ID: 1027507850

View in Genome Browser
Species Human (GRCh38)
Location 7:79040422-79040444
Sequence AAAGTTGGTCTCATGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 7, 3: 27, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027507850 Original CRISPR AAAGTTGGTCTCATGGAGGG TGG Intronic
901211731 1:7530243-7530265 TAAGTTTGTATCAAGGAGGGAGG - Intronic
901785728 1:11623203-11623225 AAAGGTGTTCTCAGGGTGGGAGG - Intergenic
904886626 1:33743196-33743218 GAAGGTGCTCCCATGGAGGGAGG - Intronic
905101332 1:35525047-35525069 AAAGTTGATCTCATGAAGATAGG - Intronic
905511874 1:38528263-38528285 AAAGATGGTGGCATGGAGGCTGG + Intergenic
911198795 1:95023117-95023139 AAAGTTGATGACATGGATGGTGG - Intronic
911449177 1:98043937-98043959 AAAGTTGGCCTCATGCTGGTTGG - Intergenic
911495501 1:98626305-98626327 AAAGAGGGTCTCAAGTAGGGAGG - Intergenic
912221550 1:107683073-107683095 AAATTTTCTCTGATGGAGGGTGG + Intronic
915090867 1:153424707-153424729 AAAGTTGGTCTCATGGAGGTAGG + Intergenic
923358116 1:233181100-233181122 AGAGTTGGGCTCAGGGAAGGAGG - Intronic
1064348993 10:14559326-14559348 AAAGCTGGGCTCATGAAGGCTGG - Intronic
1064480321 10:15734091-15734113 AAAGAGGGTGTCATGGAGAGGGG + Intergenic
1068569607 10:58614999-58615021 AAAGTGGGTATCATTGAGGGTGG + Intronic
1070510749 10:77158540-77158562 AAACTAGGAATCATGGAGGGGGG - Intronic
1071277944 10:84073545-84073567 AAAGTTGATCTCACAGAGGTAGG + Intergenic
1072612862 10:97030783-97030805 AAAGATGCCCTCTTGGAGGGTGG + Exonic
1074994299 10:118742656-118742678 AAAGTTAGTCTCATGTTGGGAGG - Intronic
1076077294 10:127544555-127544577 GAAGTTGTTATCTTGGAGGGAGG + Intergenic
1079891191 11:26055242-26055264 AAAGTTGGTTTCATTGGGAGTGG - Intergenic
1080318550 11:30978863-30978885 AGAGTTGATCTCCTGGAGGTAGG - Intronic
1080721405 11:34852749-34852771 ACACTGGGTCTCTTGGAGGGTGG + Intergenic
1083640392 11:64142187-64142209 AGAGTTGGTCAGATGGTGGGAGG - Intronic
1083727252 11:64635009-64635031 ACAGGTGGTCTCAGGGAGTGGGG + Intronic
1084783324 11:71425754-71425776 TAAGGGGGTCTCCTGGAGGGAGG - Intergenic
1085414983 11:76313810-76313832 AAAGTGAGACCCATGGAGGGAGG - Intergenic
1087605560 11:100373287-100373309 AAAATGGATCTCATGGAGGTGGG - Intergenic
1087874195 11:103336501-103336523 AAAGTTGATCTCATGGAGGTAGG - Intronic
1088749986 11:112835252-112835274 ATAGCTGGGCTCATGGAGGAGGG - Intergenic
1091433509 12:455896-455918 AAAGATGGACTCATGGAAGGAGG + Intergenic
1091581481 12:1793123-1793145 AAAGTGAGGCTCATGGTGGGAGG - Exonic
1091881032 12:3978391-3978413 AAAGATGTTCTCATGGTGGGAGG - Intergenic
1093298225 12:17417724-17417746 AAAGTTGATTTCATGGAGTAGGG - Intergenic
1094686231 12:32718669-32718691 AAACTTGATCTCATGGATGCGGG + Exonic
1095994340 12:48067240-48067262 AATGTTGGTCTCATGCAAGTAGG - Intronic
1098793317 12:74856292-74856314 AAAAATGATCTCATGGAGGTAGG - Intergenic
1099749837 12:86759083-86759105 AAAGTTGTTCTCATAGAAGTAGG - Intronic
