAGG + Intronic
916005133 1:160653211-160653233 CAGACACGGGAGGCCAGGATGGG - Intergenic
916315519 1:163444058-163444080 AAGCCCAAGGAGGCCAGAAGAGG - Intergenic
916540185 1:165745989-165746011 CAAAAAAAGAAGGCCAGGAGCGG + Intronic
917019473 1:170570024-170570046 CAGGCAAACGGGGTCAGGAGTGG + Intergenic
917392673 1:174556284-174556306 AAGTCAAAAGAGGCCAGGAGTGG - Intronic
917757023 1:178112017-178112039 TTGACAAAAGAGGCCAGGAGCGG - Intronic
919478983 1:198063239-198063261 GAGCCAAAGCAGGCCATCAGAGG - Intergenic
919765931 1:201127352-201127374 CAATCACAGGAGGCCAGGAGTGG - Intergenic
919910994 1:202110696-202110718 CAGACACAGGGGGCCAGGCGCGG - Intergenic
920457636 1:206113252-206113274 GAGGCAACGGAGGCCAGGACTGG - Intronic
921409318 1:214818009-214818031 CTGCCTTAGGAGACCAGGAGGGG + Intergenic
921527939 1:216241465-216241487 AAGAGAAAGGAGACCAGGAGGGG - Intronic
921626120 1:217379583-217379605 TAGCCAAAGGAAGCCCTGAGGGG + Intergenic
921796611 1:219352238-219352260 CATCCACAGGGGGCCAGGCGCGG + Intergenic
922961320 1:229648088-229648110 CAGTCACATGAGGTCAGGAGTGG - Intronic
923115173 1:230929602-230929624 TAGCCAAACTAGGCCAGGCGCGG - Intronic
923118843 1:230971053-230971075 CAACCACAGGTGGCCAGGCGCGG + Intronic
923158494 1:231298473-231298495 CAGTCACAGGAGGACACGAGGGG - Intergenic
923603114 1:235420769-235420791 TAGCCAGACGAGGCCAGGCGTGG - Intronic
923659271 1:235944551-235944573 GAGCAAAAGGAGGCCCGGAGAGG + Intergenic
923707160 1:236353250-236353272 CAGATAAGGGAGACCAGGAGGGG - Intronic
924288799 1:242515501-242515523 CAGGCAAAGCTGGCCAGGCGTGG - Intronic
1062828396 10:588292-588314 CAGCCACAGGAGGGCAGGGAAGG + Intronic
1063197199 10:3754437-3754459 GAGCAAACTGAGGCCAGGAGAGG - Intergenic
1063366312 10:5493094-5493116 CAGGCACAGGGGGACAGGAGAGG - Intergenic
1064078353 10:12288144-12288166 GAACCTAAGTAGGCCAGGAGCGG + Intergenic
1064158517 10:12923525-12923547 GAGCCATAGGAGGCCAGAGGTGG - Intronic
1064864795 10:19867353-19867375 GAGGGAACGGAGGCCAGGAGTGG - Intronic
1064985100 10:21201985-21202007 TACCCAAAGGATGCCAAGAGAGG - Intergenic
1065298946 10:24303304-24303326 CCTCCAATGGAGGCCAGGTGTGG - Intronic
1065650248 10:27881355-27881377 AACCCAAAGAAGGCCAGGAGTGG + Intronic
1065892278 10:30131619-30131641 GAGCCAAAAGAGGCCAGGCGCGG - Intergenic
1066543930 10:36478681-36478703 AAGCTGAATGAGGCCAGGAGCGG - Intergenic
1066627803 10:37427138-37427160 AAAACAAAGGAGGCCAGGCGCGG - Intergenic
1067217492 10:44315291-44315313 CAGCCTCAGGATGCCTGGAGTGG + Intergenic
1067345946 10:45439407-45439429 CAGCCAAGAGCGGCCAGGAAGGG - Intronic
1067814028 10:49457959-49457981 CAGACAAGAGAGGCCTGGAGTGG + Exonic
1068357010 10:55922798-55922820 CAGGCAAAGAGGGTCAGGAGTGG - Intergenic
1068392009 10:56409646-56409668 GAACCAAAGGAGGGGAGGAGAGG - Intergenic
1069270752 10:66524408-66524430 CAGCCACAGGAGGGCAGGTTTGG + Intronic
1069416888 10:68208616-68208638 CAGCCACTGGAGGGCAGGATTGG - Intronic
1069575069 10:69521217-69521239 AAGGCAGAGGAGGCCAGGTGTGG + Intergenic
1069695481 10:70382519-70382541 GAGCCAAAAGCGGCCCGGAGCGG - Intronic
1070412291 10:76153127-76153149 TAGCCAAAAAAGGCCAGGCGTGG - Intronic
1071068680 10:81667117-81667139 AGGTCAAATGAGGCCAGGAGTGG + Intergenic
1072119525 10:92394275-92394297 AAGCACAAGGAGGCCAGGCGCGG - Intergenic
1072441998 10:95465236-95465258 AAGGCAAAAGAGGCCAGGCGTGG + Intronic
1072493598 10:95933672-95933694 CAGGCAAAGGGGGTCTGGAGTGG - Intronic
1073079962 10:100853497-100853519 CAGCCAACTGAGGCCCAGAGAGG + Intergenic
1073144434 10:101271262-101271284 GAGCCCCAGGAGGGCAGGAGGGG + Intergenic
1073372862 10:103006494-103006516 AATCTAAAGCAGGCCAGGAGTGG - Intronic
1073716536 10:106114608-106114630 CAGCCAAGGGAGGCAGTGAGAGG + Intergenic
1075028964 10:119008246-119008268 CCGCCAAAGGCAGCCAGGTGTGG - Intergenic
1075047811 10:119159798-119159820 CAGGCAGAGGGGGCCAGAAGGGG + Intronic
1075331050 10:121574236-121574258 AAGGCAATGGAGGCCAGGTGCGG + Intronic
1075463199 10:122632289-122632311 CTGCTATGGGAGGCCAGGAGGGG - Intronic
1075637152 10:124037031-124037053 CAGCCACCAGAAGCCAGGAGAGG - Intronic
1075869559 10:125759998-125760020 CAACCAAATAAGGCCAGGCGCGG - Intronic
1076150943 10:128161578-128161600 CAGGAAATGGAGGCCCGGAGAGG - Intergenic
1077088247 11:765405-765427 CAGCCACAACAGGACAGGAGGGG - Intergenic
1077170714 11:1164725-1164747 CAGCCTTAGGGGCCCAGGAGAGG - Intronic
1077170835 11:1165081-1165103 CAGCCTCAGGGGGCCAGGACAGG - Intronic
1078088618 11:8249810-8249832 CAGGTGAAGGAGGTCAGGAGAGG - Intronic
1079297983 11:19251597-19251619 CAGCCATCTTAGGCCAGGAGTGG - Intergenic
1079369430 11:19838029-19838051 CAGATAAAGGAGGGGAGGAGAGG + Intronic
1079410889 11:20186462-20186484 CAGCCAAAGGAGGCCAAGGTGGG + Intergenic
1079516259 11:21272782-21272804 CAGGCAAAGAGGGCCTGGAGGGG + Intronic
1080208583 11:29758305-29758327 CAGCCACCAGAAGCCAGGAGAGG - Intergenic
1080539900 11:33256147-33256169 GAGACAAAGGAGGCCGGGCGCGG - Intergenic
1080663448 11:34315571-34315593 CAGGCACTGGATGCCAGGAGAGG - Intronic
1081308799 11:41545558-41545580 CAGGCAAACGAGGTCTGGAGTGG + Intergenic
1081410243 11:42749256-42749278 AAGCCCAAGGAAGACAGGAGGGG + Intergenic
1081455406 11:43217334-43217356 CAGCCAAAGGAGACCAATATAGG + Intergenic
1081489037 11:43553237-43553259 CAGCCAATGGGGGCCCTGAGAGG - Intergenic
1081701121 11:45153424-45153446 CAGCCCTTGGAGGCCAGTAGTGG - Intronic
1081737911 11:45417231-45417253 AAGAGAAAGGAGGCCAGGCGCGG + Intergenic
1081770693 11:45649145-45649167 CAGGCAAGGGCGGGCAGGAGGGG + Exonic
1082002552 11:47401057-47401079 CAGCCAGAGCTGGCAAGGAGGGG + Intergenic
1082681235 11:56173373-56173395 TAGCAAAAGAAGGCCAGGAGCGG - Intergenic
1083464106 11:62833847-62833869 AAGCCACAGGAGGCTAGTAGAGG + Exonic
1083631143 11:64096124-64096146 CAGACCCTGGAGGCCAGGAGGGG + Intronic
1083683782 11:64363780-64363802 AAGCAGAAGGAGGCCAGGCGTGG - Intronic
1084329620 11:68422918-68422940 CAACGGAAGGAGGCCAGGTGAGG - Intronic
1084490354 11:69475130-69475152 CAGCCAGAGGTGGCCAGGGAGGG + Intergenic
1084689202 11:70715323-70715345 CAGGCAAAGGAGCCCAGTGGCGG - Intronic
1085179605 11:74522281-74522303 CAGCTTGAGGAGGCCAGGAGAGG + Intronic
1085335583 11:75691509-75691531 AAGAAAAAGGAGGCCAGGCGTGG - Intergenic
1085368770 11:75979138-75979160 CAGGCAAACGGGGCCTGGAGTGG - Intronic
1085437617 11:76522649-76522671 AAGACAAAGTAGGCCAGGCGTGG - Intronic
1088017006 11:105072934-105072956 AAGCCAGAGAAGGCCAGAAGAGG + Intronic
1088019556 11:105102836-105102858 AAGCCAGAGAAGGCCAGAAGAGG + Intergenic
1088515487 11:110628223-110628245 GAGCCATAGGAGACAAGGAGGGG - Intronic
1088534851 11:110849584-110849606 CAGGCAAATAGGGCCAGGAGTGG - Intergenic
1089112623 11:116068746-116068768 CAGTCAAAGCAGGCCAGGCCAGG + Intergenic
1089284240 11:117395444-117395466 AAGCCAAAGGAGGACAGGCTGGG - Intronic
1089372770 11:117973018-117973040 CAGCCCAAGGCAGCCAGGGGTGG - Intergenic
1089603029 11:119626732-119626754 CAGACAGGGAAGGCCAGGAGGGG + Intronic
1089660384 11:119981703-119981725 CCACCAAAGGAGGCCTGGTGGGG - Intergenic
1090507825 11:127338370-127338392 CAGGCAAAGGAGGCTATTAGTGG + Intergenic
1090566982 11:128005678-128005700 AAACCAAAGGATGCCATGAGAGG - Intergenic
1091121870 11:133064172-133064194 CAGCCGAGGGAGGGAAGGAGAGG + Intronic
1091239079 11:134040474-134040496 CAACCCAAGGAGCCAAGGAGGGG + Intergenic
1091880331 12:3972121-3972143 AAGACAAAGGAGGCCGGGCGTGG - Intergenic
1091974925 12:4816861-4816883 AAGGCAAAGCAGGCCAAGAGGGG - Intronic
1092615319 12:10211502-10211524 CACCCACAGGGGGCCAGGCGCGG - Intergenic
1095173395 12:39061198-39061220 CTGAAAAAGGAGGCCAGGTGCGG - Intergenic
1095247077 12:39935657-39935679 GTGCTAAAGGAGGCCAGAAGGGG + Intronic
1096105760 12:48996397-48996419 CAGCCATAGGAGGGCAGGGTAGG - Exonic
1096198669 12:49665579-49665601 CAGGCAGAGGACCCCAGGAGAGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096768329 12:53913242-53913264 AAGCAAAAGCAGGCCAGGCGCGG - Intergenic
1096829701 12:54304569-54304591 CAGCCACAGGGGGCAAGGGGAGG + Intronic
1097157278 12:57022224-57022246 CAGCAACAGGAGGACAGGAGAGG - Intronic
1097180990 12:57171829-57171851 CTGACTCAGGAGGCCAGGAGAGG - Intronic
1097848403 12:64389184-64389206 CAGACAAAGGGAGCCAGGCGGGG + Intronic
1097864753 12:64550666-64550688 AAGAAAAAGGAGGCCAGGAGTGG + Intergenic
1098476354 12:70908712-70908734 CAGGCAAGGGAGACCAGGACAGG - Intronic
1098907589 12:76178088-76178110 CTGGCAAAGGAGGCCAGGCAGGG + Intergenic
1099464812 12:82970621-82970643 AAGCCTAAGGAGGCCGGGCGCGG - Intronic
1100565245 12:95789523-95789545 CAGCCCAAGAAAGCCAGGATGGG + Intronic
1101427351 12:104598996-104599018 CAGCTAAGGGAGGCGCGGAGGGG + Intronic
1101601157 12:106211746-106211768 CAGGCAAACAGGGCCAGGAGTGG - Intergenic
1101619872 12:106374804-106374826 CATGCCAAGGAGGCCAGGTGCGG - Intronic
1101925610 12:108969073-108969095 TAATCAAAGGAGGCCAGGAGTGG - Intronic
1101991861 12:109492449-109492471 AAGCCAAAAGAGGCCAGGCACGG + Intronic
1102072906 12:110036457-110036479 TAGAAAAAGTAGGCCAGGAGCGG + Intronic
1102556745 12:113731739-113731761 GAGCCAGAGGATGCTAGGAGGGG - Intergenic
1103796467 12:123506442-123506464 CAGGCAGAGGAGACCAGGAAGGG + Intronic
1103931313 12:124452595-124452617 CAGCCGAAGGGGGCCAGAAAGGG + Intronic
1104971826 12:132534227-132534249 CAGCCCATGGAGGCCAGGACTGG - Intronic
1105272933 13:18894694-18894716 CAGGCAAAGGAGGCCACTACAGG - Intergenic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1106504005 13:30355684-30355706 GGGAGAAAGGAGGCCAGGAGAGG - Intergenic
1106996991 13:35496342-35496364 AAGCCAAACAAGGCCAGGTGTGG + Intronic
1107390075 13:39954544-39954566 CAGCCACAGGAGCTTAGGAGAGG + Intergenic
1107882197 13:44842784-44842806 AAGCCAGAAGAGACCAGGAGTGG + Intergenic
1108048709 13:46408358-46408380 CAGGCAAAGGGGGTCTGGAGTGG - Intronic
1108247625 13:48533221-48533243 CAGCCTAGGGAGGAGAGGAGGGG - Exonic
1108547914 13:51514962-51514984 GAGGCAAACGAGGCCTGGAGTGG - Intergenic
1109541242 13:63781703-63781725 CAGGCAAAGGGGGTCTGGAGTGG - Intergenic
1110536090 13:76652351-76652373 CAAACAAAAGAGGCCAGGCGAGG - Intergenic
1111400870 13:87733196-87733218 AACCCAATGGAAGCCAGGAGAGG + Intergenic
1111700135 13:91676359-91676381 CAGCCAAAGGTGGCCGGGTGCGG - Intronic
1111800456 13:92974651-92974673 CAGCCAGAGCAGGACAGAAGAGG - Intergenic
1113017111 13:105840277-105840299 CAGCCAGAGGAGGGCCTGAGAGG + Intergenic
1113426347 13:110211401-110211423 CAGCGGAAGGAGGCCTGGTGTGG - Intronic
1114252282 14:20971569-20971591 CAGCCAGCAGAGGGCAGGAGCGG - Intergenic
1114499772 14:23160053-23160075 GAGAGGAAGGAGGCCAGGAGGGG + Intronic
1115020959 14:28681404-28681426 CAGCCATATCAGGTCAGGAGTGG - Intergenic
1115041448 14:28934412-28934434 TAACCAAAGGAGATCAGGAGTGG - Intergenic
1115204608 14:30888489-30888511 CTGCTAAATGAGGCCAGGTGTGG + Intronic
1115962031 14:38845895-38845917 AAGAGAAAGGCGGCCAGGAGCGG + Intergenic
1116676849 14:47917527-47917549 ATGCCACAGAAGGCCAGGAGAGG + Intergenic
1116909147 14:50439694-50439716 TTCCCAAAGGAGGCCAGGAGTGG + Intronic
1117252357 14:53950429-53950451 TGGCCAAAGGTGACCAGGAGGGG + Exonic
1118117115 14:62791599-62791621 TAGCCAAAAGAGAGCAGGAGTGG + Intronic
1118167914 14:63356339-63356361 AAACCAAAGGAGGCCAAGACGGG - Intergenic
1118206050 14:63724646-63724668 AAGGAAAAGGAGGCCAGGCGCGG + Intronic
1118541447 14:66831854-66831876 CAACCATATGAGGCCAGGTGTGG + Intronic
1119351910 14:73972940-73972962 CAGCCAGAGGAGGTCCAGAGAGG - Exonic
1120799219 14:88669953-88669975 CAGGCAAAGAAGGTCTGGAGTGG + Intronic
1120885655 14:89449914-89449936 GAGACAATGGGGGCCAGGAGTGG + Intronic
1121283297 14:92714841-92714863 GGGCCACAGGAGGCCTGGAGGGG - Intronic
1121322070 14:92997721-92997743 CAGCTAAAGGACACCAAGAGTGG + Intronic
1121699775 14:95943844-95943866 CATCCAGAGGATGCCAAGAGTGG - Intergenic
1121911597 14:97797007-97797029 CAGCAGAAGGAAGCCAGGAGAGG - Intergenic
1121946002 14:98122637-98122659 CAGCTATCTGAGGCCAGGAGAGG + Intergenic
1122236004 14:100330915-100330937 AAGCCACATGATGCCAGGAGGGG - Intergenic
1122384079 14:101332084-101332106 CAGCCAAAGGAAGCATGGTGTGG - Intergenic
1122506231 14:102233575-102233597 CAGCCAAAGGAGCTCCTGAGAGG + Intronic
1122593528 14:102872479-102872501 CAGCCACAGGGGGCGAGAAGGGG - Intronic
1122679321 14:103445494-103445516 CAGCCAAAGAATCCCAAGAGAGG - Intronic
1122882289 14:104695543-104695565 CAGGCAAGGGAGGACAGGAAGGG - Intronic
1123028428 14:105439436-105439458 GAGGCAGTGGAGGCCAGGAGTGG - Intronic
1123105564 14:105839643-105839665 CAGCCAAGGGAGGCATGGAAGGG - Intergenic
1123122716 14:105925494-105925516 CAGCCAATGTTGCCCAGGAGAGG - Intronic
1123405360 15:20016915-20016937 CAGCCAATGTTGCCCAGGAGAGG - Intergenic
1123514690 15:21023563-21023585 CAGCCAATGTTGCCCAGGAGAGG - Intergenic
1124514632 15:30356213-30356235 GACCAAAAGGAGGCCAGGTGTGG + Intergenic
1124728288 15:32174549-32174571 GACCAAAAGGAGGCCAGGTGTGG - Intergenic
1125015105 15:34925548-34925570 CACCAAAAGGAGGCCAGGAGCGG + Intronic
1125318790 15:38459672-38459694 CAGCCCAGGGAGGAAAGGAGAGG - Intronic
1125602120 15:40921175-40921197 AAGCCACAGGAGGAGAGGAGGGG + Intergenic
1125687009 15:41569478-41569500 CAAACAAATAAGGCCAGGAGTGG + Intronic
1125934735 15:43625409-43625431 CAGCTATAGGAAGTCAGGAGGGG + Intergenic
1125996371 15:44165126-44165148 CAACCAAAGTCGGCCAGGAGCGG + Intronic
1126137284 15:45403563-45403585 CAGCCAAATGGCGCCAGAAGCGG - Intronic
1126487830 15:49202293-49202315 CAGACACAAGAGGCCAGGTGTGG - Intronic
1126735658 15:51729746-51729768 ATACCAAAGGAGGCCAGGTGCGG - Intronic
1126872208 15:53001946-53001968 TAGCCAATGAAGGCCAGGTGCGG - Intergenic
1127424817 15:58845113-58845135 CATGCAAATGAGGCCAGGTGTGG + Intronic
1127509440 15:59625496-59625518 CATACAGAGGAGGCCAGTAGAGG + Intronic
1128008689 15:64270096-64270118 CAGCCATCAGAGGCCAGGTGTGG - Intronic
1128193634 15:65728777-65728799 TAGCCAAAGGGGGCCGGGCGCGG - Intronic
1128484967 15:68076072-68076094 AAGCCCTAGGTGGCCAGGAGCGG - Intronic
1128748798 15:70133823-70133845 CAGCCTAAGAAGGCCAGGAAAGG - Intergenic
1128752935 15:70161873-70161895 CAGGCAGGGTAGGCCAGGAGAGG - Intergenic
1129058920 15:72844703-72844725 TAGCCACATGAGGCCAGGCGTGG - Intergenic
1129144579 15:73634913-73634935 AAGCCAAAGGAGGACACGAACGG + Intergenic
1129387566 15:75204108-75204130 CAACCAGAAGAGGCAAGGAGAGG + Intronic
1129625265 15:77191350-77191372 CATCCAGCGGAGGCCAGGAAGGG + Intronic
1129727780 15:77910339-77910361 CAGCCAAGGGACACCAGGACTGG - Intergenic
1130041988 15:80413040-80413062 CACTGAAAGGAGGCCAGGAAAGG - Intronic
1130423464 15:83772142-83772164 GAGCCAAAGGAGGCCGGGCGTGG - Intronic
1130442016 15:83963857-83963879 CAGGCAAACCAGGCCTGGAGTGG + Intronic
1130540047 15:84816047-84816069 CAGTCAGCTGAGGCCAGGAGTGG + Intergenic
1130660462 15:85827817-85827839 CAGCCAAATAGGGCCAGGTGCGG - Intergenic
1130796900 15:87219159-87219181 AAGCCAGAAGAGGACAGGAGTGG - Intergenic
1131023242 15:89117720-89117742 CAGCCAAAAGAGGTGATGAGAGG - Intronic
1131088220 15:89596635-89596657 AAGCCAAATAAGGCCAGGCGCGG - Intronic
1131162787 15:90119060-90119082 AAGCAAAAGAAGGCCAGGCGTGG - Intergenic
1131189399 15:90301593-90301615 CAGCCAAGGGAGAGCAGGACTGG + Intronic
1131471259 15:92699341-92699363 CAGGCAAACGAGGTCTGGAGTGG - Intronic
1131587518 15:93712111-93712133 CAGCCAAAAGAAGCGAGAAGAGG - Intergenic
1132341834 15:101083765-101083787 AAGCCCAGGGAGCCCAGGAGAGG + Intergenic
1132710669 16:1265714-1265736 CAGCCAGGTGAGGCCAGGAGAGG + Intergenic
1132828203 16:1915238-1915260 AAGCAAGAGGAGGCAAGGAGCGG - Intronic
1132894025 16:2219279-2219301 GAGGCAAAGGGGGCCGGGAGCGG - Intergenic
1133905847 16:10021650-10021672 CAGCCAAGGGAGGGAATGAGGGG + Intronic
1134192033 16:12129219-12129241 CAAGGAAAGGATGCCAGGAGAGG - Intronic
1135747215 16:25027441-25027463 GATTCAAGGGAGGCCAGGAGTGG - Intergenic
1136468170 16:30459461-30459483 AAGCCACAAGAGGCCAGGAATGG + Intergenic
1137488969 16:48914793-48914815 CACCCAAAGGATCCCTGGAGAGG - Intergenic
1137907138 16:52334274-52334296 CAGGCAAACAAGGCCTGGAGTGG + Intergenic
1138153301 16:54679187-54679209 CAAACACAGGAGGCCAGTAGGGG + Intergenic
1138158692 16:54731781-54731803 GAGCAAAAGGAGGACTGGAGGGG - Intergenic
1138422274 16:56906942-56906964 CAGCCAAAGGAGTAAAGGGGCGG + Intronic
1138528388 16:57621657-57621679 GAGCCAAATGAGGCCCAGAGAGG - Intronic
1138651356 16:58463365-58463387 CGGCCACAGGGGGCCTGGAGGGG + Intronic
1138652793 16:58471319-58471341 CAGCCACAGGAAACCAGCAGGGG + Intronic
1139076207 16:63451994-63452016 CAATCACAGGAGGCCAGGTGTGG - Intergenic
1139367147 16:66440533-66440555 CTGCCAAAGGAGACCACGAATGG - Intronic
1139648827 16:68351549-68351571 CAGCCCAAGGCAGCCAGGACAGG - Intronic
1139701302 16:68709733-68709755 CAGAAAAAGGAGGCCAGGCGCGG - Intronic
1139768499 16:69253187-69253209 CTGACAAAGGGGGCCAGGTGTGG - Intronic
1140128678 16:72138390-72138412 CAGCCACAGGAGGCCATGCTGGG - Intronic
1140737170 16:77908623-77908645 CAGGAAAAGGAGGCCGGGCGCGG + Intronic
1140776834 16:78256546-78256568 CAGTTAATTGAGGCCAGGAGAGG - Intronic
1141400805 16:83745257-83745279 CTGCAGAAGGACGCCAGGAGAGG - Intronic
1141474600 16:84264298-84264320 AAACCAAAGGAGGCCAGGCGTGG + Intergenic
1141734559 16:85843678-85843700 TAGCCACAGGAGGCCAAAAGTGG - Intergenic
1141986885 16:87585889-87585911 CAGCACAAGGAGGCCAGGCGAGG - Intergenic
1142129871 16:88427660-88427682 CAGCCAAGGCAGGCCAGGGACGG + Exonic
1142570965 17:873967-873989 CAGCCAAACCATGTCAGGAGTGG - Intronic
1143218932 17:5245359-5245381 AAGCCAAAGTAGGCCAGGCATGG + Intergenic
1143264287 17:5624189-5624211 CAGAGAAAGAAGCCCAGGAGGGG - Intergenic
1143363511 17:6390148-6390170 CTGGCAAAGGAGATCAGGAGGGG + Intergenic
1143364318 17:6396024-6396046 CTGCCCAAGGCGGCCAGCAGGGG + Intronic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144545876 17:16195179-16195201 AAGAAAAAGAAGGCCAGGAGCGG + Intronic
1144629692 17:16864719-16864741 CTGCCCAAGGGAGCCAGGAGAGG + Intergenic
1144651736 17:17011398-17011420 CTGCCCAAGGGAGCCAGGAGAGG - Intergenic
1144681108 17:17195251-17195273 AAACCATAGGAGGCCAGGAGCGG - Intronic
1144886682 17:18467730-18467752 CAGAAAAAGTAGGCCAGGTGCGG + Intergenic
1144948099 17:18980097-18980119 CAGCCAGAGGAGGGCAGGAAGGG + Intronic
1144951899 17:18998858-18998880 CAGCTAAAGGATGCAATGAGTGG + Intronic
1145081654 17:19899243-19899265 GAGGTAAAGGAGGCCAGGTGTGG - Intergenic
1145145529 17:20476577-20476599 CAGAAAAAGTAGGCCAGGCGCGG - Intergenic
1145279739 17:21458418-21458440 CATCCAAGGGAGGTGAGGAGAGG + Intergenic
1145826099 17:27878239-27878261 CAGACAAAGCTGCCCAGGAGGGG - Intronic
