ID: 1027506015

View in Genome Browser
Species Human (GRCh38)
Location 7:79017560-79017582
Sequence CCTAGTTAGGAACTGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 570}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027506015_1027506020 23 Left 1027506015 7:79017560-79017582 CCCAGCAACAGTTCCTAACTAGG 0: 1
1: 0
2: 4
3: 42
4: 570
Right 1027506020 7:79017606-79017628 ATAAAATTCAGAATATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027506015 Original CRISPR CCTAGTTAGGAACTGTTGCT GGG (reversed) Intronic
900497005 1:2980336-2980358 CCAAGCTAGGAACTGGGGCTGGG - Intergenic
902939508 1:19790082-19790104 CCTATTTAGTAAATGATGCTGGG + Intronic
903608034 1:24589323-24589345 CTTGGTTAACAACTGTTGCTGGG + Intronic
906586311 1:46982384-46982406 TCTAGTTAAGAACCATTGCTGGG + Intergenic
906993709 1:50766945-50766967 CCTGGTTAAGACCTATTGCTGGG - Intronic
907829618 1:58052277-58052299 CCTATTTAGTAAATGGTGCTGGG - Intronic
909240468 1:73206071-73206093 TCTTGTTAAGAACTATTGCTGGG - Intergenic
910514120 1:88038357-88038379 CCTAGTTAATAACCCTTGCTTGG - Intergenic
910820450 1:91339270-91339292 CCTGGTTAAGAACCATTGCTGGG - Intronic
912064520 1:105720198-105720220 CCTAGTTAATAAATGGTGCTGGG + Intergenic
912138140 1:106686429-106686451 TCTAGTTAAGAACTTTTTCTTGG + Intergenic
913699967 1:121364984-121365006 CCTACCTAGCAACTGTTGTTAGG - Intronic
913721359 1:121599426-121599448 CCTATTTAGTAAATGGTGCTGGG - Intergenic
914040514 1:144045426-144045448 CCTACCTAGCAACTGTTGTTAGG - Intergenic
914137573 1:144915053-144915075 CCTACCTAGCAACTGTTGTTAGG + Intronic
914404957 1:147361317-147361339 CCTATTTAGTAAATGGTGCTGGG + Intergenic
915635969 1:157186782-157186804 ACTGGTTAAGAGCTGTTGCTTGG - Intergenic
915648107 1:157288276-157288298 ACTGGTTAGGAGCTGCTGCTTGG + Intergenic
915815873 1:158963860-158963882 CCTGGTTAAGAACCCTTGCTGGG - Intronic
915975639 1:160385832-160385854 CCTATTTAGTAAATGGTGCTGGG - Intergenic
917003628 1:170387832-170387854 CCCAGTTAATAACTCTTGCTGGG + Intergenic
917260180 1:173158654-173158676 CCTATTTAAGAAATGGTGCTGGG + Intergenic
917490972 1:175498214-175498236 CATAGTAAGAAACTGTTGCCAGG + Intronic
917572551 1:176283437-176283459 CCTATTTAATAAATGTTGCTGGG - Intergenic
917574746 1:176309612-176309634 CCTATTTAAGAAATGGTGCTGGG - Intergenic
917712255 1:177697415-177697437 CCTAGTTAATAAATGGTGCTGGG + Intergenic
918861032 1:189826473-189826495 TCTGGTTAAGAACTATTGCTGGG - Intergenic
918948714 1:191106586-191106608 CCTATTCAGTAACTGGTGCTTGG - Intergenic
918998892 1:191801609-191801631 CCTATTTAATAACTGGTGCTGGG - Intergenic
919374865 1:196782035-196782057 CCTATTTAATAAATGTTGCTGGG - Intronic
920190750 1:204192155-204192177 CCAAGTCAGGAGCTGTGGCTTGG - Intronic
920487382 1:206383693-206383715 CCTACCTAGCAACTGTTGTTAGG - Intronic
922390193 1:225133458-225133480 CCTATTTAAGAAATGGTGCTGGG - Intronic
924887509 1:248235237-248235259 CCTATTTAGTAAATGGTGCTGGG - Intergenic
924918738 1:248603437-248603459 CCTATTTAGTAAGTGGTGCTGGG + Intergenic
1062933885 10:1371202-1371224 CCTAGTCAGTAAATGGTGCTGGG + Intronic
1062982661 10:1737857-1737879 ACTAGTTAAAAACTGTTGGTTGG - Intergenic
1064150562 10:12860503-12860525 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1064817710 10:19285485-19285507 CCTAGTTAATAAATGGTGCTGGG - Intronic
1064840137 10:19582455-19582477 CCTAGTTAATAAATGGTGCTGGG - Intronic
1064914158 10:20437969-20437991 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1064925024 10:20560331-20560353 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1065498440 10:26354203-26354225 CTTAGTAAGGAACTGGAGCTAGG - Intergenic
1065595229 10:27304133-27304155 CCTATTTAATAAATGTTGCTGGG + Intergenic
1066029396 10:31403781-31403803 CCTAGTTTGAAACTATTTCTTGG - Intronic
1066152376 10:32637462-32637484 CCTAGTTAATAAATGGTGCTGGG - Intronic
1066158168 10:32700287-32700309 CCTAGTTAATAAATGGTGCTAGG - Intronic
1066953229 10:42141234-42141256 CCTATTTAATAAATGTTGCTGGG - Intergenic
1067326326 10:45270705-45270727 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1067984463 10:51126870-51126892 CCTAGTTAATAAATGGTGCTGGG + Intronic
1068071888 10:52206426-52206448 CCTGGTTAAGAACCATTGCTTGG + Intronic
1068269381 10:54700340-54700362 CCTGGTTAAGAACCATTGCTGGG - Intronic
1068355517 10:55904433-55904455 CCTATTTAATAAATGTTGCTGGG + Intergenic
1068402898 10:56553361-56553383 CCTATTTAATAAATGTTGCTGGG - Intergenic
1068440981 10:57054387-57054409 CCTGGTTAAGAACTCTTGTTGGG - Intergenic
1068642268 10:59423252-59423274 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1068817429 10:61333507-61333529 CCTATTTAATAAATGTTGCTGGG - Intergenic
1069746624 10:70718994-70719016 CCTGGTTAAGAACTACTGCTTGG - Intronic
1070027663 10:72647605-72647627 CCTATTTAATAAATGTTGCTGGG - Intergenic
1071004452 10:80866425-80866447 CCTATTTAATAAATGTTGCTGGG - Intergenic
1071698033 10:87899057-87899079 CCTAGTTAATAAATGGTGCTGGG - Intronic
1071773309 10:88754642-88754664 TCTAGTATGAAACTGTTGCTTGG + Intergenic
1072026933 10:91468538-91468560 CCTGGTTAAGAACCATTGCTGGG - Intronic
1072839391 10:98753982-98754004 CCTGGTTAAGAACCATTGCTGGG - Intronic
1073268534 10:102242601-102242623 CCCAGTTAGGCTATGTTGCTTGG + Intergenic
1073954854 10:108858643-108858665 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1073974341 10:109084362-109084384 CCTATTCATGAAATGTTGCTGGG - Intergenic
1074297649 10:112205576-112205598 CCTATTTAATAAATGTTGCTGGG + Intronic
1075615170 10:123885365-123885387 CATCGTGAGGAACTGATGCTTGG + Intronic
1077700716 11:4439615-4439637 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1077841561 11:5981678-5981700 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1077952353 11:6974127-6974149 CCTATTTAAGAAATGGTGCTGGG - Intronic
