ID: 1027507832

View in Genome Browser
Species Human (GRCh38)
Location 7:79040272-79040294
Sequence GGCCTCCGGAAACACAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 8, 2: 58, 3: 135, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027507832 Original CRISPR GGCCTCCGGAAACACAGTCA TGG (reversed) Intronic
900078953 1:841352-841374 GGCCTCAAGAATCACAGTCCAGG + Intergenic
903546303 1:24125505-24125527 GACGTCAGGATACACAGTCAAGG + Intronic
904344222 1:29857529-29857551 GGCCTCCTGACACCCAGTCCAGG - Intergenic
906187930 1:43875685-43875707 GGCCTCAGGAAACACAATCATGG - Intronic
906871577 1:49487611-49487633 GGCCTCAGGAAACATAATCATGG - Intronic
908346007 1:63233828-63233850 GGCCTCAGGAAACATAATCATGG + Intergenic
908563259 1:65328573-65328595 GGGTTCCTGAATCACAGTCAAGG + Intronic
909259797 1:73472877-73472899 GGCCTCAGAAAACACAATCATGG + Intergenic
909798457 1:79774600-79774622 GGCCTCAGGAAACATAATCATGG + Intergenic
910265695 1:85334654-85334676 GGCCTCAGGAAACCTAATCATGG - Intronic
911722174 1:101203229-101203251 GGCTGCAGGAAACACAGCCAAGG - Intergenic
911735371 1:101331169-101331191 GGCCTCAGGAAACTCAATCATGG + Intergenic
912112878 1:106364527-106364549 GGCCTCAGGAAACTTAGTCATGG - Intergenic
912206208 1:107511764-107511786 GGCCTCAGAAAACATATTCATGG - Intergenic
912234660 1:107835966-107835988 GGGCTAGGGAAACACAGGCATGG + Intronic
913127591 1:115807446-115807468 GGACTTGGGAAACCCAGTCATGG - Intergenic
913150199 1:116034344-116034366 GGCTTCCTCAAACACAGTAATGG - Intronic
913490056 1:119370740-119370762 GGCCTTCAGAAACACAGTCTGGG + Intronic
914975456 1:152356786-152356808 GACCTCCTGAGACACAGCCATGG + Exonic
915031205 1:152881786-152881808 GGCCTCAGGAAACACAATCATGG + Intronic
915249318 1:154577223-154577245 GGCCTCTGGAAGCAGAGTCAGGG - Exonic
915844412 1:159248727-159248749 GGCCTCAGGAAGCACAATTATGG - Intergenic
915886516 1:159728182-159728204 GGCCTCAGGAAACACAATCAAGG + Intergenic
916194726 1:162212399-162212421 GCCCTCATGAAACACAGTCTAGG + Intronic
917577940 1:176344097-176344119 GGCCTCAGGACACACAATTATGG + Intergenic
918573923 1:186032604-186032626 GGCCTCAGGAAACATAATCATGG - Intronic
919032428 1:192260250-192260272 GGCCTCAGGAAACTTACTCATGG + Intergenic
919814935 1:201431284-201431306 AGCCTCCTGCAAAACAGTCATGG - Intergenic
921880653 1:220250870-220250892 GGCCTCAGGAAACACAGTGGTGG - Intronic
923179025 1:231498411-231498433 GGTATCAGGAAACACAATCATGG + Intergenic
923410002 1:233698712-233698734 GGCCTCAGGAAACACAATCATGG + Intergenic
924739292 1:246785600-246785622 AGCCTCCGGAGACCCAGTCAAGG - Intergenic
924767674 1:247048700-247048722 GGCCTCAGGAAATACAATCATGG + Intronic
1063129838 10:3168715-3168737 GGCCTCAGGAAACACAATCGTGG - Intronic
1064627953 10:17280877-17280899 GGCCTCAGGAAACACAATCATGG + Intergenic
1066047352 10:31604906-31604928 GGCCTCAGGGAACACAGTTTGGG + Intergenic
1066128140 10:32362523-32362545 GGCCTTAGGAAACATAGTCATGG - Intronic
1067681616 10:48445410-48445432 TGCCTCCTGAAGCACAGTCCAGG + Intergenic
1067697725 10:48547862-48547884 GCCCTGCAGAAATACAGTCATGG + Intronic
1069101233 10:64323553-64323575 GGCCTCAGGAAATCCAGCCAGGG + Intergenic
1070225858 10:74504843-74504865 GGCCTCAGGAAACACAATCATGG - Intronic
1071197490 10:83178022-83178044 GGCCTCAGGAAACACAATCATGG + Intergenic
1072641827 10:97216733-97216755 GGCCTCAGGAAACACAATTATGG - Intronic
1073562628 10:104509861-104509883 GGCCTTCGCAAACACAGACAAGG + Intergenic
1073947555 10:108768350-108768372 GGCCTCAGGAAACATAATCATGG - Intergenic
1075483729 10:122802879-122802901 GGCCTCCGGAACCAAGATCAGGG - Intergenic
1075553551 10:123412204-123412226 GGCCTCAGGAAACACAATCATGG - Intergenic
1077705430 11:4480733-4480755 GGCCTCAGGAAACTTAGTCATGG - Intergenic
1079567785 11:21904077-21904099 GGCCTCAGGAAACTTATTCATGG + Intergenic
1079629716 11:22659149-22659171 CGCCTCTGGAAACACCATCATGG - Intronic
1083076177 11:60041445-60041467 GGCTTCCTGAAAGACAGTTAGGG - Intronic