1100800394 12:98224599-98224621 AAAGCAGATCACATGGAGGGTGG - Intergenic
1101190615 12:102328699-102328721 AAAGCTGGCGTCATGGAGGAGGG + Intergenic
1103600890 12:122053915-122053937 AAATTTGTACGCATGGAGGGAGG + Intronic
1105728374 13:23187375-23187397 ATACATGGTCTCATGGATGGTGG - Intronic
1110022212 13:70489919-70489941 TAAATTGGTATCATGGAGAGTGG + Intergenic
1110935376 13:81281071-81281093 AAAGTTGGAGTAAGGGAGGGAGG + Intergenic
1111530337 13:89528180-89528202 AAAGTTGATCTCATGGAATTAGG + Intergenic
1115051256 14:29066391-29066413 AAAGTTGATCTCATGGAGGTAGG - Intergenic
1116664728 14:47760000-47760022 AAAGTTGGACACATGGAAGCAGG + Intergenic
1119093472 14:71806607-71806629 AAAGTTGATCTTATGGAGGTAGG + Intergenic
1119383077 14:74240796-74240818 AAAGTTGGCCTCGAGGAGCGAGG - Intronic
1121987538 14:98522372-98522394 AAAGTTGATATCATGAAGGTAGG - Intergenic
1122330305 14:100907546-100907568 GAAATTGCTATCATGGAGGGTGG - Intergenic
1125090564 15:35786679-35786701 AAACTCTGTCTCTTGGAGGGAGG + Intergenic
1126137448 15:45405235-45405257 AAAGTTGATCTCATGGATGGAGG - Intronic
1127592027 15:60434703-60434725 AAAGTGGATCTCATGGAGCATGG + Intronic
1128441267 15:67710967-67710989 AGAGTTGGTATCATGAAGGATGG - Intronic
1128748719 15:70133292-70133314 AAAGCTGCTCACATGGAGGGAGG + Intergenic
1128938947 15:71771408-71771430 AAAGTGTGTCTCTTGGTGGGTGG - Intronic
1129963019 15:79705915-79705937 AAAGTTGATCTCATGGAGGCAGG - Intergenic
1131526184 15:93154530-93154552 AAAGTCGGCCTTATGGAGCGGGG + Intergenic
1132120007 15:99168377-99168399 CAAGTTGTGGTCATGGAGGGGGG - Intronic
1134533029 16:14999835-14999857 AAAGTTTGTCTCAGGGAAGCTGG - Intronic
1137544511 16:49391757-49391779 AAGGTGGGTCTCATGAAGGAAGG - Intronic
1138619487 16:58199411-58199433 CACGGTGGTCTCAGGGAGGGAGG - Intergenic
1143838687 17:9713460-9713482 AAAGTTGATTTTATGGAGGTAGG - Intronic
1144368301 17:14566716-14566738 AAAGTTGTTTTCATGGCTGGCGG + Intergenic
1146351758 17:32101342-32101364 AAGGTTGGCCACATAGAGGGAGG + Intergenic
1147711374 17:42468581-42468603 AAAGTTGATCTCATAGAGGTAGG - Intronic
1148028994 17:44607236-44607258 TAACTTGGTGCCATGGAGGGTGG - Intergenic
1149151222 17:53566279-53566301 AATGTTGGTCTAATGGATGTAGG + Intergenic
1152650432 17:81490077-81490099 CAAGGTGCTCTCAGGGAGGGAGG + Intergenic
1152817036 17:82414107-82414129 AAAGTTGGAATGAGGGAGGGAGG - Intronic
1153781629 18:8500110-8500132 GAACTTGGCCTCCTGGAGGGAGG + Intergenic
1155379873 18:25208544-25208566 AAAGTGGGTTTAAGGGAGGGAGG - Intronic
1156064548 18:33124313-33124335 AATGTTGGTCTCATGGCTGCTGG + Intronic
1157181950 18:45505995-45506017 AAAGATGTTCTGAGGGAGGGAGG + Intronic
1157348272 18:46860517-46860539 AAAGTGGGTTTCAGGGAGAGAGG + Intronic
1157589249 18:48826419-48826441 AAGATTGTTCTCATGGTGGGAGG - Intronic
1157867855 18:51201458-51201480 AGAGTTTGACACATGGAGGGTGG + Intronic
1158743179 18:60166854-60166876 ATATGTGGTCTCATGGAAGGTGG - Intergenic
