ID: 1027502766

View in Genome Browser
Species Human (GRCh38)
Location 7:78974771-78974793
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027502761_1027502766 -4 Left 1027502761 7:78974752-78974774 CCAAGCATTCCCATGCCCAACAG 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1027502766 7:78974771-78974793 ACAGTATCCTAGACACTGTATGG No data
1027502760_1027502766 26 Left 1027502760 7:78974722-78974744 CCTTATTAATCAGTCAAAAAGCT 0: 1
1: 0
2: 3
3: 16
4: 196
Right 1027502766 7:78974771-78974793 ACAGTATCCTAGACACTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr