ID: 1027508482

View in Genome Browser
Species Human (GRCh38)
Location 7:79049067-79049089
Sequence GGTGGAGCATGTCACTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027508482_1027508487 28 Left 1027508482 7:79049067-79049089 CCATAGGAGTGACATGCTCCACC 0: 1
1: 0
2: 1
3: 2
4: 93
Right 1027508487 7:79049118-79049140 TTAATGTTACTCATCCACAAAGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027508482 Original CRISPR GGTGGAGCATGTCACTCCTA TGG (reversed) Intronic
906712443 1:47940969-47940991 GGTGGAGAGTGTCATTCATATGG - Intronic
914675389 1:149904083-149904105 GGTGGAGCCTCTCACTCCAGAGG + Exonic
915312729 1:155012362-155012384 AGTGGATCCTGTCCCTCCTAAGG - Intronic
916627284 1:166571937-166571959 GCGGGAGCATGCCACTCCTGAGG - Intergenic
918430893 1:184459776-184459798 TGTGGTCCATGTCCCTCCTAGGG - Intronic
920097617 1:203496782-203496804 GGTCCAGCATGTCCATCCTATGG - Intronic
923140189 1:231155438-231155460 GATGGTGCATGTAACTCCAACGG - Intergenic
1079860144 11:25659019-25659041 GGTGTAGCATGACACAGCTAAGG - Intergenic
1085493720 11:76947049-76947071 GGTGCATCTTGTCACTTCTATGG + Intronic
1088424248 11:109684772-109684794 GCTGGAGCATGTAACTCAGAAGG + Intergenic
1092449278 12:8586761-8586783 AGTGGAGACTGTCTCTCCTAGGG - Intergenic
1094169668 12:27479091-27479113 GGTGGAGCAAGTCAGTCCCCAGG + Intronic
1095299453 12:40565702-40565724 GGTGGAGAAGGGCACTCCTCAGG - Exonic
1098693573 12:73522228-73522250 GGAGGAGCAAGTCACACCTTTGG - Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101863166 12:108499430-108499452 GGTGGGCCACGTCACTCCTCAGG + Intergenic
1108969899 13:56361167-56361189 TGTGTAGCATCTCCCTCCTATGG - Intergenic
1111772829 13:92621505-92621527 ACTGAAGCATTTCACTCCTAAGG + Intronic
1118164401 14:63321773-63321795 GTTGGACCCTGTGACTCCTAAGG + Intergenic
1120535986 14:85695827-85695849 TGTGGAGCAAGTCATTCCTCAGG - Intergenic
1120854851 14:89203506-89203528 CCTGGAGCATGTCCCTCCTCTGG + Intronic
1121834855 14:97082890-97082912 GGTGGAGGATGTCGATACTAGGG - Intergenic
1123500717 15:20878449-20878471 GGTGGTCCATCTCGCTCCTACGG - Intergenic
1123557963 15:21452142-21452164 GGTGGTCCATCTCGCTCCTACGG - Intergenic
1123594191 15:21889423-21889445 GGTGGTCCATCTCGCTCCTACGG - Intergenic
1124660801 15:31549440-31549462 GGTGGAACCTGTGACTCCGACGG + Intronic
1125550663 15:40542072-40542094 GTTGGATCAGGTCACCCCTAAGG - Intronic
1128546887 15:68574330-68574352 GGAGGAGCATCTCCCTCTTAGGG + Intergenic
1132191701 15:99867752-99867774 ACTGAAGCATTTCACTCCTAAGG - Intergenic
1202966314 15_KI270727v1_random:179314-179336 GGTGGTCCATCTCGCTCCTACGG - Intergenic
1132590959 16:726295-726317 GGTGGAGAATGTGAGTCCTCTGG - Exonic
1137871472 16:51954242-51954264 GGGGGAGCATGTTCCTGCTAAGG + Intergenic
1140569147 16:76082215-76082237 GGAGGAGCGTGTGACTCCAAAGG + Intergenic
1145288053 17:21521258-21521280 GGGAGAGCATGTCATTACTAAGG - Intergenic
1145389587 17:22445186-22445208 GGGAGAGCATGTCATTACTAAGG + Intergenic
1148207967 17:45791405-45791427 GGTGGATGATTTCACTCTTACGG + Intronic
1152262192 17:79273238-79273260 GGTGGTGGACGTCACTCCTGGGG - Intronic
1155943734 18:31825274-31825296 GGTGGAGCATGCCACTCCAATGG - Intergenic
1156483550 18:37450775-37450797 GGTGGTACCTGTCACTCCTTGGG + Intronic
1156650361 18:39218716-39218738 GGTGAAACATTACACTCCTAAGG + Intergenic
1157150781 18:45215618-45215640 GTTTGAGCATCTCTCTCCTATGG - Intronic
1159094229 18:63884339-63884361 TGCAGAGCAGGTCACTCCTACGG - Intronic
1159209533 18:65298831-65298853 GGTAGACCATGTTAGTCCTAAGG + Intergenic
1162378341 19:10317790-10317812 GGTGGAACAGGTCACTCCCTGGG + Intronic
1165848026 19:38831500-38831522 GTTGGAGCCTGTCAGTCCTGGGG + Exonic