1083996973 11:66277626-66277648 GGCCTCAGGAAACGGGGTCAAGG - Intergenic
1086977520 11:93152596-93152618 GGCTTCTGGAAACAAACTCATGG + Intronic
1086989501 11:93287659-93287681 GGCTTCAGGAAACATAATCATGG + Intergenic
1087077276 11:94136929-94136951 GGCCTCGGGAAACACAGTCATGG + Intronic
1087475599 11:98629908-98629930 GGCTTCAGGAAACACAATCATGG + Intergenic
1087939334 11:104076183-104076205 GGCTTCAGGAAACATAATCATGG - Intronic
1089473270 11:118738023-118738045 GGCCTTAGGAAACACAATCATGG - Intergenic
1090508916 11:127350587-127350609 GGCCTTCTGAAACCCATTCATGG + Intergenic
1092184644 12:6470122-6470144 CGCCTCAGGAAAGACAGTCATGG - Intronic
1092495262 12:8986962-8986984 GGCCTCAGGAAACTTAGTCATGG - Intronic
1093570857 12:20664136-20664158 GGCCTCAGGAAACATAATCATGG - Intronic
1093718654 12:22413046-22413068 AGCCTCCTGAAACACAGTACAGG + Intronic
1095109749 12:38279938-38279960 GACCTCAGGAAACTTAGTCATGG - Intergenic
1095462419 12:42456635-42456657 GGCCTTAGGAAATACAATCATGG - Intronic
1095895711 12:47278562-47278584 GGCTTTGGGAAACAGAGTCAAGG - Intergenic
1096520900 12:52184026-52184048 GGCCTAGGGAAACACACACAGGG - Intronic
1097548873 12:61041393-61041415 GGCCTCAGGAAACATAATCATGG + Intergenic
1098198357 12:68026631-68026653 GGCCTGAGGAAACAGAATCACGG - Intergenic
1099076434 12:78114455-78114477 GGCCTCAGGAAACAGAATCATGG + Intronic
1099322121 12:81162991-81163013 GGCCTCCGAGAACACAGGGATGG + Intronic
1099475999 12:83108069-83108091 GGCCTCAGGAAACATAATTATGG - Intronic
1099558832 12:84147706-84147728 GGCCTCAGGAAACACAATCATGG - Intergenic
1100216773 12:92458525-92458547 GGCATCAGGAAACACAATCATGG + Intergenic
1100810141 12:98329764-98329786 GGCCTCAGGAAACACAATCACGG + Intergenic
1101527098 12:105540980-105541002 GGCCTCTGGAAACACAATCATGG - Intergenic
1102600164 12:114023596-114023618 GGCCTCAGGAAACTTAGTCATGG - Intergenic
1103269137 12:119657634-119657656 AGCCCCAGGAAACACAATCATGG + Intergenic
1103413596 12:120729636-120729658 GGCCTCCTGAAAAAGAGACAGGG - Intronic
1107672165 13:42757417-42757439 GGCCTCAGGAAACAGAATCATGG + Intergenic
1109804837 13:67425641-67425663 GGCCTCAGGAAACACAATCATGG + Intergenic
1110163061 13:72402473-72402495 GGCCTCAGAAAACACAATCATGG + Intergenic
1110342432 13:74408197-74408219 AGCCTCAGGAAACACAAGCATGG - Intergenic
1110766017 13:79280056-79280078 GGCCTCAAGAAACACGATCATGG - Intergenic
1111483880 13:88869254-88869276 GGCCTCAGGAAATAAAATCATGG - Intergenic
1111553541 13:89849361-89849383 AGCCTCAGGAAACACAATCATGG + Intergenic
1112923177 13:104640809-104640831 GGCCTCAGGAAACAAAATCACGG + Intergenic
1113013100 13:105793416-105793438 GGCCTCAGGAAACATATTCATGG + Intergenic
1113497654 13:110744630-110744652 GGCCTCAGAAAATACAATCATGG + Intergenic
1113573133 13:111372912-111372934 GGCCTCAGAAAACTCAGTCGTGG - Intergenic
1113813485 13:113156142-113156164 GGCCTCAGGAAACATAATCATGG + Intergenic
1113869953 13:113553291-113553313 GACCTCAGGAAACACAATCACGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114780574 14:25534005-25534027 GGCCTCAGGAAACACAATCATGG + Intergenic
1115505138 14:34086613-34086635 GGCCTCAGGAAACACAATCATGG + Intronic
1115957574 14:38798321-38798343 GGCCTCAGGAAACACAGTCATGG - Intergenic
1116108232 14:40539863-40539885 GGCTTCAGGAAACAGAATCATGG + Intergenic
1116712915 14:48391932-48391954 AGCCTCAGGAAACTTAGTCATGG + Intergenic
1116784266 14:49269960-49269982 GGCCTCAGGAAACTTAGTCATGG - Intergenic
1116802646 14:49459182-49459204 GGCCTCAGGAAACACAATTATGG - Intergenic
1117280060 14:54231014-54231036 GGCCGCAGTAAAAACAGTCAGGG + Intergenic
1118941250 14:70340290-70340312 GGCCTCAGGAAACTTAGTCATGG - Intronic
1119017254 14:71071616-71071638 GGCCTCAGGAAACATAATCACGG - Intronic
1119099808 14:71869388-71869410 GTCCCCTGGAATCACAGTCATGG - Intergenic
1119746511 14:77048508-77048530 GGACTCCTGAAACAAATTCAGGG - Intergenic
1120152280 14:81049893-81049915 GGCCTCAGGAAACACAATCATGG - Intronic