1078395481 11:10977709-10977731 CCTATTCAGTAACTGGTGCTGGG + Intergenic
1078713909 11:13821243-13821265 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1078946346 11:16072061-16072083 CCTGGTTAAGAACCATTGCTGGG - Intronic
1079120717 11:17682734-17682756 CCCAGGTGGGACCTGTTGCTGGG + Intergenic
1079625175 11:22608489-22608511 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1081316926 11:41641398-41641420 CCCAGTTAAGAACCATTGCTGGG + Intergenic
1082147498 11:48687891-48687913 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1085130298 11:74032496-74032518 CCCAGTAAGGTACTGTTGATGGG - Intronic
1085215693 11:74828747-74828769 CCTATTTAGTAAGTGGTGCTGGG + Intronic
1085378750 11:76093068-76093090 CCTATTTAGTAAATGGTGCTGGG - Intronic
1085856323 11:80180597-80180619 CCTGGTTCAGAACTCTTGCTGGG + Intergenic
1085860996 11:80235633-80235655 CCTATTTAATAACTGATGCTGGG + Intergenic
1086514294 11:87593892-87593914 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1086785677 11:90967506-90967528 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1086811619 11:91317520-91317542 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1087110597 11:94462688-94462710 CCTATTTAGTAAATGGTGCTGGG + Intronic
1087322412 11:96679011-96679033 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1087918069 11:103832563-103832585 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1088414683 11:109575814-109575836 CCTATTTAATAAATGTTGCTGGG + Intergenic
1088507881 11:110543423-110543445 CCTAGTTAAGAGCTATTGCTGGG - Intergenic
1089677430 11:120099186-120099208 CCTAGGTAGGTACTGTGGATGGG - Intergenic
1090690769 11:129178701-129178723 CCTATTTAGTAAATGGTGCTGGG + Intronic
1091213047 11:133880338-133880360 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1092323641 12:7506197-7506219 CCTATTTAATAAATGTTGCTGGG - Intergenic
1092512803 12:9175220-9175242 CCTATTTAGTAAATGGTGCTGGG + Intronic
1092575761 12:9781425-9781447 CCTAGTTAAAAACAATTGCTGGG + Intergenic
1094481903 12:30890207-30890229 CCTATTTAATAAATGTTGCTGGG - Intergenic
1094877546 12:34668308-34668330 CCTATTTAATAAATGTTGCTGGG - Intergenic
1095146956 12:38741440-38741462 CCTATTTAATAAATGTTGCTGGG + Intronic
1096928836 12:55181469-55181491 CCTATTTAATAAATGTTGCTGGG - Intergenic
1096976697 12:55703499-55703521 CCTACTCAGGAACAGGTGCTGGG - Intronic
1097337391 12:58398186-58398208 CCTAGTCAATAAATGTTGCTGGG - Intergenic
1097426807 12:59455972-59455994 CATAGTCAGGAACTGATCCTGGG + Intergenic
1097498958 12:60378213-60378235 CCTTGTGAAGAACTTTTGCTAGG + Intergenic
1097910241 12:64961656-64961678 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1099575938 12:84381906-84381928 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1099697814 12:86043888-86043910 CCTTGTTAAGAACCATTGCTGGG + Intronic
1100066257 12:90649308-90649330 CCTATTTAGAAAATGGTGCTGGG - Intergenic
1100266307 12:92979387-92979409 GCCAGTTAAGAACCGTTGCTGGG - Intergenic
1100472375 12:94905085-94905107 CATAGATAGGGACTGTTACTGGG + Intronic
1101121558 12:101585978-101586000 CCTATTTAGTAAATGGTGCTGGG - Intronic
1101391568 12:104305307-104305329 CCTGGTTAGGAACCCTTTCTGGG - Intronic
1101471097 12:104998210-104998232 CCTGGTTAAGAACCATTGCTGGG + Intronic
1101513737 12:105415597-105415619 CCTAGTCAGTAAATGGTGCTGGG + Intergenic
1103018117 12:117511913-117511935 CCTTGCTGGGAACTGTTGCTGGG + Intronic
1104492238 12:129204158-129204180 CCTTGTTAAGAACCCTTGCTGGG - Intronic
1106147086 13:27059347-27059369 TCTAGTCAGGAACTGGTGATGGG + Intergenic
1107389258 13:39945952-39945974 CCTAGTTAAGAACCATTGCTTGG - Intergenic
1108315196 13:49230158-49230180 CCAACTTAGGAACTGCTACTGGG - Intergenic
1109663103 13:65491632-65491654 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1111178995 13:84636981-84637003 CCTGGTTAAGAACTATTGCTGGG - Intergenic
1111299335 13:86326249-86326271 CCTATTTAATAAATGTTGCTGGG + Intergenic
1111318650 13:86594600-86594622 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1111848523 13:93542256-93542278 CCTATTTAGTAAATGGTGCTGGG - Intronic
1112192128 13:97188290-97188312 CCCACTTAGGAACTGTTATTTGG - Intergenic
1112395729 13:99029098-99029120 CCTGGTGAAGAAGTGTTGCTGGG - Intronic
1113405994 13:110040921-110040943 CCTATTTAGCAAATGGTGCTGGG + Intergenic
1114708728 14:24755038-24755060 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG + Intergenic
1114951541 14:27760946-27760968 CCTAGTTAAGAACCCTTGCTGGG + Intergenic
1115008880 14:28520585-28520607 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1115915073 14:38302614-38302636 CCTGGTTAAGAACTATTGCTGGG - Intergenic
1116090238 14:40295478-40295500 TCTAGTTAAGAACCTTTGCTGGG + Intergenic
1116181529 14:41542316-41542338 TCCAGTTAGGAACCATTGCTGGG + Intergenic
1116418122 14:44702893-44702915 TCTTGTTAGAAACTGATGCTAGG + Intergenic
1116498572 14:45592563-45592585 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1116591521 14:46781660-46781682 TCTAGTTAAGAATTATTGCTGGG - Intergenic
1117014506 14:51505035-51505057 TCCAGTTAGGAATTGTTCCTTGG + Intronic
1118666308 14:68074543-68074565 TCTGGTTAGGAACCATTGCTGGG + Intronic
1124556866 15:30734434-30734456 CCTATTTAATAAATGTTGCTGGG + Intronic
1124569548 15:30849836-30849858 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1125830834 15:42716187-42716209 CCCAGTTAGGACCTTTAGCTTGG + Intronic
1125865150 15:43040358-43040380 CCTATTTAGTAAATGGTGCTGGG + Intronic
1126007406 15:44271229-44271251 CCAAGTTAAAAACTGTTTCTGGG + Intergenic
1126213792 15:46131621-46131643 CCTGGTTAAGAACAATTGCTGGG + Intergenic
1126233613 15:46355535-46355557 CCTGGTTAAGAACCCTTGCTGGG - Intergenic
