ID: 1027501521

View in Genome Browser
Species Human (GRCh38)
Location 7:78957847-78957869
Sequence AGGGAGCAGCAGCATCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027501521_1027501525 3 Left 1027501521 7:78957847-78957869 CCAGCCTGATGCTGCTGCTCCCT 0: 1
1: 0
2: 3
3: 52
4: 453
Right 1027501525 7:78957873-78957895 CATTTCTCTGTGTGACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027501521 Original CRISPR AGGGAGCAGCAGCATCAGGC TGG (reversed) Intronic
900030755 1:370928-370950 AGGGAAAATCACCATCAGGCTGG - Intergenic
900051371 1:599602-599624 AGGGAAAATCACCATCAGGCTGG - Intergenic
900110754 1:1004535-1004557 CAGAAGCAGCAGCACCAGGCTGG + Intergenic
900464076 1:2815599-2815621 AGGGAGCAGGAGGGCCAGGCTGG + Intergenic
900467230 1:2831689-2831711 AGGAAGCATCAGCTTCAGGAAGG + Intergenic
901146780 1:7070180-7070202 AGAGAACAGCAGCATCAGATGGG + Intronic
902082872 1:13833247-13833269 AGGGAGCAGGATCCTCAGGCAGG + Intergenic
902226189 1:14997798-14997820 ACAGAGCAACAGCATCAGGTGGG + Intronic
902259694 1:15215302-15215324 AAGCAGCAGCAGCATCACCCCGG - Exonic
902338223 1:15765979-15766001 AGTCAGCAGCAGCATCACCCGGG + Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
903626804 1:24736542-24736564 AGGGAACTGGAGCCTCAGGCAGG - Intergenic
904107428 1:28097643-28097665 AGGTAGTAGCAGCAATAGGCCGG + Intergenic
904263689 1:29305593-29305615 AGTGAGCAGCAGCTTCTGGAAGG + Intronic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904835258 1:33331550-33331572 TGGGAGCAGGAGGACCAGGCAGG - Intronic
905107614 1:35573763-35573785 CGGGCGCAGGAGCCTCAGGCTGG - Intronic
906061694 1:42953203-42953225 AGGGTGCAGAAGCCTCAGGGAGG + Intronic
906676976 1:47700373-47700395 AGGGTGCAGGAGCAGCAGGTGGG + Intergenic
907011496 1:50968200-50968222 AGGCAGCAGCAGCCGCAGCCTGG + Exonic
907751219 1:57265087-57265109 AGGGAACAGCAGCCCCAGGATGG + Intronic
908390927 1:63682893-63682915 AGGAAGCAGCTGCTTCAGGATGG - Intergenic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
909213555 1:72855254-72855276 ATGTACCAGCACCATCAGGCAGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
910364216 1:86446745-86446767 AAGGAGCAGCAGCAGAAGTCAGG + Intronic
910494760 1:87814462-87814484 AGTGTGCAGCAGCATGAGACTGG + Intergenic
912321782 1:108720405-108720427 AGGCAGCATCTTCATCAGGCTGG + Intronic
912795621 1:112691721-112691743 GGGGAGCAGCTGCCTGAGGCGGG - Exonic
913114585 1:115684677-115684699 CAGGAGCATCAGCATCACGCAGG - Intronic
915004418 1:152623282-152623304 AGGAAGGGGCAGTATCAGGCCGG - Intergenic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
918080941 1:181207184-181207206 AAGGAGCAGGAGCCGCAGGCTGG - Intergenic
919287632 1:195585040-195585062 AGGGAGCATCAGCAGTAGCCTGG + Intergenic
919768758 1:201143877-201143899 AGGGTCCACCAGCATCAGGAAGG + Exonic
919822941 1:201484329-201484351 GAGGAGCAGCAGCAACAGGCTGG - Exonic
920417882 1:205810891-205810913 AAGGAGCCGCAGCCCCAGGCTGG - Exonic
920435184 1:205942743-205942765 AGGGACCAGCTCCATCAGGCAGG - Intronic
920560099 1:206932683-206932705 AGGGAGCTGCATCAGCAGGGTGG - Intronic
920958843 1:210645956-210645978 AGGGTGAAGCAGCAACAGGGAGG - Intronic
922466581 1:225848963-225848985 GGTGAGCAGCAGCACCAGGAAGG + Exonic
922808033 1:228400653-228400675 AGGGAGCAGCAGTGTCAGTCAGG + Intronic
922991854 1:229920923-229920945 AGGCAGCAGTAGCAGCTGGCTGG - Intergenic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1063069749 10:2649360-2649382 AGGGAGCAAAAGCAGCCGGCGGG - Intergenic
1063747395 10:8899896-8899918 AGAAAGCAGCAGAATCAGGCTGG - Intergenic
1064013889 10:11758285-11758307 ACGGAGCAGCTGCGCCAGGCAGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065382143 10:25101425-25101447 AGGGAGTCACTGCATCAGGCAGG - Intergenic
1065422271 10:25558519-25558541 AGGGAGGTGCAACAGCAGGCAGG - Intronic
1065517979 10:26543920-26543942 GGCGAGGAGCAGAATCAGGCAGG - Intronic
1066676320 10:37891353-37891375 AGGGAGCAGCAGCCTATTGCTGG - Intergenic
1067081426 10:43214660-43214682 AGGGAAGAGCAGTATAAGGCAGG + Intronic
1067545521 10:47189927-47189949 AGGGAGGAGCAACAACAGGCAGG + Intergenic
1067557436 10:47282682-47282704 AGTGAGCAGCAGCATGAGCTTGG + Intergenic
1067795619 10:49319264-49319286 AGGAAGCAGCATCCTCAGACAGG + Intronic
1069211624 10:65768636-65768658 AGAGAGAAGTAGCAGCAGGCAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070753637 10:78978121-78978143 AGTGAGCAGAGGCATGAGGCAGG - Intergenic
1070967095 10:80536360-80536382 AGGGAGCAGCAGGAATGGGCCGG - Intergenic
1071497696 10:86180078-86180100 AGGGCGGAGCAGGAGCAGGCTGG + Intronic
1072940640 10:99760555-99760577 AGGGAGCAGCATCCTGAGGCAGG + Intergenic
1075310684 10:121411206-121411228 ATTGAGCAGCAGCAGCTGGCAGG - Intergenic
1075420279 10:122295324-122295346 AGGGTGGAGCAGCATCAAACTGG + Intronic
1076231202 10:128821323-128821345 GGGAAACAGCAGGATCAGGCGGG - Intergenic
1076403342 10:130197308-130197330 AGGGGGGAGCAGCACCTGGCAGG + Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076872732 10:133201641-133201663 AGAGCGCAGCAGCCTGAGGCTGG + Exonic
1077119393 11:899824-899846 AGCGAGCAGCAGCCTGAGCCTGG + Intronic
1077517604 11:3011195-3011217 AGCAAAAAGCAGCATCAGGCAGG - Intronic
1077518303 11:3015740-3015762 AGGGAGCAGGTGCAGAAGGCAGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077556427 11:3228194-3228216 CCGCAGCAGCAGCATAAGGCTGG + Exonic
1078060334 11:8039132-8039154 GGGGAGCAGCACCATCAGGAAGG - Intronic
1078097784 11:8311243-8311265 AGGGAGCTGGAGCCCCAGGCTGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079112273 11:17611521-17611543 AGGGACCAGGAGCATGGGGCAGG - Intronic
1079288002 11:19157155-19157177 GGGATGCAGCAGCATCAGTCAGG - Intronic
1080609068 11:33888254-33888276 ATGGGGCAGAAGCATAAGGCTGG - Intronic
1082077067 11:47982073-47982095 AGAGAGCAGAAGCATCACCCTGG + Intronic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1082868519 11:57921147-57921169 GGGTAGTAGCAGCAGCAGGCTGG - Intergenic
1083572059 11:63766210-63766232 GGGGACCAGCATCTTCAGGCAGG - Exonic
1084634072 11:70378659-70378681 ACGGAACAGCAGCAGCAGGGAGG - Intronic
1084912446 11:72401903-72401925 AGGCAGCATCAGCACTAGGCTGG + Intronic
1085259802 11:75197968-75197990 TGGGGGCAGCAGCATCAGGCTGG + Intronic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1087014714 11:93543553-93543575 AGGCAGCGGCAGCAGCAGGCCGG - Intergenic
1087515569 11:99154963-99154985 AGACAGTAGCAGAATCAGGCTGG + Intronic
1089278601 11:117356527-117356549 AAGCAGCAGCACCCTCAGGCAGG + Intronic
1089774696 11:120828076-120828098 GGGGAGCAGCAGTGCCAGGCAGG - Intronic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1089811788 11:121138088-121138110 AGGCTGCAGCTGAATCAGGCAGG + Intronic
1090840035 11:130479392-130479414 AAGGAGCAGCAGCACCGGGCAGG - Intergenic
1091035935 11:132233451-132233473 AGGGATCAGCAGATTAAGGCAGG + Intronic
1091194488 11:133719725-133719747 TGTGAGCAGGAGCATCAGGTCGG - Intergenic
1091316698 11:134618895-134618917 AGGAAGCAGCAGGATTAGGGAGG + Intergenic
1091563524 12:1631359-1631381 CGTGAACAGCAGCAGCAGGCTGG - Exonic
1091947596 12:4562238-4562260 CGGGAGGAGCTGCATGAGGCCGG - Intronic
1093921266 12:24862372-24862394 AGGGAGGGGCAGTGTCAGGCAGG - Intronic
1094234375 12:28146765-28146787 AGGGAGTAACAACATCAGGGTGG + Intronic
1094271423 12:28621182-28621204 AGGAAGCAACAGCAGAAGGCAGG - Intergenic
1095954187 12:47797147-47797169 AGGGAGCACCAGCGTCACTCAGG + Intronic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1096866475 12:54566647-54566669 AGGGCCCAGCAGAATTAGGCAGG - Intronic
1098817419 12:75185004-75185026 AGGGAGCAGAAGCATAAAGCCGG + Intronic
1099917037 12:88907684-88907706 AGGAAGCATCAGGATCAGTCTGG + Intergenic
1100542999 12:95575676-95575698 GGGGAGGAGCAGCATCAGAAAGG + Intergenic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1102507511 12:113392997-113393019 CGGGGGCAGCAACATCAGCCTGG - Exonic
1106269238 13:28138314-28138336 AGGGAGCGGCAGCGGCAAGCGGG - Intergenic
1106666058 13:31852113-31852135 GGGAAGCAGCAGGATCAGGCAGG + Intergenic
1106803817 13:33285592-33285614 AGGTAGTAGCAGCCTGAGGCTGG + Exonic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108689916 13:52850849-52850871 CGGCAGCAGCAGCGCCAGGCGGG - Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109178089 13:59179943-59179965 TGGGTGCAGCAGCAACATGCAGG - Intergenic