1146063725 17:29620173-29620195 CTGCCAAGGGAGGCCAGGAAAGG - Intronic
1146459848 17:33037434-33037456 CAGCCACAGCAGGGCTGGAGGGG - Intronic
1146505542 17:33401451-33401473 CAGACAAAGGAGGGCAGGAGGGG - Intronic
1147627698 17:41910518-41910540 CCTCCAGAGGAGGCCAAGAGTGG - Intronic
1147732645 17:42613742-42613764 AGTCCAAAGGAGTCCAGGAGTGG - Intronic
1147948940 17:44096269-44096291 CAGCCCAGGGAGGTCACGAGGGG + Intronic
1148093255 17:45035188-45035210 AAGGCAAATGTGGCCAGGAGTGG + Intronic
1148146181 17:45366478-45366500 CACCCAGAGCAGGCCAGGGGTGG - Intergenic
1148440907 17:47711202-47711224 CAGGGAAAGGAGGACAGGACTGG - Exonic
1148452949 17:47792032-47792054 AAGGAAAAGGAGGCCAGGTGCGG - Intergenic
1148804935 17:50259256-50259278 CAGGAAAGGGTGGCCAGGAGAGG + Intergenic
1149422204 17:56521694-56521716 CAGCCGAAGGAGGCTTGGAATGG - Intergenic
1149607578 17:57935809-57935831 CAGTCAAGGGGGCCCAGGAGAGG - Intronic
1151254687 17:72867207-72867229 AAGTAAAAGGAAGCCAGGAGTGG + Intronic
1151448895 17:74185363-74185385 CAGTCCAAGGGGGCCAGGAAGGG - Intergenic
1151552867 17:74832046-74832068 CAGCCAGGGGAGGCAGGGAGGGG + Intronic
1152016986 17:77757190-77757212 CTGCCAGGTGAGGCCAGGAGAGG + Intergenic
1152074216 17:78148798-78148820 CAGCCATAGGAGGTTTGGAGGGG + Intronic
1152176392 17:78790579-78790601 CAGCCAAAAAAGGCCAGGCATGG - Intronic
1152187793 17:78869042-78869064 GAACCACAGGAGGCCAGGACAGG - Intronic
1152192108 17:78894988-78895010 CAGCAAAAGAAGGACAGGTGTGG + Intronic
1152193285 17:78901549-78901571 AAGCCAAAGGAGGTGAGGTGGGG + Intronic
1152487012 17:80601111-80601133 CTGCCAGAGGAGGCCATGGGAGG + Intronic
1152614532 17:81331657-81331679 AAGCCAGGGGACGCCAGGAGCGG + Intergenic
1153575814 18:6520066-6520088 CAACCAAAAGAGAGCAGGAGTGG - Intronic
1154041954 18:10864889-10864911 CAGCCCCAGGAGGACAAGAGTGG + Intronic
1154095090 18:11406920-11406942 CAGCCTGAGGAGGCCAGGAGAGG - Intergenic
1154366692 18:13716737-13716759 CAGCAACAGGAGGCAGGGAGAGG - Intronic
1154464708 18:14632272-14632294 CAGGCAAAGGAGGCCACTACAGG - Intergenic
1156315613 18:35966363-35966385 CAGGTAAACGAGGCAAGGAGAGG + Intergenic
1156654006 18:39261880-39261902 AAGACAAAGAAGGCCAGGCGTGG + Intergenic
1157343550 18:46802751-46802773 AAGCCAAAGGGGGCCGGGCGCGG + Intergenic
1157547230 18:48555056-48555078 CAGAGAAGGGAAGCCAGGAGAGG - Intronic
1157608980 18:48944265-48944287 CAGCCAAAGGTGGCGGGGAGTGG - Intronic
1158418778 18:57274028-57274050 CAACAAAAGGAGCCCAGGACTGG - Intergenic
1159067713 18:63588476-63588498 CAGCAAGAGAAGGCCAAGAGAGG + Intronic
1159543731 18:69814041-69814063 CAGCAGAAGAAGGCCAGGAGTGG + Intronic
1160120672 18:76127975-76127997 CAACCAAAAGAGGTCAGCAGAGG + Intergenic
1160758967 19:773031-773053 AAGCCAAATGAGGCCACCAGAGG + Intergenic
1160790370 19:920199-920221 CAGCCCAAGGGGTCCAGGAGGGG + Intronic
1160905502 19:1450018-1450040 CAGCCAATGGCGGCCCGGGGCGG - Intronic
1160913707 19:1487110-1487132 CAGCCCGAGGAGGGCAGGGGTGG - Intronic
1160945364 19:1640243-1640265 CAGCCAAATGAGGCCGGGCTCGG + Intronic
1161232906 19:3184024-3184046 CAGCCAAAGCAGGGCAGAGGGGG - Intergenic
1161503149 19:4628671-4628693 AACCCCAAGGAGGCCAGGTGCGG - Intergenic
1161932558 19:7350380-7350402 CAACCAAAGGAGGTCAGGAAAGG + Intronic
1162358994 19:10206308-10206330 CATTCCAGGGAGGCCAGGAGAGG + Intronic
1162551034 19:11358344-11358366 CAGCCCTAGGAGGCCGGGCGTGG - Intronic
1162564609 19:11438464-11438486 CAACGGAAGGAGGCCAGGCGCGG + Intronic
1162757882 19:12871151-12871173 CCGCCAAGGAGGGCCAGGAGAGG + Exonic
1163150498 19:15410231-15410253 AGTCCAAAGGAGGCCAGGCGCGG - Intronic
1163472427 19:17505360-17505382 CAGCCACAGGAGGCCTGGATCGG - Exonic
1163548683 19:17953176-17953198 CAGCCTGAGGAGGCTGGGAGCGG - Intronic
1164726472 19:30468958-30468980 AAGCCCCAGGAGGCCTGGAGGGG - Intronic
1164797588 19:31046491-31046513 CAGCCAAAGGAGGCAGGCACAGG + Intergenic
1164800737 19:31074053-31074075 CAGCCAAAAGAGGCCGGCTGGGG + Intergenic
1164840183 19:31387372-31387394 AAGCCAGAGGAGGCAAGGAACGG - Intergenic
1165243847 19:34486654-34486676 CTGACAAAGGCGGCCAGGCGCGG - Intronic
1165433823 19:35786404-35786426 CAGCCTCTGGAGGCCTGGAGGGG - Intronic
1165507507 19:36243653-36243675 CAGCCAGAGGAGTCCAAAAGAGG + Intronic
1165530036 19:36391056-36391078 AGGTCAAAGGAGGCCAGGCGCGG - Intronic
1165565998 19:36728041-36728063 CAAACAAAACAGGCCAGGAGCGG - Intronic
1165632222 19:37311445-37311467 CAGCCAGAGGAGTCCAAAAGAGG - Intergenic
1165735502 19:38173206-38173228 CATTCAAAGGCTGCCAGGAGAGG + Intronic
1166144834 19:40826586-40826608 CAGCCAACTGAGTCCAGCAGGGG - Intronic
1166182908 19:41121621-41121643 CAGCCAACTGAGTCCAGCAGGGG + Intronic
1167679813 19:50912366-50912388 CAGCCAGAGGAGGGCAGGGCGGG + Intergenic
1167726627 19:51217707-51217729 TAGACATTGGAGGCCAGGAGTGG - Intergenic
1167832036 19:52031705-52031727 TAGCAAGAGGAGGCCAGGCGTGG + Exonic
1168413789 19:56156434-56156456 AAGCCAAAGGAGGCCAAGAAGGG - Intronic
925156559 2:1652606-1652628 CAGCCACGAGAGGCCAGGAGAGG + Intronic
925421723 2:3718072-3718094 CAGCCCTCTGAGGCCAGGAGTGG + Intronic
925627928 2:5860797-5860819 TAGCCAAGGGAAGCCATGAGGGG - Intergenic
926116724 2:10218122-10218144 CGGCCAGAGGTGGCCTGGAGTGG - Intergenic
927367820 2:22319295-22319317 TAGGAAAAGGAGGCCAGGCGCGG + Intergenic
928091816 2:28379157-28379179 CAGCCACAGGAAACCAAGAGAGG - Intergenic
928206231 2:29285851-29285873 CAGCCACTGAAGGCCAGGTGCGG - Intronic
928284912 2:29981688-29981710 CAGCCAAAGAAAGCCAGGACAGG - Intergenic
928391401 2:30913509-30913531 CAGCCCATGGAGGTCAGGAGAGG - Intronic
928846651 2:35682294-35682316 AAACCAAAGTAGGCCAGGCGCGG + Intergenic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929712855 2:44282160-44282182 AAGGCAAAGGGGGCCAGGAGCGG - Intronic
931131192 2:59338118-59338140 CAGCCAGAGGTGGTCAGGACAGG - Intergenic
931235673 2:60410703-60410725 CAGCCACAGGACCCCAGGAGGGG + Intergenic
931561997 2:63572088-63572110 AAACCAAAGGAGGCAAGGAATGG + Intronic
932051478 2:68403019-68403041 CAGGCAAAAAAGGTCAGGAGTGG - Intergenic
932233292 2:70100696-70100718 CAGACAACGGAGGCCGGGCGCGG + Intergenic
932305371 2:70698131-70698153 CAGGCAAAGGTGGGCAGGTGGGG + Intronic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
934663364 2:96154647-96154669 CAGCCAGAGGAGGCCAAGGGAGG + Intergenic
934888160 2:98042470-98042492 GTGCCAAAGGAGGCCAGCTGGGG + Intergenic
935947714 2:108301299-108301321 TCCCCAAAGGAGGCCAGGCGCGG + Intronic
936623558 2:114124575-114124597 AAGCCAAAGGGGGCCAGGTGCGG - Intergenic
937132639 2:119524569-119524591 AAGCTGGAGGAGGCCAGGAGAGG + Intergenic
937261354 2:120588432-120588454 CAGCATAAGGAGGCCAGGGAGGG + Intergenic
937516272 2:122659662-122659684 CAGCGGAAGGAGGCCAGGCTTGG - Intergenic
938172072 2:129088211-129088233 AAGACCAAGGAGGCCAGGTGAGG - Intergenic
938375698 2:130804720-130804742 TGGACAAAGGAGGCCAGGTGCGG + Intergenic
938379182 2:130827106-130827128 CAGCCAAGGGTGGACAGGTGAGG - Intergenic
939946859 2:148421342-148421364 TAGCCAAGGGAAGCCATGAGGGG + Intronic
940925106 2:159355904-159355926 TAGCCAAGGGAAGCCATGAGGGG + Intronic
941265786 2:163359920-163359942 AAGAAAAAGGTGGCCAGGAGCGG - Intergenic
941390506 2:164907553-164907575 AAGACAGAGGAGGCCAGGAACGG - Intronic
942510996 2:176700635-176700657 AATCCAAAAGAGGCCAGGAAAGG - Intergenic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
944561217 2:200940509-200940531 AACACAAAGGAGGCCAGGCGTGG + Intronic
944657528 2:201891071-201891093 CAGGCAATGGAGGCCTGAAGAGG - Intronic
944705860 2:202287819-202287841 AAGAGAAAGGAGGCCAGGTGTGG + Intronic
944862354 2:203827195-203827217 CTGCCATAAGAGGCAAGGAGAGG + Intergenic
944911401 2:204313891-204313913 CAGCAAAAGCAGTCCAAGAGAGG + Intergenic
945179704 2:207079383-207079405 CAGTCAAAGGAGGACAGGAGGGG + Exonic
945199227 2:207264704-207264726 AAGCCAAAGTAGGCCGGGTGCGG + Intergenic
946427984 2:219609474-219609496 AAGCCAGAGGAGCCCAGGATGGG + Exonic
946766356 2:223044587-223044609 CTGCCCAAGGCAGCCAGGAGCGG - Intergenic
947430243 2:230021534-230021556 AAGCCAAAGGAAGCCAGGCTAGG - Intergenic
947512708 2:230772773-230772795 CTGCCAAACTAGGCCAGGCGTGG - Intronic
947766650 2:232642092-232642114 AAGACAAATGAGGCCGGGAGTGG + Intronic
948478562 2:238236767-238236789 CAGCCCCAGGAGGCCAACAGTGG + Intergenic
948882364 2:240866402-240866424 AAGCCATAAGAGCCCAGGAGGGG - Intergenic
1168840081 20:904337-904359 AAGCAAAAGGAAGCCAGGTGTGG - Intronic
1168853172 20:990289-990311 CAGCCAAGTGAAGGCAGGAGGGG + Intronic
1169043299 20:2514689-2514711 AAGCCAAAGCAGGCCAGGCATGG + Intronic
1169576385 20:6966569-6966591 AAGCTAAAGGAGGCAAGGAAAGG + Intergenic
1169899543 20:10538815-10538837 CAGCCAAAGAAGGTCTGGTGCGG - Intronic
1169900615 20:10548537-10548559 CACACAAAGAAGGCCTGGAGAGG - Intronic
1170173400 20:13440435-13440457 AAGCCAGAAGAGGCCAGGAAAGG + Intronic
1170598754 20:17824878-17824900 CAGACATTGGATGCCAGGAGGGG - Intergenic
1170670723 20:18430522-18430544 CGGCCAATGGAGGCCAGGTGCGG + Intronic
1170751277 20:19147900-19147922 CAGCCAAGGGCGGCCGGGCGCGG - Intergenic
1172271113 20:33656385-33656407 CATCCCAAGGAGGCCATGGGAGG - Intergenic
1172358090 20:34293562-34293584 CAACCACAGGTGGACAGGAGGGG - Intronic
1172364876 20:34341470-34341492 CAGGCAAAACAGGCCAGGTGCGG - Intergenic
1172637223 20:36418073-36418095 CAACCAAATGAGGCCGGGCGCGG - Intronic
1173816086 20:45989178-45989200 AAGGCAAAGGAGGCCAGGCATGG + Intergenic
1174056555 20:47802319-47802341 CAGGCAAAGCCGGCCAGGACCGG - Intergenic
1174439837 20:50541826-50541848 CAACCAAAGTCGGCAAGGAGAGG + Intronic
1174990051 20:55499848-55499870 CAGGCAAACGGGGTCAGGAGTGG - Intergenic
1175073608 20:56355398-56355420 CAGCCATATAAGGCCAGGCGCGG - Intergenic
1175311118 20:58012162-58012184 CAGCCACAAGAGGCCAGAAAGGG + Intergenic
1175442547 20:59001840-59001862 TGCCCAAAGAAGGCCAGGAGAGG - Intronic
1175685456 20:61024838-61024860 CAGCCAACGGAGGCTCTGAGAGG - Intergenic
1175746452 20:61460458-61460480 CAACCAAAGGTGGGCAGTAGGGG + Intronic
1175848602 20:62073765-62073787 CAGCTAAAGAAGGGCAGCAGTGG + Intergenic
1175963441 20:62648398-62648420 CAGCCACAGGGGGCCTGAAGTGG + Intronic
1176163626 20:63661515-63661537 TCCCCACAGGAGGCCAGGAGAGG - Intronic
1176420199 21:6507983-6508005 CAGAAGAAGGAAGCCAGGAGTGG - Intergenic
1177219278 21:18170234-18170256 CAACCAAAGGAGAACAGCAGTGG - Intronic
1177313317 21:19425001-19425023 CAGGCAAATAAGGCCTGGAGTGG + Intergenic
1178262614 21:31113994-31114016 CAGAGAAAGGAGGACAGGAGTGG + Intergenic
1178934479 21:36849948-36849970 AAGTACAAGGAGGCCAGGAGAGG - Intronic
1179104227 21:38383920-38383942 CTGCCTAATGAGGTCAGGAGAGG + Exonic
1179355810 21:40658075-40658097 CAGACACAGGAGTCCAGGAAAGG + Intronic
1179695691 21:43116303-43116325 CAGAAGAAGGAAGCCAGGAGTGG - Intergenic
1179962153 21:44773704-44773726 CAGCCAAGTGAGCCCAGGAATGG + Intronic
1179994804 21:44969041-44969063 CAGCAAAATTAGGCCAGGCGCGG - Intronic
1180126265 21:45792291-45792313 CAGCCTTGGGATGCCAGGAGGGG + Intronic
1180230496 21:46424223-46424245 CGGCCAGAGGTGGCCAAGAGTGG - Intronic
1181007720 22:20021850-20021872 AAGCCAAGGGAGCACAGGAGAGG - Intronic
1181021457 22:20105675-20105697 CAGCCCCAGGTGGCCAGCAGAGG - Intronic
1181447304 22:22987049-22987071 GAGCCAAGGGAGACCAGAAGAGG - Intergenic
1181476029 22:23168352-23168374 CAACCAAGGGAGCCCAGGACAGG + Intergenic
1181585018 22:23848449-23848471 CATCAAAGGGTGGCCAGGAGGGG + Intergenic
1181828244 22:25537474-25537496 TACCCAAAGGAGGCCGGGCGCGG + Intergenic
1181925479 22:26355227-26355249 CAGGCAAAGAAGGACTGGAGAGG + Intronic
1182035684 22:27196524-27196546 GAACCTAAGGTGGCCAGGAGGGG + Intergenic
1182333957 22:29570747-29570769 GAGCCTCAGGACGCCAGGAGAGG + Intronic
1182595190 22:31414065-31414087 CAAGCAAAGGAGACCAGGAAGGG - Intronic
1183477732 22:38045147-38045169 GAGGCTAAGGAGGCCAGCAGAGG - Intergenic
1183782991 22:40010552-40010574 CTGCCTAAGGATGTCAGGAGAGG - Intronic
1183956011 22:41381360-41381382 CAGCCAATGGAGGGCGGGGGCGG - Intronic
1183959709 22:41404102-41404124 TAGCCATTGGAGGGCAGGAGGGG - Intergenic
1183960812 22:41410933-41410955 AACACAAAGGAGGCCAGGCGTGG - Intergenic
1184375288 22:44108165-44108187 CAGGCACAGCAGGCCAGGCGTGG - Intronic
1184810954 22:46831472-46831494 GAACCAAAGGACACCAGGAGTGG - Intronic
1185322459 22:50208139-50208161 CAGCCACAACAGGCCAGGCGCGG + Intronic