1120406946 14:84102347-84102369 GGCCTCAGGAAACAGAATTATGG - Intergenic
1120430633 14:84409975-84409997 GGCCTCAGGAAACATAATCATGG - Intergenic
1120469516 14:84904431-84904453 GGCATCAGGAAACACAATCATGG - Intergenic
1120684222 14:87518886-87518908 GGCCTCAGGAAACTTAATCATGG - Intergenic
1120771262 14:88382970-88382992 GGCCTCAGGAAACACTATCATGG - Intergenic
1122518671 14:102327049-102327071 GGCCTCGGGAAACAGAGTCACGG + Intronic
1122622337 14:103066579-103066601 TCCATCAGGAAACACAGTCATGG + Intergenic
1122746319 14:103899177-103899199 GGGCTCCTGAAACACAGGCCTGG + Intergenic
1123104393 14:105831564-105831586 GGCCTTGGGAAACACAGTCGTGG + Intergenic
1202928700 14_KI270725v1_random:19064-19086 GGCCTGGGGAAACAAAGTTAAGG + Intergenic
1123411202 15:20061273-20061295 GGCCTCAGGAAACTCAGTCACGG - Intergenic
1123493276 15:20799609-20799631 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1123520548 15:21068384-21068406 GGCCTCAGGAAACTCAGTCACGG - Intergenic
1123549783 15:21368711-21368733 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1124110187 15:26778084-26778106 GGCCTCAGGAAACATAATCACGG + Intronic
1126844484 15:52746151-52746173 GGCCTCAGGAAACCCAATCATGG - Intergenic
1126993520 15:54412292-54412314 GGCCTCAGGAAACATAATCATGG + Intronic
1127144511 15:56010734-56010756 GGCCTCAGGAAACACAATCATGG - Intergenic
1127543289 15:59964844-59964866 GGCCTCAGGAAATTTAGTCATGG - Intergenic
1127744008 15:61945141-61945163 GGCCTCAGGAAACTGAATCATGG - Intronic
1129743153 15:77999980-78000002 GGCCTTCAGAAACACAGGGAGGG - Intronic
1129842329 15:78751460-78751482 GGCCTTCAGAAACACAGGGAGGG + Intergenic
1130068772 15:80628988-80629010 GGCCTCAGAAAACACAACCATGG + Intergenic
1132117020 15:99145103-99145125 CCCCTACAGAAACACAGTCAGGG + Intronic
1132261832 15:100432790-100432812 AGCCTGCAGAAACAGAGTCACGG + Intronic
1202958114 15_KI270727v1_random:95929-95951 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1132653564 16:1032175-1032197 GGCCACCGGGCACACAGGCAGGG + Intergenic
1132713091 16:1277956-1277978 GGCCGCCGGAAAGGCAGTGAGGG + Intergenic
1132904250 16:2274037-2274059 GGCCTCTGGAAACTCAGTGCTGG - Intergenic
1134429858 16:14193348-14193370 GGCTTCTGGAAACATAGGCAAGG - Intronic
1135759045 16:25121609-25121631 GGCCTCAGGAAACTTAGTCATGG + Intronic
1136011032 16:27363516-27363538 GGCCACCTGAAACAGTGTCATGG + Exonic
1136239107 16:28933283-28933305 GGCCCCTGGACACAGAGTCAGGG - Exonic
1137685571 16:50384519-50384541 GTTCTCTGGAAACACAGGCAAGG - Intergenic
1137895546 16:52208000-52208022 GGCCTCAGGAAACATAATCATGG + Intergenic
1138261531 16:55626957-55626979 AGCTTCTGGAAAGACAGTCAGGG - Intergenic
1138804459 16:60078014-60078036 GGCCTCAGGAAACTTAGTCATGG + Intergenic
1140627373 16:76810532-76810554 GGGCTCAGGAAACAGAATCATGG + Intergenic
1141279859 16:82621563-82621585 GGGGTGCTGAAACACAGTCAAGG - Intergenic
1141665851 16:85464764-85464786 GGCCTTTGGAAACAAAGTGAGGG - Intergenic
1141883000 16:86872228-86872250 GGCCTCCAGGAACACTTTCAAGG + Intergenic
1142282558 16:89156256-89156278 GGCCTCTGGAGACACAGGCCGGG + Intergenic
1143029443 17:3959734-3959756 GGACCCCGGAGACACAGGCAGGG - Intronic
1143986459 17:10918876-10918898 CGCTTCCTGAGACACAGTCATGG + Intergenic
1144462052 17:15466307-15466329 GGCCTCCAGAAACACTGCCTGGG + Intronic
1146624351 17:34424453-34424475 GTCCTCAGGAAACACTGTTATGG - Intergenic
1148693030 17:49543977-49543999 GGCCTCAGGAAACATAACCATGG + Intergenic
1149050434 17:52297891-52297913 GGCCTCAGGAAACAGAATCACGG - Intergenic
1151067998 17:71173857-71173879 TGCCTCATGAAGCACAGTCAGGG - Intergenic
1151971205 17:77458319-77458341 GGCCTCCCAAATCACAGTCCTGG - Intronic
1152165817 17:78704912-78704934 TGCCTTAGGAAACAAAGTCATGG + Intronic
1153574056 18:6503186-6503208 GGCCTCAGGAAACTTAATCATGG - Intergenic
1153737572 18:8087438-8087460 GACCTCAGGAAACACAATCATGG + Intronic
1154450831 18:14474147-14474169 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1155617354 18:27737624-27737646 GGCCTCGGGAAACTTAATCACGG + Intergenic
1155623799 18:27811476-27811498 GGCCTCAGGAAACATAATCATGG - Intergenic
1155710020 18:28865309-28865331 GGCCTCAGGAAACTTAATCATGG + Intergenic
1156335562 18:36168458-36168480 GGCCTCAGGAAACTCAGTCATGG + Intronic
1156640801 18:39095320-39095342 GGCTTCAGGAAACACAATCATGG - Intergenic
1156957631 18:42987787-42987809 GGCCTCAGGAAACACACTCATGG + Intronic
1157277264 18:46320236-46320258 GGCCTCCGGAAAGAAAGCTATGG + Intergenic
1157815581 18:50727544-50727566 TGCCGCAGGAACCACAGTCAAGG - Intronic
1157841053 18:50958797-50958819 GGCAGCAGGAACCACAGTCAAGG - Intergenic
1159077592 18:63699456-63699478 GACCTCAGGAAACACAATCATGG + Intronic
1159204693 18:65234007-65234029 GGCCTCAGGAAAAACAATCATGG - Intergenic
1159212818 18:65349048-65349070 GGCCTCAGGAAACACAATCACGG - Intergenic
1160021938 18:75187932-75187954 GGCCTCAGGAAGCTTAGTCATGG - Intergenic
1160349632 18:78165553-78165575 GGCTTCCAGACACAGAGTCACGG - Intergenic
1161764020 19:6196555-6196577 GGCCACGGGATACACAGTGATGG + Intronic
1163413742 19:17172904-17172926 GGCCTCCCGAAGCACTGCCATGG - Exonic
1164751570 19:30659224-30659246 GGCCTCAAGAAACTTAGTCATGG + Intronic
1164898495 19:31898100-31898122 GGCCTCAGGAAACATAATCATGG + Intergenic
1165214449 19:34259979-34260001 GGCCTCAGAAAACATATTCATGG - Intronic
1166633284 19:44426972-44426994 GGCCTCCGAAAACTTAGTCATGG + Exonic
1167350803 19:48973240-48973262 GGCCTCAGAAAACTCAGTCATGG - Intronic
1168313102 19:55471450-55471472 CTCTTCCGGAAACACTGTCACGG + Intergenic
1168562432 19:57395492-57395514 GGCCTCAGGAAACACAATCCTGG + Intronic
925053155 2:832877-832899 GGCCTCAGGAAACTTAGTCGTGG - Intergenic
925140018 2:1543885-1543907 GGCCTCTGGAAACACAGTCATGG + Intergenic
925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG + Intergenic
926819076 2:16833121-16833143 GGCCTCAGAAAACATAATCATGG - Intergenic
926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG + Intergenic
927098775 2:19770635-19770657 GGCCTCAGGAAACACAATCATGG + Intergenic
927462055 2:23307729-23307751 GGCCTCAGGAAACACAATCATGG + Intergenic
928899388 2:36301177-36301199 GGCCTCAGGAAACACAATCATGG + Intergenic
929029070 2:37634069-37634091 GGCCTCAGGAAAGAGAATCACGG - Intergenic
929565370 2:42980467-42980489 TGCCTACAGAAACACAGTGATGG + Intergenic
929643776 2:43607499-43607521 GGCCTTGGGAAACACAATCATGG + Intergenic
931454584 2:62398581-62398603 CGCCTCCAGAAAGGCAGTCATGG - Intergenic
931874405 2:66496305-66496327 GGCATACGGAAACACAAACAAGG - Intronic
932014187 2:68007723-68007745 GGCAACAGGAAACAAAGTCAGGG + Intergenic
933864277 2:86501603-86501625 GGCCTCAGGAAACACAGTCGTGG + Intergenic
933949617 2:87317367-87317389 GGCCTCAGGAAACACAATTATGG + Intergenic
935702697 2:105826133-105826155 GGCCTCAGGAAACTTAATCATGG + Intronic
936330576 2:111544230-111544252 GGCCTCAGGAAACACAATTATGG - Intergenic
937059947 2:118973728-118973750 GGCTGCCTGGAACACAGTCAGGG + Intronic
941250601 2:163156913-163156935 GGCCTCAGGAAACACAATTATGG - Intergenic
941367765 2:164627824-164627846 ACCCTCCGGAACCAGAGTCAGGG + Intergenic
942736430 2:179119550-179119572 GGCCTCAGGAAACAGAATCGTGG - Intronic
943223624 2:185141033-185141055 GGCCTCAGGAAACTTAATCATGG + Intergenic
943341005 2:186682272-186682294 GGCCTCAGGAAACATAATCATGG + Intergenic
943440455 2:187921713-187921735 GTCCTCAGGAAACACAATCATGG + Intergenic
943452946 2:188068321-188068343 GACCTCAGGAAACACATTCATGG + Intergenic
944230178 2:197384588-197384610 GGCCTCAGGAAACATAATCATGG - Intergenic
945411553 2:209515432-209515454 GGCCCCAGGAAACACAATCATGG + Intronic
945774406 2:214086604-214086626 GGCCTCAGGAAACATAATCACGG - Intronic
946194605 2:218025571-218025593 GGCCTCAGCAAACACAGCAATGG - Intergenic
946722981 2:222630763-222630785 GGCTTCAGGAAAGACATTCAAGG + Intronic
947995398 2:234523119-234523141 GGCCTCAGGAAACACAATAATGG - Intergenic
948012265 2:234658671-234658693 GGCCTCAGGAAACATAATCACGG + Intergenic
948209702 2:236183709-236183731 GGCCTCAGGAAGCTCAATCATGG - Intergenic
948234590 2:236379011-236379033 AGCCCCTGGAAACACAGTCGGGG - Intronic
948698761 2:239747690-239747712 GGACCCCTGAATCACAGTCAGGG + Intergenic
1173199204 20:40942137-40942159 GACCTCAGGAAACACAATCAAGG + Intergenic
1173337469 20:42124505-42124527 GGCCTCCGGAGGCAGAGACAGGG + Intronic
1173883064 20:46433442-46433464 GTCCTCTGGAAACACCCTCACGG - Intergenic
1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG + Intronic
1174541459 20:51292984-51293006 GGCCTCAGGAAACACAATCATGG + Intergenic
1174546242 20:51327385-51327407 GGCCAATGGAAACTCAGTCATGG + Intergenic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1175712805 20:61234539-61234561 GGCCTTCAAAAACACTGTCATGG + Intergenic
1176590723 21:8647648-8647670 GGCCTGGGGAAACAAAGTTAAGG + Intergenic
1176654350 21:9576446-9576468 GGCCTCAGGAAAGACTGTCCAGG - Intergenic
1177679756 21:24351526-24351548 GGCCTCAGGAAACATAATCATGG + Intergenic
1179230398 21:39498947-39498969 AGCCTCAGGAAACTTAGTCATGG + Intronic
1179793976 21:43771704-43771726 GGCCTCAGGAAACACAATCATGG + Intergenic
1180273552 22:10624682-10624704 GGCCTGGGGAAACAAAGTTAAGG + Intergenic
1181129479 22:20722093-20722115 GGCCTCAGGAAACAGAATCATGG - Intronic
1181881230 22:25981984-25982006 GGCCTCAGGAAGCACAATCATGG + Intronic
1182523335 22:30898509-30898531 AGCCTCAGGAAACTCAATCATGG + Intronic
1182528434 22:30936861-30936883 GACCTCAAGAAACACAGTGAGGG + Intronic
1184956414 22:47889775-47889797 GGCCTCAGGAAACACAATTATGG - Intergenic
1185226676 22:49657439-49657461 GGTCTCAGGAAACACAATCATGG + Intronic
949136544 3:574032-574054 GGCCTGGGGAAACAAAGTTAAGG - Intergenic
949521226 3:4855860-4855882 AGCCTCAGGAAACTTAGTCATGG - Intronic
951034851 3:17921635-17921657 GGCCTCAGGAAACACAATCATGG - Intronic
952120139 3:30232459-30232481 GGCCTCAGGAAACACAATCAAGG + Intergenic
952221238 3:31326364-31326386 AGCCTCAGGAAACTCAATCATGG + Intergenic
952604612 3:35130060-35130082 GGCCTCAGGAAACACAGCCACGG + Intergenic
953489626 3:43337686-43337708 GGCCTCAGGAAACACAGTCATGG + Intronic
954472034 3:50706123-50706145 GGCCTCAGGAAACACAATCATGG - Intronic
955000074 3:54919469-54919491 GGCCTGAGGAGACACATTCATGG - Intronic
957372577 3:79314506-79314528 GGTCTCAGGAAACATAATCATGG - Intronic
957784638 3:84866338-84866360 GGCCTCAGGAAACACAATCATGG - Intergenic
957847405 3:85755619-85755641 AGCCTCAGGAAACTCAATCATGG + Intronic
959228528 3:103618128-103618150 GGTCTCAGGAAACAAAATCATGG + Intergenic
959351400 3:105269149-105269171 GGCCTCAGGAAACAAAATCCTGG - Intergenic
960239333 3:115322122-115322144 GGCACCTGGAAAAACAGTCAAGG + Intergenic
960268001 3:115643326-115643348 GGACCCAGGAAACACAGTCAAGG - Intronic
960591907 3:119374729-119374751 GGCCTTGGGAAACATAATCATGG - Intronic
960722437 3:120638120-120638142 AGCCTCAGGAAATACAATCATGG - Intronic
962334228 3:134511642-134511664 GGCCTCAGGAAACTTAATCATGG + Intronic
963083879 3:141419105-141419127 GGCCTCAGGAAACTTAATCATGG + Intronic
963245989 3:143063159-143063181 GGCCTCAGGAAGCTTAGTCATGG - Intergenic
966217532 3:177518875-177518897 GGTCTCAGGAAACATAATCATGG + Intergenic
966414637 3:179676173-179676195 GGCCTCAGGAAACAAAATCATGG - Intronic
967015818 3:185480757-185480779 GACCTCAGGAAACACAATCATGG + Intronic
967016753 3:185489196-185489218 GGCTGCAGGAAACCCAGTCATGG - Intronic
967566408 3:190978789-190978811 GGCCTCAGGAAACATAATCACGG - Intergenic
968022484 3:195405792-195405814 GGCCTCAGGAAACCAAATCACGG + Intronic
968524443 4:1048854-1048876 GGCCTCAGGAAACTTAGTCATGG + Intergenic
969103498 4:4787694-4787716 GGCCTCAGGAAACACAATCATGG - Intergenic
969194895 4:5553162-5553184 GGCCTCAGGAAACCAAATCATGG + Intronic
971588864 4:28441194-28441216 GGCCTCAGGAAACATAATCATGG + Intergenic
971666168 4:29488298-29488320 GGCCTCAGGAAACTTAGTCATGG - Intergenic
973040667 4:45466256-45466278 GGCCTCAGGAAACACAATCATGG + Intergenic
975970325 4:80026334-80026356 AGCCTCAGGAAACTTAGTCATGG - Intronic
977138724 4:93339786-93339808 GGCCTCAGGAAACACAATCATGG + Intronic
978256107 4:106694468-106694490 GGCCTCAAGAAACACAATCTTGG - Intergenic
979121915 4:116914007-116914029 GGCCTCTGGAAACACAACCATGG - Intergenic
979454727 4:120914569-120914591 GGCCTCAGGAAACAGAATCATGG + Intronic
981173907 4:141658245-141658267 GGCCTCAGGAAACAAAATCATGG - Intronic
981303982 4:143226218-143226240 TGCCTCAGGAAACACAGTCATGG + Intergenic
982272859 4:153609210-153609232 GACCTTAGGAAACACAGTTATGG + Intronic
982623749 4:157738149-157738171 GGCCTCGGGAAACAAAAGCATGG + Intergenic
984306937 4:178005488-178005510 GGCCTCAGGAAACATAATCATGG + Intergenic
984755432 4:183322024-183322046 GGCCTCGGGAATCACAGCCCTGG - Exonic
985368450 4:189259809-189259831 GGCCTCAGGAAACACAATCCTGG + Intergenic
985381739 4:189402461-189402483 GGCCTCAGGAAACATAGTTATGG - Intergenic
986343016 5:6808439-6808461 GGCACCAGAAAACACAGTCATGG + Intergenic
986450384 5:7857638-7857660 GGCACCCTGACACACAGTCAAGG - Intronic
987003930 5:13689571-13689593 GGCCTCAGGAAACGTAATCATGG - Intergenic
987499073 5:18682311-18682333 GGCCTCAGGAAACATAATCATGG - Intergenic
988074655 5:26337732-26337754 GGCATCAGAAAACACACTCATGG + Intergenic
988119453 5:26942111-26942133 GGCCTCAGGAAACACAATCATGG + Intronic
989149590 5:38285708-38285730 GGCCTCAGGAAACACAATCATGG + Intronic
989197160 5:38726881-38726903 TGCCTCAGGAAACACAATCATGG + Intergenic
989254546 5:39352051-39352073 GGCCTCAGGAAACCCAATCATGG + Intronic
991111507 5:62905267-62905289 GGCCTTAGGAAACATAATCATGG + Intergenic
991562830 5:67972597-67972619 GGCCTCAGGAAACACAATCTTGG + Intergenic
991992241 5:72351580-72351602 GGCCTCAGGAAATACAGTCATGG + Intronic
992082565 5:73248801-73248823 AGCCTCAGGAAACACAATCATGG - Intergenic
993605026 5:89979388-89979410 GGCCTCAGGAAACATAATCATGG + Intergenic
993713664 5:91253022-91253044 GACCTCAGGAAACACAATCATGG - Intergenic
994413913 5:99443547-99443569 GTCCTCTGGAAACACAATCATGG - Intergenic
994545054 5:101155724-101155746 GGCCCCAGGAAACACAATCATGG + Intergenic
994580153 5:101631753-101631775 GGCCTCGGGAAACATAGTCATGG + Intergenic
994734420 5:103534362-103534384 GGCTTGAGGAAACACAATCATGG - Intergenic
995698580 5:114906991-114907013 GACCTCAGGAAACCTAGTCATGG + Intergenic
995997984 5:118323747-118323769 GGACTCAGGAAACACAATCATGG + Intergenic
996026863 5:118656628-118656650 GGCCTCAGGAAACACAATCATGG + Intergenic
996156986 5:120114377-120114399 GGCCTCAAGAAACTCAATCATGG - Intergenic
996775711 5:127130446-127130468 GGCCTTAGGAAACATAATCATGG - Intergenic
997182431 5:131844007-131844029 GGCCTCAGGAAACATGGTTACGG + Intronic
999504528 5:152181126-152181148 GGCCTCAGGAAACACATTCATGG + Intergenic
1000561225 5:162791919-162791941 GGCCTCAGGAAACACAGTCATGG + Intergenic
1001110923 5:168895581-168895603 GGCCTCCAGAAGCCCAGTAACGG + Intronic
1001415725 5:171543778-171543800 GGCCTGTGGAAACACAGCAAAGG + Intergenic
1002018357 5:176344596-176344618 GGCCTCAGGAAACACAATCGTGG + Intronic
1003665392 6:8106954-8106976 GGCATCCTGAAGCCCAGTCAAGG - Intergenic
1005078226 6:21929746-21929768 GGCCTCAGGAAATGCAGTCATGG + Intergenic
1005879774 6:30047257-30047279 GGCCTCAGGAAACACAATAATGG + Intergenic
1005885491 6:30094372-30094394 GGCCCCTGGAAACAGAGTCGGGG + Intergenic
1007255425 6:40524839-40524861 TGCCTCAGGAAACTGAGTCAGGG + Intronic
1008848053 6:55992615-55992637 GGCCTCAGGAGACATAATCATGG + Intergenic
1009773302 6:68173359-68173381 GACCTCAGGAAACAGAATCATGG - Intergenic
1010257388 6:73774658-73774680 AGCCTCAGGACACACAGTCCTGG - Intronic
1010342298 6:74768383-74768405 GGCCTCCAGGAACTCAGTCAAGG + Intergenic
1010659622 6:78555373-78555395 GGCCTCAGGAAACTTAATCATGG + Intergenic
1011418859 6:87151844-87151866 GGCCTCCGGAAACCCACCCCGGG - Intergenic
1011458011 6:87573174-87573196 GGCCTCAGAAAACTCAATCATGG + Intronic
1011981559 6:93385850-93385872 GGTCTCAGGAAACATAATCATGG + Intronic