1111674420 13:91369151-91369173 AGGCAGCAGCTTCCTCAGGCAGG + Intergenic
1112357081 13:98682540-98682562 AAGGAGCAGCAGCTCCATGCTGG + Intergenic
1112486675 13:99826473-99826495 AGAGAGCAGCTGTATCAGTCAGG - Intronic
1112742643 13:102492616-102492638 AGGCAGCAGCAGCATTGGGAGGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113589497 13:111488539-111488561 AGGCAGCAGCATCAGCAGGTGGG + Intergenic
1116788020 14:49309360-49309382 AGGCCACAGTAGCATCAGGCAGG + Intergenic
1117512897 14:56471256-56471278 TGGCAGCGGCAGCAGCAGGCTGG + Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119525761 14:75321081-75321103 AGGGAGGAGCTGTTTCAGGCCGG + Intergenic
1120874652 14:89364472-89364494 TGGGATCAGCACCAACAGGCAGG + Intronic
1121450082 14:94001417-94001439 AGGGAGCAGCGGCGTAATGCTGG + Intergenic
1122170683 14:99872079-99872101 TGGGAGCAGGAGCAGCAGTCAGG + Intronic
1122500895 14:102198705-102198727 AGGGAGCAGGTGCACAAGGCAGG + Intronic
1122977669 14:105177584-105177606 AGGGAACAGCAACGTCAGGGAGG + Intronic
1202935722 14_KI270725v1_random:85957-85979 AGGAAGCAGATGCATGAGGCTGG - Intergenic
1124006700 15:25800540-25800562 AGGGAGCAGCAGCGCCCAGCAGG - Intronic
1124203980 15:27701840-27701862 CGGGAGCAGCAGCTTTGGGCAGG + Intergenic
1124373214 15:29115159-29115181 TGGGGACAGCAGCAGCAGGCCGG + Intronic
1124904840 15:33858659-33858681 AGCCAGCAGCAGGATCAGGTTGG + Intronic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125549725 15:40536469-40536491 ATGGAGCAGCAACAGCTGGCTGG - Intronic
1125831171 15:42718157-42718179 AGTGACCAACAGCATCAGCCTGG + Exonic
1128213121 15:65916103-65916125 AGGGCCCAGCAGCATCACCCAGG + Intronic
1128254299 15:66185682-66185704 AGGCAGCAGCGACATCAGGATGG + Intronic
1128622279 15:69160810-69160832 ACGGAGCAGCCGGAGCAGGCGGG + Intronic
1128904005 15:71451480-71451502 GGGGAGCAGCAGATGCAGGCAGG - Intronic
1129168157 15:73791069-73791091 AGAGAGCACAAGCAGCAGGCAGG - Intergenic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1129881006 15:79005960-79005982 ACTGAGCAGTAGCACCAGGCAGG + Intronic
1130889048 15:88117869-88117891 AGGAAGCAGAAGCCTGAGGCTGG - Intronic
1131163679 15:90126961-90126983 AGAGAGCAGCAGCCTTAGGAAGG + Intergenic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1133061799 16:3179793-3179815 AGGTACCAGCAGCACCACGCTGG + Intergenic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133175319 16:4010135-4010157 GGGGAGCCGTAGCCTCAGGCAGG - Intronic
1133345306 16:5065882-5065904 CAGGAGCAGCAGCCCCAGGCTGG + Exonic
1133746394 16:8690184-8690206 TGGCAGCAGCAGCATCTGCCTGG + Intronic
1134416807 16:14050675-14050697 AGCTAGCAGCAGCCTCTGGCTGG - Intergenic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136737493 16:32477109-32477131 AGGCAGCAGGAGCAAGAGGCAGG + Intergenic
1137440879 16:48497764-48497786 AGGAAGAAGCAGCAGCATGCAGG + Intergenic
1137483276 16:48870233-48870255 TGGAAGCAGCAGGATCAGTCAGG + Intergenic
1137614089 16:49836743-49836765 GGGGAGAAGGAGCATCAGGAGGG - Intronic
1137745604 16:50818033-50818055 AGGAAGCAGCAGCTACAGCCTGG - Intergenic
1137769482 16:51004582-51004604 AGAGAGCAGCAGCCTCACGAGGG - Intergenic
1137888150 16:52128606-52128628 AGGGATCAGGAGCCTCATGCTGG + Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138542326 16:57695940-57695962 AGGGAGCAGCAGATAAAGGCTGG - Intronic
1139241344 16:65395459-65395481 AGGCAGCAGCAGCATCACATGGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139373229 16:66480935-66480957 AGGGACCAGCAGGACCCGGCTGG - Exonic
1139519433 16:67472110-67472132 AGGCAGCAGCAGCAGCAAGCTGG + Intronic
1140146347 16:72314043-72314065 AGGGAGCACAAGAAACAGGCTGG + Intergenic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141948511 16:87325767-87325789 AGGAAGCAGCCGCAGCTGGCAGG + Intronic
1142010128 16:87709689-87709711 AGAGAGCAGCAGCTTCAGCGAGG + Intronic
1142045781 16:87924454-87924476 AGGCAGGAGCAGGCTCAGGCTGG + Intronic
1142256418 16:89015796-89015818 AGGGTGCAGGAGCCTCGGGCAGG - Intergenic