1127003219 15:54534562-54534584 CCTGGTTAAGAACTATTGCTGGG - Intronic
1127021859 15:54756955-54756977 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1127097344 15:55526357-55526379 TCTGGTTAAGAACTATTGCTGGG + Intergenic
1127212547 15:56788844-56788866 CCTATTTAAGAAATGGTGCTGGG + Intronic
1130198386 15:81802707-81802729 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1130432800 15:83865521-83865543 CCTATTTAAGAAATGGTGCTGGG + Intronic
1130475750 15:84265333-84265355 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1130483170 15:84379387-84379409 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1130698202 15:86152423-86152445 CCTATTTAATAAATGTTGCTGGG + Intronic
1131568412 15:93506839-93506861 CCTAGTCCGGAGCTGTGGCTGGG + Intergenic
1131597676 15:93814277-93814299 CCTGGTTAAGAACCATTGCTTGG - Intergenic
1131711581 15:95061720-95061742 TCTAATTAAGAACTATTGCTGGG + Intergenic
1133786410 16:8977137-8977159 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1135800254 16:25488091-25488113 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1137079391 16:36027526-36027548 CCTATTTAATAAATGTTGCTGGG - Intergenic
1137323746 16:47412238-47412260 TCTGGTTAAGAAGTGTTGCTGGG - Intronic
1137363041 16:47837950-47837972 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1138463532 16:57169376-57169398 CTAAGTTAGGAACTGTTTCTAGG - Intronic
1139009833 16:62618087-62618109 CCTATTCAATAACTGTTGCTGGG + Intergenic
1139106863 16:63836333-63836355 CCTAGTTAAGAACCGTTGCTGGG - Intergenic
1139125269 16:64070310-64070332 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1140182273 16:72731913-72731935 CCTACTTAATAACTGGTGCTGGG - Intergenic
1149247573 17:54728713-54728735 TCTGATTAAGAACTGTTGCTGGG - Intergenic
1149352349 17:55803618-55803640 CCTATTTAGTAAATGGTGCTGGG + Intronic
1152042334 17:77912222-77912244 CCTATTTAATAAATGTTGCTGGG + Intergenic
1152902866 17:82954890-82954912 CCTATTTAGTAAATGGTGCTGGG + Intronic
1155463315 18:26108177-26108199 CCTAGTCAATAAATGTTGCTGGG - Intergenic
1155675955 18:28429254-28429276 ACTAGTTAAGCACTATTGCTGGG + Intergenic
1156073963 18:33249500-33249522 CCTATTTAGTAAATGGTGCTGGG - Intronic
1156079999 18:33320998-33321020 CCTATTTAGTAAATGATGCTGGG + Intronic
1156124085 18:33881963-33881985 CCTATTTAATAAATGTTGCTGGG + Intronic
1156582248 18:38391948-38391970 CCTTTTTAGCAAATGTTGCTTGG + Intergenic
1157853097 18:51076454-51076476 ACTAGTTAGGAAAGGTGGCTTGG - Intronic
1158689943 18:59651223-59651245 CTTACTTAGGAAGTGTTCCTTGG + Intronic
1159359265 18:67380480-67380502 CCTGGTTAAGAACCCTTGCTGGG + Intergenic
1159373389 18:67559280-67559302 CCTCCTTGGGAACTGGTGCTGGG - Intergenic
1159515601 18:69453816-69453838 CCTATTTAGTAAATGGTGCTGGG + Intronic
1163818971 19:19485347-19485369 CCCAGCTGGGCACTGTTGCTGGG + Intronic
1163973866 19:20829418-20829440 CCTATTTAATAACTGGTGCTGGG + Intronic
1164246177 19:23431361-23431383 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1164286539 19:23822265-23822287 CCCAGTTGGGATCTGTTTCTGGG + Intronic
1164487260 19:28669257-28669279 TCAAGTTAAGAAATGTTGCTTGG + Intergenic
1165326854 19:35118959-35118981 CCTAGTTAGGAGCAGCTGCTGGG + Intronic
1167772003 19:51526671-51526693 TCTGGTTAAGAACTTTTGCTGGG - Intronic
1168606054 19:57760714-57760736 TCTGGTTAGGAACTACTGCTGGG - Intergenic
925239836 2:2314935-2314957 CCTACTTAGTAAATGGTGCTAGG + Intronic
927042392 2:19242439-19242461 CAAAGTTAGCAATTGTTGCTTGG + Intergenic
927332108 2:21877845-21877867 CCTGGTTAAGAACCATTGCTGGG + Intergenic
927565212 2:24105588-24105610 CCCAGTTAAGAACCCTTGCTGGG - Intronic
928609204 2:32975918-32975940 CCTAGTTAAGGACCATTGCTGGG + Intronic
928817815 2:35320987-35321009 CCTATTTAATAAATGTTGCTGGG - Intergenic
928837397 2:35564296-35564318 CCTATTTAATAAATGTTGCTGGG - Intergenic
930100358 2:47598620-47598642 ACTAGTTTGGAATTGTTCCTGGG + Intergenic
930557909 2:52923077-52923099 CCTAGTTAATAAATGGTGCTGGG + Intergenic
930588507 2:53298847-53298869 CCTAGTTAATAAATGGTGCTGGG + Intergenic
930839269 2:55826962-55826984 CCTGGTTAAGAACCCTTGCTAGG - Intergenic
930885564 2:56322051-56322073 CCTATTTAATAAATGTTGCTGGG + Intronic
930931846 2:56894075-56894097 CCTATTTAGTAAATGGTGCTGGG - Intergenic
931549394 2:63425355-63425377 TCTGGTAAAGAACTGTTGCTAGG - Intronic
933083304 2:78022541-78022563 CCTCGTTAGTAAATGGTGCTGGG - Intergenic
933915606 2:86989753-86989775 CCTAGCTAGGAAATGATACTAGG + Intronic
934007387 2:87780149-87780171 CCTAGCTAGGAAATGATACTAGG - Intronic
934485808 2:94708754-94708776 CCTAGTTAAGAACCCTTGCTGGG - Intergenic
936118762 2:109724000-109724022 CCTAGTTAATAAATGGTGCTGGG - Intergenic
936367410 2:111870922-111870944 CCTATTTAGTAAATGGTGCTGGG - Intronic
936905356 2:117530131-117530153 CCTATTTAGTAAATGGTGCTGGG + Intergenic
936917406 2:117653956-117653978 CCTATTTAGTAAATGGTGCTGGG + Intergenic
937019137 2:118634163-118634185 CCTAGTTTGTCACTGTTCCTGGG + Intergenic
937173042 2:119896243-119896265 CCTTGGTAGAAACTGTAGCTTGG + Intronic
937586595 2:123558983-123559005 CCTATTCAGCAATTGTTGCTGGG - Intergenic
937633330 2:124127818-124127840 CCTATTTAATAAATGTTGCTGGG + Intronic
937722353 2:125116947-125116969 CCTAGTTCTGAACTTTTGCTCGG - Intergenic
937784348 2:125877744-125877766 CCTATTTAGTAAATGGTGCTGGG - Intergenic
938202235 2:129382506-129382528 CCTTTTTAATAACTGTTGCTAGG - Intergenic
938241976 2:129749192-129749214 TCTAGTTAGGATCCATTGCTTGG - Intergenic
938675436 2:133628895-133628917 CCTAGTCAGTAAATGGTGCTGGG + Intergenic
938990376 2:136622463-136622485 CCTGCTTAGGAACCATTGCTGGG + Intergenic
939077762 2:137624236-137624258 CCTATTTAATAACTGCTGCTGGG + Intronic
939122385 2:138133268-138133290 CCAAGTTAGGAAATGTCACTGGG - Intergenic
940538322 2:154976304-154976326 GCTAGTTAGCTACTGTTGCATGG + Intergenic
940708037 2:157127789-157127811 CCCAGTTAAGAACCCTTGCTGGG - Intergenic
942640319 2:178054256-178054278 CCTATTTAGCAAATGGTGCTGGG + Intronic
942696867 2:178656176-178656198 CCTATTTAGCAAATGGTGCTGGG + Intronic
942697306 2:178660436-178660458 CCTATTTAGCAAATGGTGCTGGG + Intronic
943250589 2:185517218-185517240 CCTATTTAAGAAATGGTGCTGGG - Intergenic
943979097 2:194523876-194523898 CCTATTTAGTAAATGGTGCTGGG + Intergenic
944270863 2:197784874-197784896 CCTAGATGGGGACTGTTGCCGGG + Intronic
945347009 2:208730890-208730912 CCTGGTTAAGAACCATTGCTGGG + Intronic
945761645 2:213922544-213922566 CCTGGTTAAGAACTCTTGCTGGG + Intronic
946226799 2:218268260-218268282 CTTAGTAAGAAACTGTTGCCAGG - Intronic
946454651 2:219814741-219814763 CCTATTTAAGAACTGGTGCTGGG - Intergenic
946468747 2:219936587-219936609 CCTACTTAAGAACTGGTGCTGGG + Intergenic
947885153 2:233563405-233563427 CCTAGGTAGGAACTCTTACTGGG + Intronic
948839900 2:240643705-240643727 CCCACTTAGGAGCTGTTCCTGGG + Intergenic
1168791504 20:580041-580063 CCTATTTAGCAAATGGTGCTGGG - Intergenic
1169508449 20:6239006-6239028 CCAAATTAGGAACTGATTCTGGG - Intergenic
1169577709 20:6984023-6984045 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1169862168 20:10164302-10164324 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1170053076 20:12168392-12168414 CCTAGTTAATAAATGCTGCTGGG - Intergenic
1170107733 20:12769568-12769590 CCTACTTAATAAATGTTGCTGGG + Intergenic
1171241903 20:23576739-23576761 CCTATTCAGGAAATGGTGCTGGG - Intergenic
1171352655 20:24516097-24516119 CCTATTTAATAACTGGTGCTGGG + Intronic
1171356871 20:24553543-24553565 CCTATTTAATAACTGGTGCTGGG - Intronic
1172700357 20:36849919-36849941 CCCAGCTGGGAGCTGTTGCTGGG - Intronic
1173319633 20:41975783-41975805 CCTAGTTACGTACAGTTGCTTGG + Intergenic
1173778051 20:45728166-45728188 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1176347889 21:5767773-5767795 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1176354703 21:5888357-5888379 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1176496938 21:7556682-7556704 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1176542210 21:8165843-8165865 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1176561161 21:8348888-8348910 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1177336372 21:19733734-19733756 CCTATTTAACAAATGTTGCTGGG - Intergenic
1178197856 21:30368840-30368862 CCTATTTAGTAAATGTTGCTGGG - Intronic
1179972942 21:44846360-44846382 TCTAGTTAGAAATTGTTTCTTGG + Intergenic
1180047410 21:45315327-45315349 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1180399271 22:12393743-12393765 CCTATTTAGTAAGTGGTGCTGGG + Intergenic
1180518139 22:16167905-16167927 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1203247151 22_KI270733v1_random:82260-82282 CCTAGTTAATAAATGGTGCTGGG - Intergenic
949594682 3:5531504-5531526 CCTGGTTAAGAACCATTGCTAGG + Intergenic
950184705 3:10937950-10937972 CCTGGCTAGGAAAGGTTGCTGGG - Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950444330 3:13027491-13027513 GCCAGGGAGGAACTGTTGCTTGG + Intronic
950605424 3:14074984-14075006 CCTATTTAGTAAATGGTGCTGGG + Intronic
950805311 3:15597892-15597914 GCTAGGTAAGAAATGTTGCTAGG + Intronic
951168022 3:19506172-19506194 CCCAGTTAGGAACCCTTGCTGGG + Intronic
951468660 3:23031650-23031672 CCTATTTAATAAATGTTGCTGGG - Intergenic
952629934 3:35453889-35453911 TCTAGTTAAGAACCATTGCTGGG - Intergenic
953027713 3:39154232-39154254 CCTAGTTTGGAACTTCTGCAGGG - Intronic
955423110 3:58759767-58759789 CCTATTTAAGAAATGGTGCTGGG - Intronic
957116242 3:76030599-76030621 CCTATTTAATAAATGTTGCTGGG - Intronic
958661846 3:97078627-97078649 CCTATTTAATAACTGGTGCTGGG - Intronic
958838507 3:99173499-99173521 CCTGGTTAAGAACCCTTGCTGGG - Intergenic
958953909 3:100446358-100446380 CCTATTTAAGAAATGGTGCTGGG + Intronic
959250302 3:103933382-103933404 CCTATTTAGTAAATGGTGCTGGG + Intergenic
959687521 3:109163709-109163731 CCTATTTAGTAAATGGTGCTGGG + Intergenic
960118835 3:113926525-113926547 CCTGGTTAAGAACCATTGCTGGG + Intronic
960762306 3:121086070-121086092 CCTATTTAATAAATGTTGCTGGG + Intronic
962655544 3:137541226-137541248 CCTGGTTAAGAACCATTGCTGGG + Intergenic
963615218 3:147528264-147528286 CTTGGTTAAGAACTATTGCTGGG + Intergenic
964296385 3:155239026-155239048 CCTGGTTAAGAACCATTGCTAGG + Intergenic
964439520 3:156692140-156692162 CATAATTGGGAACAGTTGCTGGG + Intronic
964860036 3:161191542-161191564 CCTATTTAACAAATGTTGCTGGG - Intronic
965015097 3:163147708-163147730 CCTATTTAATAAATGTTGCTGGG - Intergenic
967561932 3:190926418-190926440 CCTCGTTATGAACCATTGCTGGG + Intergenic
970632396 4:17964030-17964052 ACTAGTTAGGATCAGTAGCTAGG + Intronic
970995385 4:22261588-22261610 CCTATTTAAGAAATGGTGCTGGG + Intergenic
971480092 4:27106999-27107021 CCTATTTAAGAAATGGTGCTGGG + Intergenic
971729566 4:30360547-30360569 CCTGGTTAAGAACCATTGCTGGG + Intergenic
972140810 4:35957328-35957350 TCTGGTTAGGATCTATTGCTGGG + Intronic
972215206 4:36890489-36890511 TCTGGTTAAGAACTATTGCTGGG + Intergenic
972718494 4:41673149-41673171 CCTAGTTTTGTACTGTGGCTGGG - Intronic
972828143 4:42785576-42785598 CCTGGTTAAGAACCCTTGCTAGG + Intergenic
972972806 4:44597977-44597999 CCTATTTAATAAATGTTGCTGGG + Intergenic
972973218 4:44602954-44602976 CCTATTTAATAAATGTTGCTGGG - Intergenic
973013449 4:45106477-45106499 CCTATTTAATAAATGTTGCTGGG - Intergenic
973116356 4:46465024-46465046 CCTATTTAATAAATGTTGCTGGG - Intronic
974470637 4:62314151-62314173 CCTATTTAATAAATGTTGCTGGG + Intergenic
974621536 4:64361839-64361861 CTTGGTTAAGAACTATTGCTGGG - Intronic