1012064746 6:94536581-94536603 GGCCTCAGGAAACAAATTCATGG + Intergenic
1014187344 6:118450584-118450606 GGCCTCAGGAAACATAATCATGG - Intergenic
1014282613 6:119458436-119458458 GGCCTCAGGAAACACAATCATGG - Intergenic
1014403035 6:121014825-121014847 GGCCTCAGGAAACACAATCATGG + Intergenic
1014714299 6:124846543-124846565 GGCCTGGGGAAAAACAGTCATGG + Intergenic
1014951359 6:127559234-127559256 GGCCTCAGGAAACACAATCATGG - Intronic
1015239474 6:131007328-131007350 AGCCTCAGGAAACAAAGTTACGG - Intronic
1016128201 6:140433090-140433112 GGCGTCAGGAAACACAATTATGG - Intergenic
1016788615 6:148042062-148042084 AGCCTCAGGAAACACAATCATGG + Intergenic
1017234876 6:152108985-152109007 GGCCTCAGGAAACTCAATCATGG + Intronic
1017569333 6:155726293-155726315 GGCCTCAGGAAACATAATCATGG - Intergenic
1018029106 6:159828081-159828103 GGCCTCAGGAAACAAAATCATGG + Intergenic
1019214440 6:170434280-170434302 GGTCTGGGGAAACACAGACAAGG + Intergenic
1019558747 7:1645502-1645524 GGCCTCCGGGCCCACAGCCAGGG + Intergenic
1019607584 7:1917924-1917946 GGCCTGATGCAACACAGTCAGGG - Intronic
1019685912 7:2382100-2382122 AGCCTCCTGAAACACAACCAAGG - Intergenic
1019924853 7:4185445-4185467 GGGCTCTGGAAATACAGGCAGGG - Intronic
1020538886 7:9436229-9436251 GGGCTCCTAAAACACAGTGAGGG - Intergenic
1022352168 7:29576618-29576640 TGCCTCAGGAAACATAATCATGG - Intergenic
1024895872 7:54261341-54261363 GGCCTCAGGAAACACAGTCATGG + Intergenic
1025253139 7:57365410-57365432 GGCCTGAGGCAGCACAGTCAGGG - Intergenic
1025810151 7:64870425-64870447 AGCCCCGGGAAACACAGGCAGGG - Intronic
1025860810 7:65325883-65325905 GACCTCAGGACACTCAGTCATGG - Intergenic
1027507832 7:79040272-79040294 GGCCTCCGGAAACACAGTCATGG - Intronic
1028323538 7:89493306-89493328 GGCCTCCTGAGGCACAGTCAGGG + Intergenic
1028385569 7:90249310-90249332 GGCCTCAAGAAAAACAGTCATGG - Intronic
1029659187 7:101947898-101947920 GTCCTCAGGAAATACAGACATGG - Intronic
1032217690 7:129970264-129970286 GACCTTCTGAAACACACTCAGGG + Intergenic
1032366632 7:131306143-131306165 GGCCTCAGGAAACGTAATCATGG - Intronic
1033730668 7:144175815-144175837 GGCCTCAGGAAACACAATCATGG - Intergenic
1033843324 7:145401999-145402021 GGCCACAGGAAACACAATCATGG - Intergenic
1034001258 7:147415563-147415585 GACCTCAGGAAACACAATCATGG - Intronic
1034113614 7:148562811-148562833 GGCCTTAGGAAACTTAGTCATGG + Intergenic
1034229599 7:149511387-149511409 GGCCTCAGGAAACACAATCATGG - Intergenic
1034477638 7:151296018-151296040 GGCCTCAGGAAACACAATCATGG + Intergenic
1034824969 7:154253853-154253875 GGCCTTAGGAAACACAATTATGG + Intronic
1034926703 7:155128509-155128531 GGCCTCAGGAAACACAATCATGG - Intergenic
1035109720 7:156470985-156471007 GGCCTCAGGAAACATCATCATGG - Intergenic
1035295658 7:157865675-157865697 GGCCACTGGAAACACAGATAAGG - Intronic
1035526678 8:318332-318354 GGCCTCAAGAATCACAGTCCAGG - Intergenic
1035596253 8:860396-860418 GGGCTCCAGAAACACTTTCAAGG + Intergenic
1035634560 8:1134716-1134738 GGCCTCAGGAAACTTATTCATGG + Intergenic
1036057277 8:5270234-5270256 GGCCTCAGGAAACACATTCATGG - Intergenic
1036090985 8:5664964-5664986 GGCCTCAAGAAAAGCAGTCATGG - Intergenic
1036518658 8:9469524-9469546 GGCCTCAGGAAACACAATCCTGG - Intergenic
1037294450 8:17385785-17385807 GGCCACAGGAAACACAATCATGG - Intronic
1037566861 8:20125434-20125456 GGCCTCAGGAAACACAGTCATGG + Intergenic
1037721993 8:21452304-21452326 GGCCTCAGAAAACAAAATCATGG + Intergenic
1038138652 8:24818700-24818722 GGCCTCAGGCAAAACTGTCAAGG + Intergenic
1038188211 8:25294791-25294813 GGCCTCAGGAAACACAATCATGG + Intronic
1040741215 8:50578766-50578788 GCCCTCAGGAAACACAATTATGG - Intronic
1040945792 8:52883011-52883033 GGCTTCAGGAAACATAATCATGG + Intergenic
1041265609 8:56061242-56061264 GGCCTCAGGAAACTTAATCATGG - Intergenic
1042052879 8:64731038-64731060 GGCCTCAGAAAACACTGTGATGG - Intronic
1042182718 8:66107924-66107946 GGCCTCCTGAATCACAGCCAGGG - Intergenic