1142263296 16:89052347-89052369 AGGGCGTGGCAGCATCAGGGAGG - Intergenic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1203015578 16_KI270728v1_random:352468-352490 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1203033913 16_KI270728v1_random:625626-625648 AGGCAGCAGGAGCAAGAGGCAGG - Intergenic
1142614015 17:1124748-1124770 AGGGAGCACCAGGCCCAGGCTGG + Intronic
1143019685 17:3910685-3910707 AGGGAGCAGCAGCCTTGGGGAGG + Intronic
1143334697 17:6163410-6163432 AGGGAGGAGGAGCATCCGGGAGG + Intergenic
1143496437 17:7315276-7315298 AGGGAGCGGCAGCAGCGAGCCGG - Intronic
1143506274 17:7367324-7367346 AGGGAGCATCTCCTTCAGGCTGG - Intergenic
1143974093 17:10817388-10817410 AAGGGACAGCAGCATCCGGCAGG + Intergenic
1144022751 17:11251678-11251700 AGGGAACAGCAGAAGCAAGCTGG - Intronic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144450077 17:15369847-15369869 AGGGAGCGGCAGGTGCAGGCAGG - Intergenic
1144788708 17:17845827-17845849 AGGGAGCAGAAGGCCCAGGCAGG + Intronic
1145060140 17:19728037-19728059 AGAGAACTGCAGCATCAGGCAGG + Intergenic
1145212057 17:21021069-21021091 AGGGAACTGCAGGATCAAGCAGG + Intronic
1146607388 17:34272405-34272427 AGGGAGAGGCAGCCACAGGCTGG + Intergenic
1146832575 17:36082468-36082490 AGGGAACAACAGCAAAAGGCAGG + Intergenic
1146847055 17:36188780-36188802 AGGGAACAACAGCAAAAGGCAGG + Intronic
1146908565 17:36633329-36633351 AGGGAGGAGCAGCCTCAGCTTGG + Intergenic
1147388019 17:40093051-40093073 AGGGGGCAGCGGCAGAAGGCCGG + Exonic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147854430 17:43468113-43468135 AGGGAACAGGAGCATCTGTCAGG + Intergenic
1147925373 17:43942452-43942474 AGCGAGCACCTGCCTCAGGCCGG + Intronic
1148126379 17:45239379-45239401 TGGGAGCACCAGCCTCAGACAGG + Intronic
1149477855 17:56978124-56978146 CGGCAGCATCAGCAACAGGCTGG - Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1150641708 17:66953859-66953881 AGGGAGGAGGAGCCACAGGCTGG + Intergenic
1152287795 17:79422585-79422607 AGGGTCCAGCAGCCTCAGGCTGG + Intronic
1152844901 17:82593666-82593688 AGGGACCCGCAGCCTCAGCCCGG - Intronic
1152948858 17:83214477-83214499 AGGGAAAATCACCATCAGGCCGG + Intergenic
1154206882 18:12345110-12345132 AGGGTGCGCCAGCATCAGCCTGG - Intronic
1154485921 18:14871196-14871218 GGGGTGCAGCAGGACCAGGCAGG - Intergenic
1154493999 18:14942377-14942399 AGGAAGCGGCAGCCTGAGGCTGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1157589686 18:48828914-48828936 AGGGAGGAGGAGGAGCAGGCGGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158591917 18:58785182-58785204 AGGGAGAAGTGGGATCAGGCTGG - Intergenic
1158636220 18:59160734-59160756 AAGGACCAACAGCATCAGGGAGG - Intergenic
1158989599 18:62854991-62855013 AAAAAGCAGCAGGATCAGGCTGG - Intronic
1159041050 18:63322896-63322918 AGGGAACACCAGCCTGAGGCAGG + Intergenic
1160049312 18:75417236-75417258 AGGGAGCACCTGCCTCAGGAAGG + Intronic
1160367306 18:78337436-78337458 AGGTAGGAGCAGCAGGAGGCCGG - Intergenic
1160474491 18:79170142-79170164 AGGGAGGAGCTGCAGCCGGCCGG + Intronic
1160918354 19:1508226-1508248 AGGGAGGAGCAGGACCTGGCGGG + Intronic
1161590224 19:5126162-5126184 AGGGGGCATCAGCATCGGGGAGG + Intronic
1161644243 19:5443513-5443535 AGGGAGCACCTGACTCAGGCTGG + Intergenic
1161735159 19:5987698-5987720 TGGCAACAGCAGCAGCAGGCTGG - Intergenic
1162034625 19:7932367-7932389 AAGGAACAACAGCCTCAGGCAGG + Intronic
1162135561 19:8553101-8553123 AGGGAGCAGCTGCTCCAAGCAGG + Intronic
1162844624 19:13382710-13382732 AGGGAGCCGCAAGAGCAGGCTGG + Intronic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1164649631 19:29882553-29882575 AGGGAGCAGCTGCCTCCTGCCGG + Intergenic
1164762214 19:30736640-30736662 AGGTAACAGCAGCAACAGGATGG - Intergenic
1164834577 19:31349351-31349373 TGGGCGCAGCAGCATCCTGCGGG - Exonic
1165299723 19:34961141-34961163 AGCCCGCAGCAGCAACAGGCAGG + Intronic
1165710177 19:38005355-38005377 AGGGATCTGCAGGATGAGGCGGG - Intronic
1166240907 19:41493043-41493065 AGGGAGGTGGAGCAGCAGGCAGG + Intergenic
1167441616 19:49512641-49512663 AGGGAGCAGCAGCCTCCCACAGG + Exonic
1167587001 19:50380882-50380904 TGTGAGCAGCCCCATCAGGCAGG - Intronic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168492436 19:56821961-56821983 TGGGAGCAGAAGGATGAGGCAGG - Intronic