1165986757 19:39776382-39776404 AATGTTGGTCTCCATGAGGGAGG - Intergenic
1167153230 19:47722278-47722300 AAAGTGTGTCTCATGGGGCGGGG - Intronic
926172183 2:10559297-10559319 AATTTTGTTCTCATGGAGGGAGG + Intergenic
926455513 2:13062883-13062905 AAAGTAAATCTCATGGAGGTAGG - Intergenic
929011151 2:37446429-37446451 AAAGTTGATCTCATGGAGGTAGG - Intergenic
929729223 2:44468988-44469010 AATGTTGATCTCATGGAAGTAGG + Intronic
930616883 2:53602887-53602909 AAAGCTGGTGGCATGGAGGTAGG - Intronic
931080249 2:58761174-58761196 ACAGTGGGTCTCATGGATGATGG - Intergenic
931841075 2:66149103-66149125 ATAGTTGATTTCATGGAGGAAGG - Intergenic
932655508 2:73608021-73608043 AAACTTGGTCTGGTGGAAGGAGG - Intronic
933323989 2:80812796-80812818 AAAGTTGATCACATGGAGGTAGG + Intergenic
941469401 2:165865577-165865599 AAAGTTGGTGGCATTGTGGGAGG + Intronic
941516528 2:166487043-166487065 AAAGTTGTTATCCTGGAGGTGGG - Intronic
941690606 2:168497674-168497696 AAAGTTGGTGACATGGTGGCTGG + Intronic
943400237 2:187399891-187399913 AAAGTTGATCTCATAGAAGTAGG + Intronic
945962410 2:216149338-216149360 AGAGATGGTCTTATGGGGGGCGG - Intronic
945993519 2:216416319-216416341 CATGGTTGTCTCATGGAGGGTGG + Intronic
946042533 2:216794927-216794949 AAGGTGGATCTCATGGAGGTAGG + Intergenic
947902999 2:233738333-233738355 TAAATTGGTGTCATGGAGAGTGG + Intronic
1172730255 20:37081205-37081227 AAGTTGAGTCTCATGGAGGGGGG - Intronic
1173387815 20:42605065-42605087 AAAGTAGAACTCATGGAGTGAGG + Intronic
1174306761 20:49618939-49618961 AATGTTGGTCCCATGAAGGCAGG + Intergenic
1175010486 20:55729613-55729635 AAATGGGGTCGCATGGAGGGAGG + Intergenic
1175159423 20:56996818-56996840 AAAGGTGGCCACATGGTGGGGGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1179037691 21:37773558-37773580 AAAGTGGGTCTTTTGGAGAGGGG + Intronic
1179281953 21:39941318-39941340 AGAGTTGTTCTCAGGGAGTGAGG - Intergenic
1179495428 21:41768380-41768402 AAAGTTGGTCTCCTTAAGGCTGG + Intergenic
1181566354 22:23741101-23741123 AAAGTTGGTTTTAAGGAGAGTGG + Intergenic
1182149825 22:28020128-28020150 AAAGGTGGTGTGATGGTGGGTGG + Intronic
1182921557 22:34084857-34084879 AAAGATGGTCTGTTGAAGGGTGG - Intergenic
1183515225 22:38261679-38261701 AAAGGTGGTCACATGTAGAGGGG - Intronic
1183712334 22:39512500-39512522 AAGGTGGTTCTCATGGTGGGTGG + Intronic
1184299011 22:43543950-43543972 AGAGCTGGTCTCAAGGAGGAGGG - Intronic
1185358047 22:50386827-50386849 AAAGTTAGGCTGAAGGAGGGTGG + Intronic
949144347 3:678793-678815 ATAATTGATCTCATGGAGGTGGG - Intergenic
949147843 3:724704-724726 AAAACTGATCTCATGGAGGTAGG + Intergenic
949693419 3:6666922-6666944 AAAATTGGTGTCAAGGAGTGGGG + Intergenic
953210408 3:40870242-40870264 ATGGGTGGTCTCATGGAGAGTGG - Intergenic
953856249 3:46501395-46501417 ACAGTTGTCCCCATGGAGGGAGG + Intergenic
954439715 3:50515236-50515258 AGAGTTGTTGTGATGGAGGGTGG + Intergenic
954842343 3:53522960-53522982 AAAGCTGATCTCATGGAGACAGG - Intronic
955065530 3:55530862-55530884 AAAGGTGTTCTGGTGGAGGGGGG - Intronic
955879429 3:63527838-63527860 AAAGTTGGTGTGATGTAGTGTGG + Intronic
960878320 3:122318609-122318631 AAATTTGGACTCATGAAGGGAGG + Intergenic
961346105 3:126264398-126264420 AATGTTGGTCTCATTCAGGTGGG - Intergenic
962391882 3:134978966-134978988 GATGTTGTCCTCATGGAGGGTGG + Intronic
962953230 3:140240871-140240893 AAAGGTTCTCTCATGGAGAGGGG - Intronic
964456396 3:156871938-156871960 AATGTTGGTCTCATAGAATGAGG + Intronic
964697831 3:159529800-159529822 ACAGTTGATCTCATGGAAGGAGG - Intronic
967006112 3:185384140-185384162 AAAGTTGACCTCATGGAGGTAGG - Intronic
967146767 3:186613045-186613067 AAAGGTAGACCCATGGAGGGTGG - Exonic
967170567 3:186820130-186820152 AAACTAGGTCTCATGAAAGGAGG - Intergenic
969924498 4:10573693-10573715 AAAATTGGCCTCAAGGAGTGCGG + Intronic
970073289 4:12187720-12187742 ACAGTTGATCTCATGGAAGGAGG - Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
979299694 4:119073319-119073341 AAAGTTGATCTCTTGGAGGTAGG + Intergenic
981142562 4:141286385-141286407 AAAGTTGATCTCATGAAGGTAGG - Intergenic
981158227 4:141465325-141465347 ACAGTTGGTCTCCTGGGAGGAGG + Intergenic
981444283 4:144817757-144817779 AATGTTGATCTTATGGAGGTAGG + Intergenic
982377607 4:154710789-154710811 AAAGATGGTCCTATGGAGTGTGG - Intronic
982505917 4:156218005-156218027 AAAATTGGTATCAAGGAGAGGGG + Intergenic
985335681 4:188891095-188891117 AAAGTTGATCTCATGGAAGTAGG - Intergenic
987630369 5:20462303-20462325 AAAGTTGATCTCGTGGAAGTAGG + Intronic
989458414 5:41668495-41668517 AAAATAGGTCCAATGGAGGGTGG + Intergenic
990736068 5:58863775-58863797 AAAGTTGGTTTCTTAGAAGGGGG + Intergenic
990882122 5:60550537-60550559 AAAGTTGACCTCATGGAGGTAGG + Intergenic
991293182 5:65053079-65053101 AAATTTGATCACATGGAGGTAGG - Intergenic
991906579 5:71519504-71519526 AAAGTGGATCTCATGGAGGTAGG - Intronic
992224239 5:74604028-74604050 AAAGTTGATCTCATAGAAGTAGG + Intergenic
993942026 5:94070275-94070297 AAAGTTGATCTCATGGAAGTAGG + Intronic
994748488 5:103708997-103709019 AATGTTGGTCTGATGGAGAAAGG - Intergenic
998721465 5:144955874-144955896 AAAATTGATCTCATGGTGGTAGG - Intergenic
999941487 5:156547770-156547792 AAAGTTGGTCTCGAGGACTGAGG + Intronic
1000256567 5:159544541-159544563 AAAGCAGTTCTCAGGGAGGGAGG + Intergenic
1001679692 5:173547170-173547192 ACAGTTGGTCAGTTGGAGGGAGG + Intergenic
1006191008 6:32209298-32209320 AAAGTTAGTCTCATGGAAGTAGG + Intronic
1008097064 6:47349848-47349870 AAAGCTGTTCTCACAGAGGGAGG - Intergenic
1008838883 6:55874416-55874438 AAAGTTGGTATCATGGAGGCTGG + Exonic
1010638157 6:78285494-78285516 AAAGTTTATCTCATGTAGGGAGG - Intergenic
1012559623 6:100564395-100564417 AAAATTGATCTCATGGAGGTAGG - Intronic
1014993470 6:128111635-128111657 AGAGTGACTCTCATGGAGGGAGG - Intronic
1018854541 6:167666237-167666259 GTAGCTGGCCTCATGGAGGGTGG + Intergenic
1019934999 7:4249069-4249091 AGAGGTGGCCTCAGGGAGGGAGG + Intronic
1023215565 7:37859009-37859031 AAGCTTGTTCTCATGGAGGAAGG - Intronic
1023971562 7:44994986-44995008 AAAGTTGCTTTCATGAAGTGTGG + Intergenic
1024969683 7:55057080-55057102 GAAGGTGCTATCATGGAGGGAGG + Intronic
1027507850 7:79040422-79040444 AAAGTTGGTCTCATGGAGGGTGG + Intronic
1029017210 7:97327064-97327086 CAAATTTGTCTCATGCAGGGAGG - Intergenic
1029129119 7:98316840-98316862 GAAGTTGATCTCATGGAAGTGGG - Intronic
1030158696 7:106484712-106484734 AAAATTGGTCACGTGGAGGCTGG - Intergenic
1031569183 7:123336845-123336867 AAATTTGATCTCATGGAGGCAGG + Intergenic
1033477821 7:141707503-141707525 ACAGTTGATCTCCTAGAGGGAGG - Intergenic
1034287268 7:149895187-149895209 AAAGTTGATCTCATAGAGGTAGG + Intergenic
1034663855 7:152797727-152797749 AAAGTTGATCTCATAGAGGTAGG - Intronic
1034899900 7:154901553-154901575 AGAGTTGGCATCATGGTGGGTGG - Intergenic
1037363939 8:18102896-18102918 AAAATTGGTATCAAGGAGTGAGG + Intergenic
1037382448 8:18301145-18301167 GAAGTTGATTTCATGGAGGTAGG - Intergenic
1037838131 8:22226666-22226688 AAGGTTGGGCTCCTGGAGGCAGG + Intronic
1040386719 8:46919162-46919184 GAAGTTGGACACAAGGAGGGAGG + Intergenic
1042695678 8:71552538-71552560 AAAGTTTGACTCATGAAGAGTGG + Intronic
1044092598 8:88020839-88020861 AACTTTGGTCTTATGGAGAGAGG - Intergenic
1044758779 8:95494699-95494721 AAAGTTGATCTCATGGAAGTGGG + Intergenic
1047689421 8:127336145-127336167 TAAGTTTGTCTTAGGGAGGGGGG - Intergenic
1049604598 8:143523425-143523447 GAAGGTGATCTCAGGGAGGGTGG + Intronic
1051125928 9:13805724-13805746 TATGTTAGTCTTATGGAGGGAGG + Intergenic
1051626013 9:19100880-19100902 AAAGTGGACCTCATGGAGGTAGG + Intronic
1051989527 9:23135260-23135282 AAAGTGGATCTCATGGAGATAGG - Intergenic
1056555950 9:87687331-87687353 AAAGTTGATTTTATGGAGGTAGG - Intronic
1056774245 9:89499327-89499349 AAAGCTGGTGTCAAGCAGGGTGG + Intergenic
1057163800 9:92910616-92910638 AAACCTGGGCTCTTGGAGGGTGG - Intergenic
1061561092 9:131403794-131403816 AAATATGGCCTCATGTAGGGAGG + Intronic
1061854509 9:133434199-133434221 AAAGTGGCACTCAGGGAGGGAGG - Intronic
1062588848 9:137263907-137263929 AAAGATGGTCTCAGGGCTGGAGG - Intronic
1186918942 X:14256094-14256116 AATGTAGGTCTCATGAAAGGAGG - Intergenic
1188396274 X:29687445-29687467 AAGGTTGTTCTCATGGAAGTAGG + Intronic
1188455391 X:30358772-30358794 AAATTTGGTGTCATGGAATGAGG - Intergenic
1193995263 X:88358990-88359012 AAAGTTGGACTCATGGAAGGGGG + Intergenic
1196422344 X:115536110-115536132 AAAGTTGGTCTCTGGTAGGGTGG - Intergenic
1196717557 X:118825379-118825401 GAAGTTGTTCTCGGGGAGGGTGG + Exonic
1197761831 X:130033466-130033488 AAAGTGGGGCTCAGAGAGGGAGG + Intronic
1197915614 X:131531017-131531039 AAATTTGGTATCATGGTGGAAGG - Intergenic
1198099924 X:133414804-133414826 ACCGTTGATCTCGTGGAGGGGGG + Exonic
1198316249 X:135469518-135469540 AAGGAAGGGCTCATGGAGGGAGG - Intergenic
1199190849 X:144968129-144968151 ATAGTTGATCTCATGGAGATAGG + Intergenic