1042193430 8:66211325-66211347 GGCCTCAGGAAACTTAATCATGG + Intergenic
1043102332 8:76061243-76061265 GGCCTCAGGAAACATAATCATGG - Intergenic
1043708690 8:83385335-83385357 GGCCTCAGGAAACATAATCATGG + Intergenic
1046040417 8:108896774-108896796 GGACTCAGGAAACACAATCATGG - Intergenic
1046611376 8:116429414-116429436 GGCCTCAGGAAACACAGTCATGG + Intergenic
1046942340 8:119943348-119943370 GGTCTCAGGAAACACAATCATGG + Intronic
1047151367 8:122267266-122267288 GGCCTCAGGAAACATAATCATGG + Intergenic
1047188117 8:122654041-122654063 GGCCTCAGGAAACTTACTCATGG - Intergenic
1047870096 8:129072503-129072525 GGCCTCAGGAAACTTAGTCATGG - Intergenic
1048376873 8:133830447-133830469 GGCATCCAGAAACAGAGTCAGGG - Intergenic
1050890409 9:10818372-10818394 GGCCTCAGGAAACATAGTTATGG + Intergenic
1052552136 9:29965936-29965958 GGCCTCAGGAAACGTAGTCATGG + Intergenic
1052571333 9:30227920-30227942 GGCCTCAGGAAACTTAATCATGG - Intergenic
1054903072 9:70389683-70389705 GTCCTCCCCAAACACAGACATGG - Intronic
1055185836 9:73452857-73452879 GGCCTCAGGAAACATAATCATGG - Intergenic
1055856709 9:80697038-80697060 GGCCTTGGGAAACACAATCATGG + Intergenic
1055926893 9:81519609-81519631 GGCCTCAGGAAACTTAGTGATGG + Intergenic
1056978224 9:91281412-91281434 GGCATCCTGAAACACAGAAATGG - Intronic
1057209593 9:93192568-93192590 GGCCCCCCGAGACACAGTCCTGG - Intronic
1057701144 9:97363957-97363979 TGCCTCCAGAAACCCAGGCAGGG + Intronic
1058066044 9:100549184-100549206 GGCCTCAGGAAACACAATCATGG + Intronic
1058209055 9:102144619-102144641 GGCCACAGGAAACTTAGTCATGG + Intergenic
1058350001 9:104010098-104010120 GGCCTCAGGAACCACAATTATGG - Intergenic
1058653308 9:107197178-107197200 AGCCTCAGGAAACACAATCATGG + Intergenic
1059031126 9:110697487-110697509 GGCCCCTGGTCACACAGTCAGGG - Intronic
1059617957 9:115971461-115971483 GGCCTCAGAAAACATAATCATGG + Intergenic
1059680543 9:116581268-116581290 GGCCTCTGGAATCACAGACCTGG + Intronic
1060869437 9:127028100-127028122 TGCCTCTGGCAACACAGGCAGGG - Intronic
1060879186 9:127105800-127105822 GACCTCCAGAAACTCAGTCTGGG - Intronic
1062120457 9:134831337-134831359 AGCCTCCAGAAACACAGCCACGG - Intronic
1203620736 Un_KI270749v1:126372-126394 GGCCTGGGGAAACAAAGTTAAGG + Intergenic
1203632071 Un_KI270750v1:79904-79926 GGCCTCAGGAAAGACTGTCCAGG - Intergenic
1186042148 X:5492401-5492423 GGCCTCAGGAAACACAATCATGG - Intergenic
1188473237 X:30563292-30563314 AGCCTCAGGAAACACAATCATGG - Intronic
1188791185 X:34409712-34409734 GGGATCAGGAAACACAATCATGG - Intergenic
1189011268 X:37048037-37048059 CGCCTCAGGAAACAAAATCATGG - Intergenic
1189650966 X:43189066-43189088 GACCTCAGGAAACACAATCATGG + Intergenic
1189728870 X:43997766-43997788 GGCTTCAGGAAACATAATCATGG + Intergenic
1190603581 X:52117471-52117493 GGACTCCAGACACACAGTGAAGG + Intergenic
1193028982 X:76878095-76878117 GGCCTCAAGAAACATAATCATGG + Intergenic
1193850628 X:86532560-86532582 GGCCTCAGGAAACACAATCATGG - Intronic
1196068468 X:111492140-111492162 GGCCTCAGGAAGCACACTCTAGG - Intergenic
1197349912 X:125370790-125370812 GGCTTCAGGAAACATAATCATGG + Intergenic
1197581769 X:128293230-128293252 GGCCTGAGGAAACATAATCATGG - Intergenic
1197740472 X:129888626-129888648 GGCCTCAGGAAACAGAATCATGG - Intergenic
1198278958 X:135123674-135123696 GGCCTCGGGTAACACAGAGACGG - Intergenic
1198283286 X:135164365-135164387 GGCTTACGGAAACATAATCACGG - Intronic
1198292000 X:135248846-135248868 GGCCTCGGGTAACACAGAGACGG + Intergenic
1199041576 X:143120547-143120569 GGCCTCAGGAAACATGATCATGG + Intergenic
1199636566 X:149818896-149818918 GTCCTCAGGAAACACAATCATGG + Intergenic
1202232707 Y:22672080-22672102 GGCCTCTGGACACACACACATGG + Intergenic
1202310449 Y:23524078-23524100 GGCCTCTGGACACACACACATGG - Intergenic
1202386549 Y:24332090-24332112 GGCCTCAGGAAACACAATCATGG + Intergenic
1202484236 Y:25338038-25338060 GGCCTCAGGAAACACAATCATGG - Intergenic
1202560353 Y:26146516-26146538 GGCCTCTGGACACACACACATGG + Intergenic