974707773 4:65543982-65544004 CCTATTTAATAAATGTTGCTGGG + Intronic
974739965 4:65994530-65994552 CCTATTTAGTAAATGGTGCTGGG - Intergenic
975219024 4:71792893-71792915 CCTAGTTAATAAATGGTGCTGGG - Intronic
975236340 4:72001153-72001175 CCTAGTTAATAAATGGTGCTGGG + Intergenic
975500127 4:75075469-75075491 CCTAGTTAATAAATGGTGCTGGG - Intergenic
975678415 4:76850954-76850976 GATATTTAGGAACTGTGGCTGGG + Intergenic
975803499 4:78088186-78088208 CCTATTTAGTAAATGATGCTGGG + Intronic
976038685 4:80856636-80856658 CCTATTTAGTAAATGGTGCTGGG - Intronic
976655236 4:87481533-87481555 CCTTGATAGGAACTGTTCCTGGG - Intronic
977477146 4:97526908-97526930 CCTAGTTAATAAATGGTGCTGGG - Intronic
978044405 4:104108261-104108283 CCTATTTAATAAATGTTGCTTGG + Intergenic
978271434 4:106894469-106894491 CCTGGTTAAGAACCATTGCTGGG - Intergenic
978287271 4:107094195-107094217 TCTAGTTAAGAACCATTGCTGGG + Intronic
978658526 4:111095876-111095898 CCTATTTAATAACTGGTGCTGGG - Intergenic
978662744 4:111148277-111148299 CCTATTTAACAACTGGTGCTGGG - Intergenic
978772409 4:112470328-112470350 CCTATTTAGCAAATGTTACTGGG + Intergenic
978783328 4:112580185-112580207 CCTATTTAACAAATGTTGCTGGG + Intronic
978952784 4:114581549-114581571 CCTAGTTAAGAACTCTTGGCCGG + Intergenic
979096016 4:116552656-116552678 CCTGGTTAAGAACCATTGCTGGG + Intergenic
979186003 4:117794013-117794035 CCAAGTTATGAACTGTCTCTGGG + Intergenic
979298745 4:119063135-119063157 CCTATTTAATAAATGTTGCTGGG - Intergenic
979300228 4:119078533-119078555 CCTATTTAATAAATGTTGCTGGG + Intergenic
979553965 4:122023607-122023629 CCTAGTTAATAAATGGTGCTGGG + Intergenic
980312047 4:131143476-131143498 CCTATTTAATAACTGGTGCTGGG - Intergenic
980334577 4:131455088-131455110 CCTATTTAATAACTGGTGCTGGG - Intergenic
980685204 4:136219190-136219212 CCTGGTTAGGAACTTTTGCTGGG + Intergenic
980863187 4:138522898-138522920 ACTGGTTAAGAACTATTGCTGGG - Intergenic
981276077 4:142899873-142899895 CCTGGTTAGAAACCATTGCTGGG + Intergenic
981337434 4:143582642-143582664 CCTGGTTAAGAACCATTGCTGGG - Intronic
981450879 4:144896269-144896291 CCTATTTAGTAAATGGTGCTGGG + Intergenic
981453650 4:144928832-144928854 CCTATTTAGTAAATGGTGCTGGG - Intergenic
981752566 4:148106768-148106790 CCTATTTAGTAAATGGTGCTAGG + Intronic
981757469 4:148156020-148156042 CCTATTTAATAACTGGTGCTGGG + Intronic
982384750 4:154788419-154788441 CCTATTTAGTAAATGGTGCTGGG - Intronic
982670282 4:158313057-158313079 ACTAGTTAAGAACCATTGCTGGG + Intergenic
982845079 4:160242204-160242226 CCTATTTAATAAATGTTGCTGGG - Intergenic
983303287 4:165954939-165954961 TCTGGTTAGGAACCATTGCTGGG - Intronic
983487811 4:168352727-168352749 CGTAGTTAAGAACCATTGCTGGG + Intergenic
983791271 4:171800489-171800511 CCTATTTAATAAATGTTGCTGGG - Intergenic
984067261 4:175063226-175063248 ACTGGTTAAGAACTATTGCTGGG - Intergenic
984319186 4:178170004-178170026 CATAGTTAAGAATTCTTGCTGGG + Intergenic
985376862 4:189349967-189349989 CCTATTTAGTAAATGGTGCTGGG - Intergenic
985962306 5:3311847-3311869 TCTACTTAGTAACAGTTGCTAGG + Intergenic
986522179 5:8631590-8631612 CCTATTTAGTAAATGGTGCTGGG + Intergenic
986620501 5:9667903-9667925 CCTGGTTAAGAACCATTGCTGGG - Intronic
986940232 5:12939509-12939531 CCTATTTAGTAAATGGTGCTGGG + Intergenic
987395310 5:17417471-17417493 CCTATTTAGTAAATGGTGCTGGG - Intergenic
987399382 5:17459235-17459257 CCTATTCAGGAAATGGTGCTGGG - Intergenic
988023270 5:25651425-25651447 CCTATTTAATAAATGTTGCTGGG - Intergenic
988772112 5:34442869-34442891 CCTATTTAATAAATGTTGCTGGG - Intergenic
988929326 5:36020666-36020688 CCTATTCAGCAACTGGTGCTGGG - Intergenic
989085870 5:37675466-37675488 CCTACTTAAGAAATGGTGCTGGG - Intronic
989284504 5:39683748-39683770 CCTATTTAGCAACTAGTGCTGGG - Intergenic
989505948 5:42228135-42228157 CCTGGTTAGAAACCATTGCTGGG + Intergenic
989522014 5:42413544-42413566 CCTATTTAGTAAATGGTGCTGGG - Intergenic
989607629 5:43260011-43260033 CCTATTTAGTAAATGTTGCTGGG - Intronic
989958301 5:50380394-50380416 CCTATTTAATAAATGTTGCTGGG + Intergenic
990179632 5:53145971-53145993 CCTATTTAAGAAATGGTGCTGGG + Intergenic
990226495 5:53661233-53661255 CCTATTTAAGAAATGGTGCTGGG - Intronic
990913403 5:60877112-60877134 CCTATTTAGTAAATGGTGCTGGG - Intronic
991161160 5:63504920-63504942 CCTGGTTAAAAACTATTGCTGGG + Intergenic
991323661 5:65405378-65405400 CCTATTTAGTAAATGGTGCTGGG - Intronic
992280731 5:75174137-75174159 CCTATTTAGTAAATGGTGCTGGG + Intronic
992314176 5:75535960-75535982 CCTAGTTAAGAACCATTGCCTGG + Intronic
992965703 5:81997518-81997540 CCTAGTTAAGAACCATTGCTGGG - Intronic
993163372 5:84318565-84318587 CCTATTTAATAACTGGTGCTGGG + Intronic
993233988 5:85279198-85279220 CCTATTTAACAAATGTTGCTGGG + Intergenic
993246289 5:85457819-85457841 TCTGGTTAGGAACTATTGCTGGG + Intergenic
993433474 5:87861745-87861767 CCTATTTAATAAATGTTGCTGGG + Intergenic
993794833 5:92253993-92254015 CCTATTTAGCAAGTGGTGCTAGG + Intergenic
993797011 5:92280334-92280356 CCTATTCAGGAAATGTTGTTGGG + Intergenic
993804490 5:92387616-92387638 CCTATTTAATAAATGTTGCTGGG + Intergenic
994405523 5:99340847-99340869 CCTATTTAAGAAATGGTGCTGGG - Intergenic
994550849 5:101233037-101233059 CCTATTTAAGAAATGGTGCTGGG - Intergenic
994558246 5:101331664-101331686 CCTTGTTAAGAACCATTGCTGGG - Intergenic
995257852 5:110067871-110067893 CCTATTTAGTAAATGCTGCTGGG - Intergenic
995309750 5:110697206-110697228 CCTATTTAAGAAATGGTGCTGGG + Intronic
995489402 5:112674726-112674748 CCTATTTAAGAAATGGTGCTGGG - Intergenic
995529616 5:113079566-113079588 CCTAGTTAATAAATGGTGCTGGG + Intronic
995673939 5:114641109-114641131 CCTATTTAAGAAATGGTGCTGGG + Intergenic
995677200 5:114675645-114675667 CCTATTTAAGAAATGGTGCTGGG + Intergenic
995693101 5:114849300-114849322 CCTATTTAAGAAATGGTGCTGGG + Intergenic
995697161 5:114892480-114892502 CCTATTTAAGAAATGGTGCTGGG - Intergenic
995812787 5:116126683-116126705 CCTATTTAATAAATGTTGCTGGG + Intronic
995852942 5:116565434-116565456 CCTAGCTAGACACTGTCGCTGGG - Intronic
996036695 5:118766334-118766356 CCTATTTAATAAATGTTGCTGGG + Intergenic
996245755 5:121262599-121262621 CTTAGTTAGAAACCATTGCTGGG + Intergenic
996289122 5:121830290-121830312 CCTATTTAGTAAATGTTACTGGG - Intergenic
996894273 5:128460766-128460788 CCTAATTAGTAAATGGTGCTGGG + Intronic
997805595 5:136914108-136914130 CCTATTTAATAAATGTTGCTGGG - Intergenic
998776443 5:145609278-145609300 ACTAGTTAAGAACCATTGCTGGG + Intronic
999416829 5:151405573-151405595 TCTAGTTAGGATCCTTTGCTGGG + Intergenic
1002010360 5:176274738-176274760 CCTAGTTAATAAATGGTGCTGGG - Intronic
1002010652 5:176277681-176277703 CCTAGTTAATAAATGGTGCTGGG - Intronic
1003686550 6:8309910-8309932 CCTAGTCAGTAAATGGTGCTGGG - Intergenic
1004352243 6:14900372-14900394 CCCTGTTAGGAAATGGTGCTGGG + Intergenic
1004840223 6:19575661-19575683 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1005151895 6:22761250-22761272 CCTAGTTAATAATTGATGCTGGG - Intergenic
1005193469 6:23255519-23255541 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1005373944 6:25163077-25163099 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1005426941 6:25712810-25712832 TCTAGTTAGCAACTGATCCTTGG + Intergenic
1006198671 6:32265657-32265679 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1006286383 6:33097638-33097660 CTTAGTTTGGATCTATTGCTGGG - Intergenic
1007188933 6:39997237-39997259 CCCAGTTAGGATCTGTCTCTGGG + Intergenic
1008716333 6:54294615-54294637 CCTGGTTAAGAACCGTTGTTAGG + Intergenic
1009289628 6:61867477-61867499 CCCAGTTCTGAACTCTTGCTAGG + Intronic
1009355767 6:62741419-62741441 GCTAGTTAAGAACCATTGCTGGG - Intergenic
1009664033 6:66653088-66653110 CCTAGTTAACAAATGGTGCTGGG - Intergenic
1009708686 6:67289471-67289493 CCTATTTAATAAATGTTGCTGGG + Intergenic
1010178003 6:73051871-73051893 CCTGGTTAAGAACCATTGCTGGG - Intronic
1010272236 6:73927592-73927614 CCTGGTTAAGAACTGCTGCTGGG - Intergenic
1010867756 6:81001010-81001032 CCTATTTAGTAAATGATGCTGGG - Intergenic
1010883506 6:81209219-81209241 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1010898759 6:81400039-81400061 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1011436605 6:87344793-87344815 CTTACTTGGCAACTGTTGCTAGG - Intronic
1011788556 6:90873055-90873077 CCTTACTAAGAACTGTTGCTGGG - Intergenic
1012243742 6:96902819-96902841 CCTATTTAATAAATGTTGCTGGG - Intergenic
1012251903 6:96990106-96990128 CCTGGTTAAGAACACTTGCTGGG + Intronic
1013556776 6:111264311-111264333 CCAAGTTTGGAACTGTTATTTGG + Intronic
1013727265 6:113114202-113114224 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1014085235 6:117334750-117334772 CCTATTTAGTAAATGGTGCTGGG + Intronic
1014367459 6:120562585-120562607 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1014520637 6:122438412-122438434 CCTGGTTAAGAACCCTTGCTGGG - Intergenic
1015226774 6:130866053-130866075 CCTGGTCAGGTTCTGTTGCTTGG - Intronic
1015725862 6:136298708-136298730 CCTAATTATAAACTGCTGCTAGG + Intergenic
1015861364 6:137683751-137683773 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1017360636 6:153564998-153565020 CCAAGATAGAAACTGTTTCTGGG - Intergenic
1017411952 6:154177046-154177068 CCTATTTAATAAATGTTGCTGGG + Intronic
1017733822 6:157342069-157342091 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1017762670 6:157583235-157583257 CCTGGTTAAGAACCCTTGCTGGG + Intronic
1018147059 6:160901163-160901185 TCTGGTTAGGAACCATTGCTGGG - Intergenic
1019072619 6:169361224-169361246 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1020513891 7:9091785-9091807 CCGAGTTAAGAACCCTTGCTGGG - Intergenic
1020549778 7:9588628-9588650 CCTGGTTCCGAACTATTGCTGGG - Intergenic
1020659076 7:10961310-10961332 CCTATTTAATAAATGTTGCTGGG - Intergenic
1020899462 7:13987473-13987495 TCTTTTTATGAACTGTTGCTAGG - Intronic
1021366349 7:19784193-19784215 CCTAGTTAGGAACCACTGCTGGG - Intergenic
1021766240 7:23952069-23952091 CCTATTTAATAAATGTTGCTGGG + Intergenic
1022676122 7:32500839-32500861 CCTATTTAATAACTGGTGCTGGG - Intronic
1022999141 7:35789522-35789544 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1023075851 7:36482368-36482390 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1023290301 7:38661018-38661040 TTTAGTTAGGGACTATTGCTGGG - Intergenic
1024341037 7:48260128-48260150 CCTGGTTAAGAACATTTGCTGGG + Intronic
1024445929 7:49479099-49479121 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1024615939 7:51111813-51111835 CCTAGTTGTGAACACTTGCTGGG - Intronic
1025311270 7:57945169-57945191 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1025598973 7:62970916-62970938 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1027495561 7:78883763-78883785 CCTATTTAATAACTGGTGCTGGG + Intronic
1027506015 7:79017560-79017582 CCTAGTTAGGAACTGTTGCTGGG - Intronic
1027997123 7:85438522-85438544 CCTATTTAATAAATGTTGCTGGG - Intergenic
1028053963 7:86220763-86220785 CCCAGTTAACAACTCTTGCTGGG - Intergenic
1028211738 7:88082245-88082267 CCTATTTAGTAAATGGTGCTGGG + Intronic
1028258580 7:88632303-88632325 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1028347156 7:89797648-89797670 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1028353314 7:89876904-89876926 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1028802553 7:94983051-94983073 CCTATTTAATAAATGTTGCTGGG - Intronic
1028917415 7:96274741-96274763 CCTATTTAGTAAATGGTGCTGGG - Intronic
1029951240 7:104588349-104588371 CCTATTTAGTAAATGGTGCTGGG - Intronic