949642251 3:6049915-6049937 AGGCAAAAGGAGGGCAGGAGAGG + Intergenic
950511474 3:13430923-13430945 AAAGTAAAGGAGGCCAGGAGTGG + Intergenic
950539096 3:13599433-13599455 TAGAGAAAGGAGGTCAGGAGGGG + Intronic
950667603 3:14506674-14506696 CCCCTAAAGGATGCCAGGAGAGG + Intronic
951104630 3:18728600-18728622 GAGCCAAAAGTGTCCAGGAGAGG - Intergenic
951254393 3:20432412-20432434 CAGGCAAATGGGGCCTGGAGTGG - Intergenic
951469125 3:23036332-23036354 TAGCCAAGGGAAGCCAGGACAGG - Intergenic
951565958 3:24012701-24012723 CAACTAATGGGGGCCAGGAGTGG - Intergenic
951664939 3:25112484-25112506 AAGCTAATGGTGGCCAGGAGTGG + Intergenic
951742905 3:25944014-25944036 AAGAGAAAGGAGGCCAGGCGCGG + Intergenic
952502646 3:33978314-33978336 CAGAAAAAGGAGGCCAGGCACGG - Intergenic
952841405 3:37649404-37649426 CAACCAAAAGAGAGCAGGAGTGG + Intronic
953057627 3:39400738-39400760 AAGAAAAAGGAGGCCAGGCGTGG - Intergenic
953914180 3:46907346-46907368 CAGGCAATGGAGGCCAGGTGAGG + Intergenic
953941707 3:47104975-47104997 AAGCCAAAGGAGGCCAGCCTGGG - Intronic
954249853 3:49358902-49358924 CAGCCTGAGGAGGCCAGGGAGGG - Intergenic
954348240 3:50019314-50019336 TACCCAAAGGAGGCCAGGCATGG - Intronic
954395629 3:50291954-50291976 CAGGCAACTGAGGCCCGGAGGGG + Intronic
954695861 3:52425631-52425653 AAGCAAAAAGAGGCCAGGCGTGG - Intergenic
955245342 3:57219655-57219677 TGGGCAAAGGAGGCCAGGTGCGG - Intronic
955610356 3:60750355-60750377 CAGCCAAACCATGTCAGGAGGGG - Intronic
955675328 3:61442273-61442295 CAGCCACTGGAAGACAGGAGAGG + Intergenic
955965403 3:64383817-64383839 CACACAAAAGAGGCCAGGTGCGG - Intronic
956207324 3:66768920-66768942 CAGCCAAACAAGGTCTGGAGTGG - Intergenic
958049971 3:88332962-88332984 GAGAGGAAGGAGGCCAGGAGAGG - Intergenic
958060329 3:88471374-88471396 CAGGGAAAGGGGGCAAGGAGAGG + Intergenic
959952957 3:112201699-112201721 GAGAAAAAGGAGGCCAAGAGAGG - Intronic
960392808 3:117100023-117100045 AAGCCAGAGGGGGCCAGGGGTGG - Intronic
960426937 3:117520374-117520396 CAGCTAAAGCAGTCCTGGAGTGG + Intergenic
960452439 3:117826769-117826791 CAGCTACATGAGGCCAGAAGAGG + Intergenic
960845818 3:122003727-122003749 GAGCCAAAGGTGGCTGGGAGTGG + Intronic
960973626 3:123156190-123156212 AAGCCAAAGGAAGCCAGGCTGGG + Intronic
961134446 3:124496711-124496733 CAGCCCAAGAAGCCCAGGTGGGG - Intronic
961171849 3:124802739-124802761 CAGGCCATGCAGGCCAGGAGAGG - Intronic
961247313 3:125466634-125466656 TGGGCAAAGGAGGCCAGGCGTGG + Intronic
961553968 3:127685127-127685149 AAGCCAAAGGTGAGCAGGAGCGG - Intergenic
961811470 3:129524189-129524211 TAGACAAATGAGGCCAGGTGTGG + Intergenic
961967703 3:130923505-130923527 AGGACAAAGGAGGCCAGGTGTGG - Intronic
962184267 3:133241902-133241924 AAGCCACAGGAGGCCGGGGGTGG - Intronic
962815958 3:139000633-139000655 TACCCAAAGGAGGCCAGGCACGG - Intergenic
964020072 3:151999324-151999346 CAGGGGAAGGAGGCCATGAGCGG + Intergenic
964264132 3:154875067-154875089 TAGCCAAGGGAAGCCATGAGAGG + Intergenic
964677497 3:159300043-159300065 CAGACAAAGGAGGCAAATAGAGG - Intronic
964874524 3:161351071-161351093 TAGCCAAAGGAGGCTAAGGGAGG + Intronic
964902121 3:161671758-161671780 CACCCAAAGCAGGAAAGGAGAGG - Intergenic
965652775 3:170951031-170951053 CAGTCAAAGGAGGACAGGAGGGG + Intergenic
965822835 3:172701752-172701774 AAGCAAAAGTAGGCCAGGCGTGG - Intronic
967688434 3:192444663-192444685 TACGCACAGGAGGCCAGGAGTGG + Intronic
967952936 3:194854700-194854722 AAGCCAGAGGAGGCCAGGCTGGG + Intergenic
968170254 3:196504034-196504056 CAGCCAAACAAGGCCGGGTGCGG + Intergenic
968246669 3:197156630-197156652 TAACCAAAGGAGAGCAGGAGTGG + Intronic
968546292 4:1200659-1200681 CAGCCACTGCAGGCCAGGTGTGG + Intronic
968594966 4:1477502-1477524 CAGCCAGAGCCAGCCAGGAGAGG - Intergenic
968688536 4:1977483-1977505 AACCCAAAAGAGGCCAGGTGCGG + Intronic
968887908 4:3345310-3345332 GAGCCAGAGAAGGCCAGGAAGGG - Intronic
969043879 4:4322584-4322606 GAGCCAGAGGAGGCCATGAGAGG - Intergenic
969448112 4:7256925-7256947 CATCCAAAGGATGCTAGGAATGG - Intronic
972202438 4:36730395-36730417 GAGCCACAGGAGCCCAGGAAGGG + Intergenic
972561011 4:40229010-40229032 AAGCCAAAGGAGGCCAAAGGAGG - Intronic
972599777 4:40561838-40561860 AAGACAACGGAGGCCAGGCGAGG - Intronic
972629049 4:40827815-40827837 CAGCCAAAGCATGTCAGCAGGGG - Intronic
973555048 4:52074294-52074316 AAGCCATAAGAGCCCAGGAGTGG + Intronic
973800644 4:54474567-54474589 AAGGAAAAGGAGGCCTGGAGTGG + Intergenic
975183735 4:71376924-71376946 CAACCAAATGAGGCCAGGTGAGG - Intronic
975260135 4:72288154-72288176 CAGCAAAATGGGGCCAGGTGCGG - Intronic
975985127 4:80196019-80196041 CAGTCCCAGGAGGCCAGGGGAGG - Exonic
978498184 4:109382482-109382504 CAGCAAAAATAGGCCAGGCGCGG + Intergenic
979236363 4:118404556-118404578 CAGGCAAACGAGGTCTGGAGTGG + Intergenic
980211020 4:129787536-129787558 AGGCCAAAGGAAGCTAGGAGAGG + Intergenic
981114757 4:140976671-140976693 GAGAGAAGGGAGGCCAGGAGAGG - Intronic
981749793 4:148082481-148082503 TAGCCAAGGGAAGCCATGAGGGG + Intronic
981885435 4:149667278-149667300 CAGGCAAACAGGGCCAGGAGTGG + Intergenic
982197704 4:152933442-152933464 GAGTCAAAGTAGGCCAGGCGTGG + Intergenic
984205965 4:176788416-176788438 GTGCCAAAGGAGACCAGCAGAGG + Intronic
984626200 4:182009915-182009937 CAGCCAAGGGAGGCGGTGAGTGG - Intergenic
985815923 5:2127888-2127910 CAGCCCAAGCAGCACAGGAGAGG - Intergenic
985996178 5:3598447-3598469 GAGCCACCGGCGGCCAGGAGGGG - Intronic
986304359 5:6504501-6504523 CAGACAGAAGAGGCTAGGAGAGG - Intergenic
986429225 5:7665230-7665252 CAGCCAAAGAAGGGAAGGAAAGG - Intronic
987627002 5:20415093-20415115 CAGATGAATGAGGCCAGGAGGGG + Intronic
988135754 5:27169573-27169595 CAGCCAGCAGAAGCCAGGAGAGG - Intergenic
988844387 5:35113779-35113801 CTGGCCTAGGAGGCCAGGAGGGG + Intronic
991517426 5:67453597-67453619 AAGCCAAAAGAGGCCAGAAAGGG + Intergenic
991574601 5:68089943-68089965 AAGCCAAAAGAGGCAAGGAAGGG - Intergenic
992083119 5:73253876-73253898 CAGCCATGGGAGGCAAGGACAGG - Intergenic
992093569 5:73340159-73340181 CAGCCAAGGGAGGCTGGGAGAGG - Intergenic
992229024 5:74645060-74645082 ACTCCTAAGGAGGCCAGGAGTGG - Intronic
992712254 5:79471251-79471273 GGCCTAAAGGAGGCCAGGAGCGG + Intronic
993404043 5:87488662-87488684 CAGGCAAACGGGGCCTGGAGTGG + Intergenic
993926635 5:93873742-93873764 CCTCCATATGAGGCCAGGAGAGG - Intronic
995024130 5:107399159-107399181 AAGTGAAAGGAGGCCAGGCGTGG + Intronic
996113340 5:119591395-119591417 AAGCCAAATGAGGCCGGGTGTGG + Intronic
996192422 5:120562294-120562316 AAACCAAAAAAGGCCAGGAGTGG - Intronic
997053642 5:130413488-130413510 CAGCCATAGGAAACCAGCAGGGG - Intergenic
998117998 5:139553107-139553129 CAGCTAGTAGAGGCCAGGAGCGG - Intronic
998250850 5:140551206-140551228 CAGCCCAATGAGGGGAGGAGAGG + Intronic
998602492 5:143599400-143599422 CACCTAAAGGAGGTCTGGAGTGG + Intergenic
999111503 5:149125451-149125473 CAGCACAAGTAGGCCAGAAGGGG + Intergenic
999244621 5:150147324-150147346 CAGCCAAAGGAGCCCCTGAGAGG + Intronic
999307255 5:150527778-150527800 CAGTCAATGGAGGGCAGGAAGGG - Intronic
999561751 5:152810955-152810977 CAGTGGAAGGAGGCCAGGATGGG + Intergenic
1000883041 5:166719100-166719122 CAGCCCAAGGAGGTCAGCAGTGG + Intergenic
1001036874 5:168303304-168303326 AAGGCACAGGAGGCCAGGTGTGG + Intronic
1001115145 5:168933251-168933273 CAGCCAGAGGAGGCTGGGCGCGG + Intronic
1002177921 5:177412617-177412639 CAGAAAGAGGAGGGCAGGAGAGG + Intronic
1002332138 5:178450455-178450477 CAGCCAGCGGGGGCCAGGAGAGG + Intronic
1002518519 5:179776675-179776697 CAGCCAGATGGGGTCAGGAGAGG - Exonic
1002785536 6:397088-397110 CTGCTAAAGGAGTGCAGGAGAGG - Exonic
1003640134 6:7869245-7869267 CTGGCACTGGAGGCCAGGAGAGG - Intronic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1003878333 6:10457955-10457977 CAGCCAGAAGAGGCAAGGAATGG - Intergenic
1004190138 6:13456463-13456485 AAGCTAAAGGAGGCCAAGTGTGG - Intronic
1005748559 6:28862759-28862781 CATACAAAGTAGGCCAGGCGTGG + Intergenic
1006503128 6:34470467-34470489 TAGCCAAGGTAGGCCAGGTGCGG - Intronic
1006551789 6:34830101-34830123 TAGCCAGGGGAGGCCAGGCGCGG - Intronic
1006960153 6:37921124-37921146 CAGACAAAGGAGGAAAGGGGAGG - Intronic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1008952111 6:57172509-57172531 TAGCCAAAGAAGGGCAGGCGCGG - Exonic
1009057613 6:58356049-58356071 CAGCCAAAGGAGGAGATCAGTGG - Intergenic
1009462713 6:63933495-63933517 AACCCAAAAGAGGCCAGGTGCGG - Intronic
1010432519 6:75794680-75794702 CAGCCAAACAAGGGAAGGAGGGG + Intronic
1010591045 6:77712679-77712701 CAACAAAAGGAGGCCGGGTGCGG + Intronic
1010766455 6:79781325-79781347 AAGGCAAAGTAGGGCAGGAGAGG + Intergenic
1011052787 6:83172209-83172231 CTGTCACAGGAGGCCAGGTGTGG - Intronic
1013332515 6:109119011-109119033 CAGCCTCAGGAAGCCAGGAAAGG + Intronic
1013390800 6:109684582-109684604 TAGGCAAAGGAGGCCGGGCGCGG + Intronic
1013957017 6:115853151-115853173 CAGGCAAACGAGGTCTGGAGTGG + Intergenic
1014209283 6:118691122-118691144 ATGACAAAGGAGGCCAGGCGTGG + Intronic
1014465325 6:121749615-121749637 CAGTAAAAGGTGGCCAGGCGCGG - Intergenic
1015808421 6:137136024-137136046 CAACCAAAAGAGAGCAGGAGTGG + Intergenic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1017115821 6:150975635-150975657 CAGCCAGAGGAGGCCCAGACAGG - Intronic
1017120682 6:151021255-151021277 CAGGCAATGAAGGCCAGGAGTGG + Intronic
1017207592 6:151820193-151820215 CAGACAAAGAAGGGCAGGTGAGG + Intronic
1017595492 6:156024409-156024431 AAACCAAAAGAAGCCAGGAGAGG + Intergenic
1017604618 6:156120644-156120666 AGTCCAAAGGAGGCAAGGAGAGG - Intergenic
1017930727 6:158952390-158952412 CAGCGAGTGGAGGCAAGGAGAGG + Intergenic
1018216588 6:161534061-161534083 CAGACAATGGAGGCCAGGCAAGG - Intronic
1018219633 6:161565364-161565386 CAGCCAAACCATGTCAGGAGAGG - Intronic
1018682740 6:166277338-166277360 CAGCCAAAGGAGTCCTGGCTGGG + Intergenic
1019211546 6:170409725-170409747 AAGACAATAGAGGCCAGGAGCGG + Intergenic
1019863133 7:3679274-3679296 TGGGCAAAGGAGGCCAGGTGCGG + Intronic
1019939219 7:4276098-4276120 GAACAAAAGGAGGCCAGGCGCGG + Intergenic
1021312207 7:19108903-19108925 GAGGGAAAGGAGGCTAGGAGGGG - Intronic
1021769708 7:23985931-23985953 CAGTCAAAATAGGCCAGGCGCGG + Intergenic
1022565062 7:31391411-31391433 CAGCCAGAAGAAGCCAGAAGAGG - Intergenic
1023952056 7:44854109-44854131 TAGCCAAAAGAGGCCGGGCGCGG - Intergenic
1025277822 7:57599162-57599184 AAGAAAAAGAAGGCCAGGAGCGG - Intergenic
1025814449 7:64898015-64898037 CAGCAAAATGAGGCCGGGTGCGG - Intronic
1025936978 7:66045224-66045246 TAGCCAGAGGGGGCCAGAAGCGG - Intergenic
1026013850 7:66656843-66656865 TAACCAAATGAGACCAGGAGTGG + Intronic
1026208663 7:68281314-68281336 AAGCCAAAGTGGGCCAGGTGCGG + Intergenic
1027499582 7:78932058-78932080 CAGCCAAAGGAGGCCAGGAGGGG - Intronic
1029231421 7:99072362-99072384 AATCCAAAGGCGGCCAGGCGTGG + Intronic
1029425796 7:100493496-100493518 CAGCCAGAGGGAGCCAGCAGAGG + Intronic
1029572434 7:101379123-101379145 CAATCAAAGGAGGCCAGGAAGGG - Intronic
1029826208 7:103197640-103197662 CAGGCAGAGGAGGCAGGGAGAGG + Intergenic
1029882763 7:103834040-103834062 CAGTAAAAGGATGTCAGGAGAGG + Intronic
1029885920 7:103871590-103871612 CAGACCATGGAGGGCAGGAGTGG + Intronic
1031113061 7:117635253-117635275 CAACCAAAAGAGACCTGGAGAGG - Intronic
1031141544 7:117948505-117948527 TGGCAAAAGGAGGACAGGAGTGG + Intergenic
1031679136 7:124649473-124649495 AAGCCACAGGAGGGCAGGAATGG - Intergenic
1032085029 7:128879399-128879421 TAGCCAAAAAAGGCAAGGAGTGG - Intronic
1032693727 7:134315774-134315796 CAGGAAAAGGAGCCCAAGAGAGG + Intronic
1032845431 7:135748009-135748031 CAGCCAGAGGTGGGCAGGTGAGG - Intronic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1034046209 7:147930409-147930431 CAACCAAAAGAGAGCAGGAGTGG + Intronic
1034097613 7:148424609-148424631 CAGCCAAGGGAAGCCATAAGAGG + Intergenic
1035404523 7:158588569-158588591 AAGACAAAGGGGGCCAGTAGGGG + Intergenic
1035699075 8:1624464-1624486 CATTCAAAGGAAGCCAGCAGTGG + Intronic
1035750799 8:1994766-1994788 AAGCTAAAAGAGGCCAGGCGTGG + Intronic
1036662291 8:10716158-10716180 CAGCCACAGGAAGCCGGCAGGGG - Intergenic
1037439818 8:18903917-18903939 CAGCCCAAGAAGGCGGGGAGAGG + Intronic
1037814664 8:22105634-22105656 CAGCCAAGAGAGGCAGGGAGGGG + Intergenic
1037948950 8:23006597-23006619 CAGACAGAGCAGGGCAGGAGTGG + Intronic
1038184396 8:25259749-25259771 AAAACAAAGGAGGCCAGGTGCGG - Intronic