1168666512 19:58209062-58209084 AGGGTGCTCGAGCATCAGGCAGG + Intronic
924994371 2:343512-343534 AGGCAGCAGAAGCAAGAGGCAGG + Intergenic
925085041 2:1101204-1101226 AGGGGGCAGCAGGGGCAGGCAGG - Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
926684977 2:15691333-15691355 GTTGAGCAGCAGCTTCAGGCTGG + Intronic
926963903 2:18388626-18388648 TGGAAGCAACAGCACCAGGCTGG - Intergenic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
932740879 2:74290301-74290323 AGGCAGCAGCGGAAGCAGGCTGG - Intronic
933649627 2:84840112-84840134 TGGAAGCAGCAGCAGCAGGCAGG - Intronic
935091811 2:99901802-99901824 AGGGAGCAACATAATCAGACTGG - Intronic
935191421 2:100781721-100781743 AGGCTGATGCAGCATCAGGCTGG - Intergenic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
935532720 2:104254180-104254202 AGGGAACATCAGCATTAGTCTGG + Intergenic
936083860 2:109453247-109453269 AGGGAGCAATATGATCAGGCAGG - Intronic
936097448 2:109541838-109541860 ATGGAGCAGCCGGAGCAGGCTGG - Intergenic
936679698 2:114756314-114756336 GGGGATCTGCAACATCAGGCAGG + Intronic
937243210 2:120475779-120475801 GGGGAGCAGCAGCTCCAGGTTGG + Intergenic
937598247 2:123696149-123696171 AGAGAACAGCAGCATCAAGACGG + Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938421086 2:131147385-131147407 AGTGAGCAGCAGCAGCAGCTAGG - Exonic
942373370 2:175310273-175310295 AGGGAGATGCAGCATCAGCTCGG - Intergenic
942455392 2:176134992-176135014 AGGGAACCGCAGCAGCAGCCAGG - Intergenic
944135151 2:196391083-196391105 AGGGAGCACCAGCAAGAGACAGG + Intronic
944881672 2:204018988-204019010 AGGGTGCAGCAGCATCTGGAGGG + Intergenic
946587034 2:221201263-221201285 AGAGAACAGAAGCATCAGTCAGG - Intergenic
947204580 2:227648553-227648575 AAGCAGCAGCAGCACCAGGTAGG + Intergenic
947209959 2:227699508-227699530 AGGCAGCAGCAGCACCAGGTAGG + Exonic
947230807 2:227884668-227884690 AGCCAGCAGCATAATCAGGCCGG - Intronic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947878357 2:233482877-233482899 AGGGAGCTGCAGAATCCAGCAGG - Intronic
948124672 2:235556036-235556058 AGGGAGAAACAGCATCCTGCAGG + Intronic
948277440 2:236719857-236719879 CTTGAGCAGCAGCACCAGGCAGG + Intergenic
948710407 2:239821709-239821731 TGGGAGCATCAGCCCCAGGCAGG + Intergenic
948747961 2:240109589-240109611 AGGGAGCTGGAACATGAGGCCGG - Intergenic
948871115 2:240798706-240798728 GGGAAGCAGCAGCATCTGGCTGG - Intronic
948949219 2:241238238-241238260 AGGCAGCTGCAGCCTCTGGCTGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170673188 20:18454070-18454092 AGGGAGCAGCACATGCAGGCAGG + Intronic
1173120733 20:40286959-40286981 AGGGAGCCCCAGCCTCGGGCAGG + Intergenic
1173473241 20:43339480-43339502 AGGAACTAGCAGCATCAGTCAGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174515338 20:51087804-51087826 AGGGACCAGCAGCATGGGGATGG - Intergenic
1175388932 20:58614313-58614335 AGGGAGCTGCAGCCTCACGGTGG + Intergenic
1175401167 20:58700886-58700908 AGGGAGCACCAGGCTCAGGCAGG + Intronic
1175503312 20:59465456-59465478 AGGGAGCAGGGCCATCATGCTGG - Intergenic
1175714108 20:61244241-61244263 TGGAAGCAGCTGCTTCAGGCTGG - Intergenic
1175798866 20:61789490-61789512 AGGGAGAGGCCGCTTCAGGCAGG - Intronic
1175928913 20:62484458-62484480 TGGGGGCAGCAGCTTCAGGCCGG - Intergenic
1176025198 20:62982119-62982141 AGGAGGCAGCAGGAACAGGCTGG + Intergenic
1176360185 21:5988718-5988740 CAGCAGCAGCAGCATCTGGCAGG - Intergenic
1176795383 21:13368182-13368204 GGGGCGCAGCAGGACCAGGCAGG + Intergenic
1178061434 21:28857054-28857076 AGCCAGCAGCAGCAGCAGGCTGG + Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179157228 21:38861189-38861211 AGGGAGCCGCTGCATCCGCCAGG - Intergenic
1179560243 21:42211318-42211340 GGAGGGCAGCAGCATAAGGCTGG - Intronic
1179631579 21:42681979-42682001 AGTCAGGAGCAGCATCAGGCTGG + Intronic
1179763333 21:43549832-43549854 CAGCAGCAGCAGCATCTGGCAGG + Intronic
1179887572 21:44320914-44320936 AGGGAGGACCAGACTCAGGCTGG - Intronic
1180639951 22:17290447-17290469 AGGTTGCAGCAGCCTCTGGCTGG - Intergenic
1180646398 22:17342622-17342644 AGGGAGGACAAGCAGCAGGCAGG + Intergenic