1030426499 7:109385417-109385439 CCTATTTAGCAAATGTTGCTGGG + Intergenic
1030507719 7:110445649-110445671 CCCACTTAGGATCTGGTGCTGGG - Intergenic
1031097037 7:117432671-117432693 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1031172004 7:118303857-118303879 CCTATTTAATAAATGTTGCTGGG - Intergenic
1031294507 7:119984279-119984301 CCTGGTTAATAACTATTGCTAGG - Intergenic
1031300863 7:120059778-120059800 CCCAGTGAGGATCTGTTTCTGGG + Intergenic
1031455223 7:121971035-121971057 CCTATTTAAGAAATGGTGCTGGG - Intronic
1031469555 7:122152910-122152932 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1031669413 7:124524687-124524709 CCTGGTTATGAACCATTGCTAGG + Intergenic
1032563020 7:132912300-132912322 TCTGGTTAGTAACTGTTGCCTGG + Intronic
1032879600 7:136075008-136075030 TCTAGTTACCAAGTGTTGCTAGG + Intergenic
1037056055 8:14443569-14443591 CCTATTTAAGAAATGGTGCTGGG + Intronic
1038866511 8:31444284-31444306 CCTATTTAAGAAATGGTGCTGGG + Intergenic
1038990357 8:32860539-32860561 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1039371462 8:36988087-36988109 CTTAGTGATGAAATGTTGCTGGG + Intergenic
1040321518 8:46310538-46310560 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1041891593 8:62875736-62875758 CCTATTCAGGAAATGGTGCTTGG + Intronic
1042629674 8:70803458-70803480 CCTGGTTAAGAATTATTGCTGGG + Intergenic
1043048380 8:75355533-75355555 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1043498374 8:80827830-80827852 CCTATTTAGTAAATGGTGCTGGG + Intronic
1045586649 8:103545017-103545039 CCTGGTTAAGAACCATTGCTGGG - Intronic
1045705022 8:104912429-104912451 CCTATTTAATAAATGTTGCTGGG - Intronic
1046049426 8:109004072-109004094 CCCAGTTAGGCAATGTGGCTGGG + Intergenic
1046122484 8:109863525-109863547 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1046145345 8:110151112-110151134 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1046286159 8:112095077-112095099 CCTATTTAGCAAATGGTGCTGGG + Intergenic
1046454661 8:114441738-114441760 ACTGGTTAAGAACTATTGCTTGG - Intergenic
1046596886 8:116271989-116272011 CCTAGTTAATAACCATTGCTGGG + Intergenic
1046960057 8:120102108-120102130 CCTGGTTAAGAACCTTTGCTGGG + Intronic
1047159462 8:122361342-122361364 CCTAGTTAAGAACCATTGCAGGG + Intergenic
1047356925 8:124130483-124130505 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1047938512 8:129804965-129804987 CCTAATCAGGACCTGTTTCTGGG + Intergenic
1048727377 8:137401431-137401453 CCTAGTTAAGAACCATTGCTGGG - Intergenic
1051090055 9:13396039-13396061 ACTATTTAGGAACTGTTCCTAGG + Intergenic
1051120704 9:13749068-13749090 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1051891444 9:21946159-21946181 CCTAGTTAAGGACCCTTGCTGGG - Intronic
1051981537 9:23025508-23025530 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1052146698 9:25059381-25059403 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1052239523 9:26254540-26254562 CCTATTTAATAAATGTTGCTGGG + Intergenic
1052263170 9:26540923-26540945 CCCAGTTAAGAACCCTTGCTGGG - Intergenic
1052605951 9:30700975-30700997 CCTAGTCAATAACTGGTGCTGGG - Intergenic
1053671982 9:40375567-40375589 CCTAGTTAAGAACCCTTGCTGGG + Intergenic
1053921795 9:43001929-43001951 CCTAGTTAAGAACCCTTGCTGGG + Intergenic
1054383095 9:64515615-64515637 CCTAGTTAAGAACCCTTGCTGGG + Intergenic
1054512641 9:66000743-66000765 CCTAGTTAAGAACCCTTGCTGGG - Intergenic
1054966059 9:71027436-71027458 CCCAGTTAAGAACCCTTGCTGGG - Intronic
1056862314 9:90197084-90197106 CCTATTTAATAAATGTTGCTGGG + Intergenic
1058243404 9:102596099-102596121 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1058258017 9:102793408-102793430 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1058572074 9:106357980-106358002 CCTGGTTAAGAACCATTGCTTGG + Intergenic
1058583072 9:106479974-106479996 CCTAGTTAGGATGAGTTGCTTGG - Intergenic
1058916307 9:109569101-109569123 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1059868764 9:118546863-118546885 CTTGATTAAGAACTGTTGCTGGG - Intergenic
1060168041 9:121436306-121436328 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1203463485 Un_GL000220v1:65321-65343 CCTAGTTAATAAATGGTGCTGGG - Intergenic
1203380509 Un_KI270435v1:33124-33146 CCTATTTAGTAAGTGGTGCTAGG + Intergenic
1185988275 X:4861518-4861540 AGTAGTTGGGAACTGGTGCTTGG - Intergenic
1186177220 X:6937390-6937412 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1186236012 X:7510416-7510438 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1186857692 X:13641392-13641414 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1187596260 X:20776074-20776096 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1187641194 X:21292156-21292178 CCTAGTTAAGAACCATTGCTTGG + Intergenic
1188139284 X:26528543-26528565 CCTAGTCAGTAAATGGTGCTAGG - Intergenic
1188291114 X:28390148-28390170 CCTATTTAATAAATGTTGCTGGG + Intergenic
1188362478 X:29273150-29273172 CCTAGTTAAAAACCATTGCTGGG + Intronic
1188826880 X:34846104-34846126 CCTATTCAGTAAATGTTGCTGGG - Intergenic
1188837788 X:34979260-34979282 CCTGGTTAGGAACCATTGCTAGG - Intergenic
1188845922 X:35072012-35072034 CCTATTTAGTAAATGGTGCTTGG + Intergenic
1188998421 X:36915165-36915187 CCTATTTAATAAATGTTGCTGGG + Intergenic
1189009221 X:37029581-37029603 CCTATTTAACAAATGTTGCTGGG + Intergenic
1189583787 X:42435840-42435862 CCTGGTTAAGAACTGTTGCTGGG - Intergenic
1189704616 X:43747566-43747588 TCTAGTGAGGAACTGTAGCTGGG + Intergenic
1189897902 X:45674324-45674346 CCTGGTTAAGAACAATTGCTGGG - Intergenic
1189926553 X:45960639-45960661 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1190391712 X:49938547-49938569 CCTAGTTAATAAATGGTGCTGGG + Intronic