1038263056 8:26014625-26014647 CACCCAAAGCAAGCAAGGAGAGG + Intronic
1038310469 8:26442341-26442363 TAGCCAAGGGTGGCCAGGCGTGG - Intronic
1038333985 8:26631749-26631771 CAGCCCAGTGAGGCGAGGAGGGG + Intronic
1038637090 8:29296209-29296231 CTGCTAAATGAGGCCAGGTGTGG - Intergenic
1039271213 8:35882720-35882742 CTGCCAAATGAGGACATGAGAGG - Intergenic
1040392257 8:46960298-46960320 CAGGAAAATGAGGCCAAGAGAGG + Intergenic
1042101609 8:65280712-65280734 AAGCTAGAGGAGGCAAGGAGAGG - Intergenic
1043104834 8:76094717-76094739 TAACCAAAGGAGAGCAGGAGTGG - Intergenic
1043982246 8:86656808-86656830 CAGAGAAAGGAGGCAAGGATGGG - Intronic
1044684386 8:94812909-94812931 CAGAGACAGGAGGTCAGGAGAGG + Intergenic
1044750785 8:95413438-95413460 CTGCCAAAGGAGAGCAGGAAGGG - Intergenic
1045324863 8:101110387-101110409 GAGCTAAATGAGGCCAGGTGCGG + Intergenic
1047646308 8:126874122-126874144 AAGGGAAATGAGGCCAGGAGCGG - Intergenic
1047763139 8:127968898-127968920 CAGCCACCAGAAGCCAGGAGAGG + Intergenic
1047927106 8:129692741-129692763 AAGCAAAAAGAGGCCAAGAGAGG - Intergenic
1048292734 8:133192865-133192887 CAGCCAGAGGAGACCAGCAAAGG + Intronic
1048972203 8:139651385-139651407 GAGCCACAGGTGGCCAGGTGTGG - Intronic
1049041953 8:140119177-140119199 CAGCCAAACCACGCCAGGCGTGG + Intronic
1049216277 8:141409812-141409834 CAGCGCAAGCAGGGCAGGAGGGG - Intronic
1049586002 8:143432631-143432653 CAGGCCAAGGAGACCAGGAGAGG + Intergenic
1049767765 8:144362857-144362879 CAGCCCAGGGTGGACAGGAGAGG - Intergenic
1050334110 9:4574298-4574320 GAGCCAAGGGAGGCTACGAGTGG - Intronic
1051270273 9:15348629-15348651 AATCAACAGGAGGCCAGGAGTGG - Intergenic
1051971423 9:22892077-22892099 CATCCACTGGAGGCCAGGATAGG + Intergenic
1052998638 9:34565288-34565310 CCGAAAAAGGAGTCCAGGAGTGG - Intronic
1053444076 9:38137986-38138008 GAGCCATAGGAGGCAGGGAGGGG + Intergenic
1055466765 9:76574118-76574140 CAGCCCAAGGGGCCAAGGAGGGG - Intergenic
1056421196 9:86428021-86428043 TGGGCAAAGGAGGCCAGGTGCGG - Intergenic
1056681720 9:88725102-88725124 CAGCCAGGGAAGGCCAGGCGCGG - Intergenic
1056936730 9:90920197-90920219 CAGCCAAGGCTGTCCAGGAGGGG - Intergenic
1057103742 9:92390972-92390994 CAGCAAAATCAGGCCAGGTGTGG + Intronic
1057149768 9:92785911-92785933 CAGCCAGAGAAGGCCAGGCATGG - Intergenic
1057225075 9:93288909-93288931 CAGTCACAGGAGGGGAGGAGGGG - Exonic
1057738151 9:97686634-97686656 AAGCAAAATGAGGCCAGGCGTGG + Intronic
1058053196 9:100427001-100427023 CAGCCCGAGGATGTCAGGAGCGG + Intergenic
1058265887 9:102898280-102898302 CAGGCAAATGGGGTCAGGAGTGG + Intergenic
1059180814 9:112210488-112210510 CAGGCTAGGGAGGCCAGTAGGGG - Intergenic
1059634364 9:116156962-116156984 CAGCCAGAGAAAGCCAGCAGAGG - Intronic
1059695924 9:116730503-116730525 CTGCAAAGGAAGGCCAGGAGAGG - Intronic
1059736390 9:117104018-117104040 CCTCCAAATGTGGCCAGGAGAGG + Intronic
1059757727 9:117309643-117309665 AAGCCAACTGAGGCCAAGAGAGG + Intronic
1059866674 9:118522245-118522267 CAGCCAAAAGGGGGCAGTAGAGG + Intergenic
1060298586 9:122360455-122360477 CAACCAAAGGATGGCAGGGGAGG + Intergenic
1060507151 9:124206483-124206505 CAGCCAAGGGTGCACAGGAGTGG - Intergenic
1060992721 9:127857944-127857966 CAGCCTGAAGAGGCCAGGGGAGG - Intergenic
1061190426 9:129079573-129079595 CGGGCAAAGTAGGGCAGGAGAGG + Intergenic
1061194869 9:129102234-129102256 GGGCCCAGGGAGGCCAGGAGGGG - Intronic
1061455453 9:130694128-130694150 CAGCCACCGGAGGTCAGGAGTGG - Intronic
1061681333 9:132243845-132243867 CAGAGAGAGGAGGCCAGGAGGGG - Exonic
1061870345 9:133517014-133517036 CAGCCACAGGAGCCGAGGATGGG - Intronic
1062217962 9:135399345-135399367 GAGCCATGGGAGACCAGGAGGGG + Intergenic
1062575235 9:137203642-137203664 AAGCAAAAGCAGGCCAGGCGTGG - Intronic
1062745462 9:138208981-138209003 CAGCCACAGGAGGTGATGAGTGG - Intergenic
1203492023 Un_GL000224v1:116280-116302 CAGGCAAACAAGGCCTGGAGTGG - Intergenic
1203504647 Un_KI270741v1:58152-58174 CAGGCAAACAAGGCCTGGAGTGG - Intergenic
1186179729 X:6961107-6961129 CACCAAAAGTAGGCCAGGTGTGG + Intergenic
1186189161 X:7052325-7052347 AAGGCAAAGGGGGCCAGGTGTGG - Intronic
1186301611 X:8205378-8205400 CAGCCAGAGAGTGCCAGGAGAGG + Intergenic
1186410702 X:9342557-9342579 CAGGGAGAGGAGGCTAGGAGGGG - Intergenic
1187138964 X:16575314-16575336 CAGGCAGAGGAGGCGCGGAGAGG - Intergenic
1187279384 X:17846333-17846355 CAGGCAAATGAGGACAGGATGGG + Intronic
1189334791 X:40164592-40164614 CAGCCAATGTAGGTCAGGAGGGG - Intronic
1189347470 X:40252893-40252915 CAGTGAAAGGAGGCCGGGTGCGG + Intergenic
1189461724 X:41248795-41248817 GAGTCCAAGGAGGCCAGGCGTGG - Intergenic
1189561834 X:42198964-42198986 AAGACAAAAGAGGCCAGGCGCGG - Intergenic
1189778431 X:44491017-44491039 GAGGCATAAGAGGCCAGGAGCGG - Intergenic
1190296729 X:49031929-49031951 GAGCCTAAGGAGGCAAGGCGGGG - Intronic
1190621656 X:52292648-52292670 CAGGCAAACGGGGCCTGGAGTGG + Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1190929524 X:54935639-54935661 CAGCCAACTGAGGCCTTGAGAGG + Intronic
1191023580 X:55889255-55889277 CAGTCAAAGAGGGCCTGGAGTGG - Intergenic
1192168307 X:68839667-68839689 CATCCAATGGAAGCCTGGAGGGG + Exonic
1192799323 X:74450731-74450753 AAGGCAGAGGAGGCAAGGAGCGG - Intronic
1193196627 X:78639677-78639699 CAGCCAAAGGGCTCCAGGTGTGG + Intergenic
1193616059 X:83689116-83689138 TAGCCAAAGAAAGCCATGAGGGG - Intergenic
1193934658 X:87601717-87601739 CAGGCACATGAGGCCAGGAGAGG - Intronic
1195909825 X:109877794-109877816 GATACAAAAGAGGCCAGGAGAGG + Intergenic
1196787267 X:119431861-119431883 AAGCTAAGGGAGGCCAGGGGCGG + Intronic
1197183303 X:123560852-123560874 AAGACAAAGAAGGCCAGGTGTGG + Intergenic
1198025149 X:132698072-132698094 CAGACAAAGGAAGCCATGATAGG - Intronic
1198321202 X:135520819-135520841 CAGAAAGAGGAGGCCAGGAGCGG + Exonic
1198461875 X:136871154-136871176 CAACCATAGGCGGCCAGGTGCGG + Intronic
1198648665 X:138837495-138837517 GAGCCAAAGCTGACCAGGAGTGG - Intronic
1199798973 X:151230770-151230792 CAGTCAAATGCAGCCAGGAGAGG + Intergenic
1200124144 X:153805339-153805361 CAGCCTTCAGAGGCCAGGAGGGG + Intronic
1200389341 X:155928211-155928233 CAGCCAAAGGGGGCCAGGTGTGG - Intronic
1202114936 Y:21463476-21463498 CAAACAAATGAGGCCAGGTGTGG + Intergenic