1180979772 22:19873043-19873065 TGAGAGCAGCAGCGTCAGGTGGG - Intergenic
1181021712 22:20106966-20106988 AGGGAGCAGCAGGATTCTGCTGG - Intronic
1183096576 22:35555582-35555604 AGGGAGTGGCAGCAGCAGGCTGG - Intergenic
1183323685 22:37180221-37180243 AGGCAGGGGCAGGATCAGGCAGG + Exonic
1183706042 22:39475460-39475482 AGGGTGCAGGGGCATTAGGCAGG - Intronic
1183729123 22:39607340-39607362 AGGGAGCAGCAGGATCACTGGGG + Intronic
1184049249 22:41991955-41991977 AGGCAGGAAGAGCATCAGGCTGG + Intronic
1184103077 22:42351814-42351836 ATGGACCAGCAGTACCAGGCTGG + Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184892526 22:47388730-47388752 TGGGAGCAGCAGCATCTGGGAGG - Intergenic
1184924044 22:47625092-47625114 AGTGGGCAGCAGAGTCAGGCTGG + Intergenic
1184938287 22:47740741-47740763 GGGGCTCTGCAGCATCAGGCAGG - Intergenic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
949966556 3:9361725-9361747 TGGGAGGGTCAGCATCAGGCTGG - Intronic
950446645 3:13042590-13042612 AGACAGCAGCAGCATGAGCCGGG - Intronic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
950858534 3:16127465-16127487 AGGGAGGAGAAGAATCAAGCGGG - Intergenic
953098491 3:39802756-39802778 AGCCAGCAGCAGCAACCGGCTGG + Intergenic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
953983745 3:47426127-47426149 GGGGTGCAGAAGCATCAGGCGGG + Exonic
954366973 3:50151415-50151437 AGGGACCTGCAGCAGGAGGCCGG + Intergenic
954388431 3:50256522-50256544 AGGCTGCAGCCACATCAGGCAGG - Intronic
954771032 3:52969100-52969122 GGGGAGCAGCAGCTTGATGCAGG - Exonic
956836386 3:73099616-73099638 AGGCAGCAGCATCACCAGGAGGG - Intergenic
961001110 3:123374693-123374715 GGGGGGCAGCAGCATCTGTCTGG + Intronic
962070589 3:132029565-132029587 GGGGAGGAGCAAAATCAGGCTGG - Intronic
962352274 3:134664812-134664834 TCAGAGCAGCAGCTTCAGGCAGG - Intronic
962361843 3:134749380-134749402 AGGGACCAGCTGCAACAGGGAGG + Intronic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
963107563 3:141659989-141660011 TGGGAGCGGCGGCAACAGGCTGG + Intergenic
963269367 3:143270471-143270493 GGGGAGCTGCAGACTCAGGCTGG + Intronic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
964118547 3:153160652-153160674 AGGGAGCAGTGACATCAGGACGG + Intergenic
966350688 3:179030841-179030863 AGGGTGAAGCAGCATTAGGGTGG - Intronic
966853897 3:184181041-184181063 GGGGAGCAGCGGAGTCAGGCAGG - Intronic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
969462520 4:7336265-7336287 AGGGAGGAGAAGCATCCAGCGGG + Intronic
973272497 4:48275956-48275978 AGAGAGCATCAGGGTCAGGCTGG + Intergenic
975520008 4:75290363-75290385 CAGGAGCAGCTGCATCATGCCGG - Intergenic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976178125 4:82374322-82374344 CGGGAGCAGCAGCGTTAGGCCGG + Intronic
980219540 4:129898081-129898103 AGGGAGCAGGAGCAACAGGGAGG + Intergenic
981518308 4:145634368-145634390 AGGGAGCATCAGCAGTAGTCTGG - Intronic
982234700 4:153241622-153241644 AGGGAGCAGGAGCAACAGCAGGG + Intronic
985757055 5:1725430-1725452 TGGGAGGAGCTGCAGCAGGCGGG - Intergenic
985936547 5:3101909-3101931 AGGAAGCAGCAGCAACACTCAGG - Intergenic
986375309 5:7124925-7124947 AGGGAGGATCATCATCAGCCTGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
987920407 5:24272941-24272963 GGTGAGGAGCAGAATCAGGCGGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990855946 5:60266511-60266533 AGGGTGAAGCAGCAGCAGCCTGG - Intronic
991927465 5:71719334-71719356 AGGTAGCATCAGCAGCAGGGCGG - Exonic
991974443 5:72172258-72172280 TGGTAGTGGCAGCATCAGGCTGG - Intronic
992557208 5:77915670-77915692 AGGGAGCAGGTGCAGCCGGCTGG + Intergenic
993901224 5:93585135-93585157 GGCGAGCAGCAGCAGCAGGCGGG + Exonic
995471249 5:112504078-112504100 AAGGAGCAGCAGCTCCAGTCAGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996478685 5:123949363-123949385 TGAGAGCAGCACCAGCAGGCCGG + Intergenic
996967590 5:129323111-129323133 AGGTAGCAGCAGCAGTGGGCAGG + Intergenic
998774950 5:145588781-145588803 AGGCAGCACCAGCAGCAGCCAGG + Intronic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999411272 5:151351946-151351968 AGGCAGCAGCTGGATCATGCAGG - Intergenic
999639792 5:153661048-153661070 GAGGAGCAGCAGCATGGGGCTGG - Intronic
999786141 5:154892414-154892436 AGGGAGCTTCACCATCATGCAGG - Exonic
1001116675 5:168946374-168946396 ATGGGGCAGCAGCATTGGGCTGG + Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1002325056 5:178399213-178399235 AGGGAGGGGCAGCAGAAGGCAGG - Intronic
1002353269 5:178600748-178600770 AATGAGCAGCAGCAGCAAGCTGG + Intergenic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1002743065 5:181447940-181447962 AGGGAAAATCACCATCAGGCTGG + Intergenic
1002976762 6:2086517-2086539 GGGGAGGAGCAGCAGCATGCTGG - Intronic
1003105077 6:3209278-3209300 AGGCAGCAGCGGCATCAGCTGGG + Intergenic
1003816127 6:9842519-9842541 AGGGAGCAGCAGGACCCCGCTGG - Intronic
1004232637 6:13846956-13846978 GGGGAGCACCAGCGTCAGTCAGG + Intergenic
1005215197 6:23518513-23518535 TGGCAGCAGGAGCACCAGGCGGG - Intergenic
1006425061 6:33958607-33958629 AGGGAGCAGGGGAAACAGGCAGG + Intergenic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007341047 6:41191809-41191831 AGGGAGGAGCAGCCCCAGTCAGG + Exonic
1007622503 6:43223557-43223579 AGGGTCCAGCAGCATCAGGCAGG - Intronic
1007627535 6:43254881-43254903 AGGGAGCAGGGTCAGCAGGCGGG + Intronic
1007741232 6:44010791-44010813 AGGGTGCAGTAGCACTAGGCAGG + Intergenic
1011105874 6:83780780-83780802 AGGCAGCAGTAGAATAAGGCAGG - Intergenic
1011377678 6:86707049-86707071 TGTGACCAGCAGCAGCAGGCTGG - Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015769438 6:136753839-136753861 GGAGAACAGCAGCGTCAGGCAGG + Intronic
1019248164 6:170723353-170723375 AGGGAAAATCACCATCAGGCTGG + Intergenic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1020081458 7:5288163-5288185 AGGGACATGCAGCATCAGGGCGG - Intronic
1020288271 7:6703075-6703097 AGTGAGTGGCAGCATCAGGAAGG - Intronic
1020748672 7:12111801-12111823 AGGGATCAGAAGCAGGAGGCAGG - Intergenic
1021767092 7:23960706-23960728 AGGGTGCAGCAGCATTATCCAGG - Intergenic
1022526570 7:31041793-31041815 AGGTGGCAGAAGCATCAGGAAGG + Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022954194 7:35366494-35366516 AGAGAGCAGGAGCATCATTCGGG + Intergenic
1023795349 7:43787762-43787784 AGGAAGCCACAGCATCAGGATGG - Intronic
1023969092 7:44978450-44978472 AGGGAGCATCAACAACTGGCTGG + Intronic
1023983436 7:45082327-45082349 AGACAGCAGCAGCGGCAGGCTGG + Exonic
1024987119 7:55205126-55205148 AGGGAGCAGGAGCCTCGGGAGGG - Intronic
1025197450 7:56943985-56944007 AGGGACACGCAGCATCAGGGTGG + Intergenic
1025674497 7:63632954-63632976 AGGGACACGCAGCATCAGGGTGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026734450 7:72940878-72940900 AGGCAGGTGCAGCAGCAGGCAGG - Exonic
1026784782 7:73295786-73295808 AGGCAGGTGCAGCAGCAGGCAGG - Intergenic
1027109293 7:75424142-75424164 AGGCAGTTGCAGCAGCAGGCAGG + Exonic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027831988 7:83188774-83188796 AGGGAGTAGCAGAAACAAGCTGG + Intergenic
1028273818 7:88825779-88825801 AGTGAGCAGCATCATCATACAGG - Intronic
1028396868 7:90379361-90379383 AGGGAACATCAGCATCAGCTTGG - Intronic
1029152595 7:98491539-98491561 AGGCTGCAGCAGCTTGAGGCGGG + Intergenic
1029460128 7:100689512-100689534 TGGGAGCTGCAGCACCAAGCCGG - Intergenic
1029655686 7:101922874-101922896 AGGGAGCAGCAGCAGCTATCTGG + Intronic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1033204674 7:139408371-139408393 AAAAAGCAGCAGCATCAGGATGG + Intronic
1033265649 7:139884456-139884478 AGGGAGCTGGAGCAGCAGGAAGG + Intronic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1035499936 8:84360-84382 AGGGAAAATCACCATCAGGCTGG - Intergenic
1035896239 8:3405785-3405807 AGGGAGGATCTGCCTCAGGCTGG - Intronic
1036767679 8:11559043-11559065 AGGAAGCAGCAGCAGTGGGCAGG - Intronic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1037896358 8:22658930-22658952 AGGCAGCAGCTCCAGCAGGCTGG + Intronic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1038418858 8:27419141-27419163 AGGAAGCTGTGGCATCAGGCTGG + Intronic
1038465777 8:27761241-27761263 AGAGAGCTGCAGCAACAGCCTGG + Intronic
1040801678 8:51349226-51349248 AGGCAGGAGCAGCGTCAGGGTGG - Intronic