1190392244 X:49943635-49943657 CCTAGTTAATAAATGGTGCTGGG - Intronic
1190400819 X:50032953-50032975 CCTAGTTAATAAATGGTGCTGGG - Intronic
1190841090 X:54145074-54145096 CCTAGTTAATAAATGATGCTGGG + Intronic
1190970583 X:55343612-55343634 TCTGGTTAGGATCCGTTGCTAGG - Intergenic
1191062102 X:56309771-56309793 CCTGATTAAGAACTTTTGCTTGG + Intergenic
1191130608 X:57004939-57004961 CCTACTCAGTAAATGTTGCTAGG - Intergenic
1191186488 X:57618630-57618652 CCTATTCAGTAAATGTTGCTGGG + Intergenic
1191613858 X:63146577-63146599 CCTATTTAGTAAATGGTGCTAGG + Intergenic
1191622438 X:63232350-63232372 CCTATTTAGTAAATGGTGCTAGG - Intergenic
1191654226 X:63578089-63578111 CCTGGTTAAGAACCATTGCTGGG - Intergenic
1191685600 X:63886009-63886031 CCTAGTTAAGAGCCATTGCTGGG - Intergenic
1191698309 X:64012917-64012939 CCTAGTTAATAAATGGTGCTGGG + Intergenic
1192199507 X:69057039-69057061 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1192523392 X:71821582-71821604 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1192690009 X:73353003-73353025 CCTGGTTAAGAACCGTTGCTGGG + Intergenic
1192691615 X:73371486-73371508 CCTGGTTAAGAACCATTGCTGGG + Intergenic
1192756430 X:74050652-74050674 CCTAGTTACGTACTATTGCTGGG - Intergenic
1192788395 X:74355543-74355565 CCTGGTGTGGAACTGTTGGTTGG - Intergenic
1192866044 X:75132959-75132981 CCTGGTTAAGAACCATTGCTAGG - Intronic
1192872014 X:75193973-75193995 CCTGGTTAAGAACTATTTCTGGG + Intergenic
1192980907 X:76340257-76340279 CCTATTTAATAAATGTTGCTGGG + Intergenic
1193015759 X:76732020-76732042 CCTATTTAACAAATGTTGCTCGG + Intergenic
1193044666 X:77039499-77039521 CCTATTTAATAAATGTTGCTGGG + Intergenic
1193050469 X:77094162-77094184 CCTATTTAGTAAATGTTGCTGGG + Intergenic
1193060640 X:77203233-77203255 CCTATTTAATAAATGTTGCTGGG - Intergenic
1193089976 X:77483217-77483239 ACTAGTTAAGAACTATTGCTGGG - Intergenic
1193215151 X:78855204-78855226 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1193309677 X:79991039-79991061 CCTATTTAATAAATGTTGCTGGG + Intergenic
1193316782 X:80074315-80074337 CCTTGTTAAGAATTCTTGCTGGG + Intergenic
1193464170 X:81827132-81827154 CCTATTTAAGAAATGGTGCTGGG + Intergenic
1193494890 X:82199065-82199087 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1193551634 X:82900161-82900183 CCTTGTTAAGAACTATTGTTTGG - Intergenic
1193553142 X:82924068-82924090 CCTGGTTATGAACCATTGCTGGG + Intergenic
1193583829 X:83295911-83295933 CCTAGCTAGGAACCATAGCTGGG - Intergenic
1193638802 X:83985725-83985747 CCTTGTTAAAAACTTTTGCTGGG - Intergenic
1193749503 X:85325691-85325713 CCTGGTTAGGAACCATTGCTGGG + Intronic
1193771066 X:85588046-85588068 CCTATTTAGTAAATGGTGCTTGG + Intergenic
1193814738 X:86091104-86091126 CCTGGTTAAGAACTATTGTTGGG + Intergenic
1193910724 X:87302942-87302964 CCTATTCAGTAAATGTTGCTGGG - Intergenic
1193967379 X:88005493-88005515 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1193992488 X:88325093-88325115 CCTATTTAATAAATGTTGCTGGG - Intergenic
1194281077 X:91955186-91955208 CCTATTTAATAACTGGTGCTGGG - Intronic
1194434607 X:93855328-93855350 TCTGGTTAAGAACTATTGCTGGG + Intergenic
1194519436 X:94900897-94900919 CCTGGTTAGGAGCCATTGCTGGG + Intergenic
1194544329 X:95214066-95214088 CCTACTTAGTAAATGGTGCTGGG - Intergenic
1194755136 X:97730476-97730498 TTGAGTTAGGAACAGTTGCTTGG - Intergenic
1194982112 X:100451137-100451159 CCTAGTTAAGAACCATTGCTGGG - Intergenic
1195170983 X:102268198-102268220 CCTATTTTGGAAATGGTGCTGGG + Intergenic
1195173243 X:102289654-102289676 CCTATTTTGGAAATGGTGCTGGG - Intergenic
1195185622 X:102397442-102397464 CCTATTTTGGAAATGGTGCTGGG + Intronic
1195187877 X:102418901-102418923 CCTATTTTGGAAATGGTGCTGGG - Intronic
1195241611 X:102958657-102958679 CCTGGTTAGGAAACATTGCTGGG + Intergenic
1196139154 X:112241928-112241950 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1196146614 X:112325559-112325581 CCTATTTAAGAAATGGTGCTGGG + Intergenic
1196167052 X:112547039-112547061 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1196234158 X:113260349-113260371 CCTGGTTAAGAACCCTTGCTGGG + Intergenic
1196537483 X:116864527-116864549 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1196984777 X:121256306-121256328 CCTAGTTGGAAACTAGTGCTAGG - Intergenic
1197562870 X:128046607-128046629 CCTGGTTAAGAACTATTGCAGGG + Intergenic
1197680315 X:129375786-129375808 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1197823924 X:130568902-130568924 CCTATTTAAGAAATGGTGCTGGG - Intergenic
1197950147 X:131886120-131886142 CCTCTTTAGTAAATGTTGCTGGG - Intergenic
1198296932 X:135296142-135296164 CCAAGTTAGGAACTGTCCCGGGG + Intronic
1198773228 X:140152697-140152719 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1199245686 X:145600772-145600794 CCCAGTTAAGTACTCTTGCTGGG - Intergenic
1199387924 X:147244864-147244886 CCTATTTAGTAAATGGTGCTGGG + Intergenic
1199640890 X:149859651-149859673 CCTGGTTAGGAACTATTGCTGGG - Intergenic
1199913122 X:152308774-152308796 CCTGGTTAGGAACCATTTCTGGG - Intronic
1200574522 Y:4871269-4871291 CCTATTTAGGTAATGGTGCTGGG + Intergenic
1200598671 Y:5179855-5179877 CCTATTTAATAACTGGTGCTGGG - Intronic
1200867134 Y:8056728-8056750 CCTATTTAGCAAATGGTGCTGGG - Intergenic
1201080258 Y:10237322-10237344 CCTATTTAAGAAATGTTGCTGGG - Intergenic
1201080442 Y:10239411-10239433 CCTATTTAGTAAATGGTGCTGGG - Intergenic
1201337289 Y:12894573-12894595 GCTAGTTGAGAACTGGTGCTCGG - Intergenic
1201599994 Y:15717900-15717922 CCTAGTTAATAAATGCTGCTGGG + Intergenic
1201783739 Y:17750680-17750702 CCTATTTAGCAAATGGTGCTGGG + Intergenic
1201817814 Y:18155307-18155329 CCTATTTAGCAAATGGTGCTGGG - Intergenic
1202191130 Y:22246894-22246916 CTCAGTTAGAAACTGATGCTGGG - Intergenic