1166099184 19:40560871-40560893 GGTCCAGCATGTGACTCCCAGGG - Intronic
932811837 2:74832837-74832859 GGTGGAGAATGGCAAGCCTAAGG - Intergenic
936034408 2:109099430-109099452 AGTGGAGCAAGTCTCTCCAAAGG + Intergenic
936874004 2:117166525-117166547 GTGGGTACATGTCACTCCTAAGG + Intergenic
937590405 2:123606755-123606777 GCTGGTGCATGTCTCTACTAGGG - Intergenic
938734276 2:134172239-134172261 ACTGGAGCGTGTGACTCCTAAGG + Intronic
941203108 2:162539014-162539036 GGTGCAGCTTGCCATTCCTAAGG - Intronic
942176844 2:173342822-173342844 GGTGGAACTTGTCCCTCCTGGGG - Intergenic
944156863 2:196616669-196616691 GGTAGTGGATGTCACTCCTGTGG + Intergenic
1174162639 20:48562632-48562654 GGTGGGTCACGTCACTCCTGAGG - Intergenic
1179654777 21:42838108-42838130 GGTGGAGGCCGTCCCTCCTAAGG - Intergenic
953534928 3:43770108-43770130 TGTGGAGCATGTGACCCCTGTGG - Intergenic
953534957 3:43770288-43770310 TGTGGAGCATGTCACCTCTGTGG - Intergenic
954785799 3:53091575-53091597 GTTGGAGCATGTAGCTCCAAAGG + Exonic
958952833 3:100434994-100435016 GGTGGGGCATGGCCCTCTTAGGG + Intronic
959157643 3:102685950-102685972 GGTGGAACAAGTCTCTCCGAAGG - Intergenic
962252342 3:133843517-133843539 AAAGGAGCATGTCACTCCTGGGG - Intronic
964061112 3:152524347-152524369 GGTATAGCCTGTTACTCCTAAGG - Intergenic
964862659 3:161219806-161219828 GAAGGAGCATGTAACTCCTCTGG + Intronic
971958472 4:33454086-33454108 GCTGAAGCTTGTGACTCCTATGG + Intergenic
972661541 4:41121562-41121584 GGTGGAGGATTTCCATCCTAGGG - Intronic
978883120 4:113732023-113732045 GGTGGGTCATTTCACTCCTTTGG + Intronic
985537135 5:472027-472049 GGTGGAGGTGGACACTCCTAGGG - Intronic
986625588 5:9720861-9720883 AGTGCAGCATGGCACTCCTGGGG - Intergenic
997196527 5:131983987-131984009 TGGGGAGCAGGTCACTGCTATGG - Intronic
999268620 5:150283251-150283273 AGTGGAGCATGTCAGCCCTGGGG - Intronic
1000019524 5:157306937-157306959 GGTGGAGCAGGGTACTGCTAAGG - Intronic
1000520315 5:162286780-162286802 CTTTGAGCAAGTCACTCCTAAGG - Intergenic
1003994314 6:11523466-11523488 GGAGGAGGATGTCACCACTAGGG + Intergenic
1016097232 6:140053164-140053186 GGTGGAGCAGATAACTCCAAAGG + Intergenic
1022671133 7:32457395-32457417 GTTGGAGCATGTCAGTACTATGG - Intergenic
1022903966 7:34838007-34838029 GGAGGAGCATGTCAGACCCATGG - Intronic
1024520725 7:50303143-50303165 GGAGGCGCATCTCACTCCTCTGG + Intergenic
1027508482 7:79049067-79049089 GGTGGAGCATGTCACTCCTATGG - Intronic
1027900382 7:84106377-84106399 GGTGGAGCCTATTGCTCCTAAGG - Intronic
1029253597 7:99253905-99253927 GGAGTCTCATGTCACTCCTAGGG + Intergenic
1031270542 7:119643972-119643994 GGAGGAGCATGTCACATCTTAGG - Intergenic
1035577709 8:718648-718670 GGCGGAGCTTGTGACTCCCAGGG - Intronic
1037179878 8:15992580-15992602 GGTGGAGCAGGTCAGTCCCTGGG + Intergenic
1037297302 8:17414140-17414162 GGTGGAGCATTGTACTCTTAGGG - Intergenic
1040902265 8:52428948-52428970 GGTGAAGCATGCCCCTCCTCAGG - Intronic
1041890003 8:62858470-62858492 GGTGGGGCATGTCACTACCTTGG - Intronic
1047462135 8:125076822-125076844 AGTGGAGCCTGTCAGTTCTAAGG - Intronic
1053024629 9:34719649-34719671 GGTGGAGCAGGTCCCTCCCATGG - Intergenic
1053035988 9:34827125-34827147 GGTGGAGCAGGTCCTTCCCATGG - Intergenic
1057139295 9:92717039-92717061 GCTGGAGCAGGTCACTGCTGGGG - Intronic
1062405858 9:136395948-136395970 AGTGGAGCCTGTCACTCTCAAGG + Intronic
1196846932 X:119903895-119903917 GGAGGAGCATCTCCCTCCTTAGG - Intronic
1197985318 X:132260489-132260511 AGTTGATCATGTCACTCCTCTGG + Intergenic
1199084672 X:143615159-143615181 GCTGGAGCATGTACCTCCTGAGG - Intergenic
1199519951 X:148724035-148724057 GGTGAAGCAAGTCACTACCAAGG + Intronic
1199753764 X:150845677-150845699 TGGGGAACAGGTCACTCCTATGG - Intronic