1042350436 8:67771960-67771982 AGAGGGCAGCATAATCAGGCAGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1044368338 8:91377283-91377305 AGGGGGCAGCACCAGCAGCCAGG - Intronic
1044923371 8:97188464-97188486 AGGGAACGGGAGCAGCAGGCAGG + Intergenic
1045416690 8:101974578-101974600 AGGGAGCGGCTTCAGCAGGCAGG - Intronic
1047192987 8:122695467-122695489 AGGGAGCAGGAGGATGAGGGGGG + Intergenic
1048174895 8:132142786-132142808 AGGTAGCAGCAGCTTCTGGCAGG - Intronic
1048224388 8:132570702-132570724 AAGGATCAGCTGCAGCAGGCTGG - Intergenic
1048236200 8:132693092-132693114 AGGTGGCTGCAGCAGCAGGCTGG + Intronic
1048860953 8:138724253-138724275 GGGGACCAGAAGCAACAGGCGGG - Intronic
1049231843 8:141488671-141488693 AGAGGCCAGCAGCATCAGCCCGG - Intergenic
1049663942 8:143834837-143834859 AGGGAGCAGCTGCCCCAGGGAGG + Exonic
1050052636 9:1619186-1619208 ACTGAACAGCAGCATGAGGCAGG + Intergenic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1050876926 9:10650980-10651002 AGGCTGCAGCATCATCATGCTGG + Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1053026108 9:34729710-34729732 AGAGAGCCGAGGCATCAGGCTGG - Intergenic
1053053716 9:34981228-34981250 AGGGAGCAGCAGGACCAGAAAGG - Exonic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1055728609 9:79258081-79258103 AGGAAGGAACAGCACCAGGCAGG + Intergenic
1057047567 9:91897970-91897992 AGGGAGAAGGAGCACCAGACGGG + Intronic
1057196716 9:93119672-93119694 AGGGAGGGGCGGCATCAGACTGG + Intergenic
1059337158 9:113576251-113576273 AGCCAGCAGCAGCATCACCCAGG - Intronic
1059423079 9:114205069-114205091 GGGAAGAAGCTGCATCAGGCAGG - Intronic
1059435133 9:114271520-114271542 AGGGAGCAGCAGGGTCAAGTTGG - Intronic
1059845929 9:118276431-118276453 AGGTAGCAGCTGGAGCAGGCTGG + Intergenic
1060141411 9:121213440-121213462 TGGGAGCAGTAGCCACAGGCTGG - Intronic
1060218543 9:121752608-121752630 AGGAAGCAGGAGTCTCAGGCAGG - Intronic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060972341 9:127745322-127745344 AGGCTGCAGCAGCCTCAGGGTGG - Intronic
1061374247 9:130214743-130214765 AGGAAGCTGGAACATCAGGCTGG + Intronic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1062007082 9:134244758-134244780 GGGGAGCAGCTCCATCATGCAGG + Intergenic
1062210191 9:135359450-135359472 AGGGATGAGGAGCCTCAGGCAGG + Intergenic
1062367238 9:136216714-136216736 AGGGAACAGCTGCATGAGGAAGG + Exonic
1203608948 Un_KI270748v1:78975-78997 AGGGAAAATCACCATCAGGCTGG + Intergenic
1185613815 X:1408379-1408401 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613881 X:1408799-1408821 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613898 X:1408904-1408926 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613912 X:1409009-1409031 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1185613978 X:1409429-1409451 TGGGAGTAGCAGCATTTGGCTGG - Intronic
1186209815 X:7238428-7238450 AGTTAGCAGCAGCAACAGGATGG + Intronic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1187337826 X:18396160-18396182 AGGGACTAGCAGCATCAGGAAGG - Intergenic
1187361113 X:18628526-18628548 CGGGAGCAGCAACATCCGGCAGG + Exonic
1187829991 X:23371328-23371350 AGAGAACAGCATCATGAGGCAGG + Intronic
1189170613 X:38905853-38905875 AGGTAGCATGAGCATTAGGCTGG + Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189627690 X:42916893-42916915 AACAAGCAGCAGAATCAGGCTGG + Intergenic
1190221631 X:48515800-48515822 AGGGTGGAGCAGGATCAGGGTGG + Intronic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192432843 X:71124364-71124386 AGGCAGCAGCAGCAGCAAGCTGG + Exonic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1198897439 X:141471334-141471356 AGGGAGTAGCTGCACCAGGAAGG - Intergenic
1199097500 X:143759526-143759548 AGGGTGCAGCAGCAACTGGCAGG + Intergenic
1200089759 X:153628914-153628936 AAAGGCCAGCAGCATCAGGCTGG + Intergenic
1200292709 X:154887189-154887211 GAGGAGCAGCAGCAGCACGCGGG - Exonic
1200339553 X:155382929-155382951 GAGGAGCAGCAGCAGCACGCGGG - Exonic
1200346917 X:155457764-155457786 GAGGAGCAGCAGCAGCACGCGGG + Exonic
1201286022 Y:12379414-12379436 AGGGAGCAGGAGTCTCAAGCAGG + Intergenic
1201582161 Y:15521038-15521060 AGTTAGCAGCAGCACCAGGAAGG + Intergenic