ID: 1027515441

View in Genome Browser
Species Human (GRCh38)
Location 7:79136902-79136924
Sequence CATCAGGGAGCTATCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515441_1027515453 9 Left 1027515441 7:79136902-79136924 CCCGGCCTGATAGCTCCCTGATG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515441_1027515447 -5 Left 1027515441 7:79136902-79136924 CCCGGCCTGATAGCTCCCTGATG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1027515447 7:79136920-79136942 TGATGCCTCCCATTGGTCCCAGG No data
1027515441_1027515449 -3 Left 1027515441 7:79136902-79136924 CCCGGCCTGATAGCTCCCTGATG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1027515449 7:79136922-79136944 ATGCCTCCCATTGGTCCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 135
1027515441_1027515448 -4 Left 1027515441 7:79136902-79136924 CCCGGCCTGATAGCTCCCTGATG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1027515448 7:79136921-79136943 GATGCCTCCCATTGGTCCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515441 Original CRISPR CATCAGGGAGCTATCAGGCC GGG (reversed) Intronic
900216281 1:1483492-1483514 CACCAGTGAGCCACCAGGCCTGG - Intronic
900394519 1:2447720-2447742 CATCAGGGAGGAGTGAGGCCAGG - Intronic
902192747 1:14774985-14775007 CCTCATGGAGCTCCCAGGCCTGG + Intronic
902414532 1:16231010-16231032 GATCATGGAGTTGTCAGGCCAGG - Intergenic
902531086 1:17091165-17091187 CATCAGGGAGATATTTAGCCAGG - Intronic
902564511 1:17302226-17302248 CGTCAGGGAGCTTTCAGTCATGG - Intergenic
903006680 1:20303321-20303343 CATCTAGGAGGGATCAGGCCAGG + Intronic
903824255 1:26131326-26131348 AATCCTGGAACTATCAGGCCAGG + Intergenic
904957772 1:34300230-34300252 CATCAGAGATCTATCAGGCAAGG - Intergenic
906803741 1:48759675-48759697 AATCAGGGAGAAATGAGGCCAGG + Intronic
907514464 1:54984665-54984687 CCTCAGGGAGCTCACAGACCGGG + Intronic
907672981 1:56492993-56493015 CATGAGTGAGCCATCATGCCTGG + Intergenic
911509682 1:98795944-98795966 CATTAGGGGGCTGTCAGGCTAGG + Intergenic
912586971 1:110776040-110776062 GATCAAGGAGCTAGCAGGCCTGG - Intergenic
912665149 1:111572124-111572146 CACCAGGGAGGTATCAGAGCAGG + Intronic
913133356 1:115863334-115863356 CGTCAGGGAGCAGTCAGGCTGGG + Intergenic
915854351 1:159365716-159365738 TATCAGGTAGCTATGAAGCCTGG + Intergenic
919881712 1:201905310-201905332 CATCATGTAGCCATAAGGCCTGG - Intronic
920399164 1:205666513-205666535 CATCAGATGGCTATCAGTCCTGG + Intronic
922701407 1:227763332-227763354 CATCAGGGAGCTGGAAGCCCAGG - Intronic
922998598 1:229986951-229986973 CTTCAAGGAGCTTTCAGTCCTGG - Intergenic
924708908 1:246518670-246518692 CACCAGGCAGGTCTCAGGCCAGG - Intergenic
924756875 1:246949311-246949333 CAACTGTGAGCTACCAGGCCCGG - Intronic
1063098578 10:2929735-2929757 TTTCAGAGAGCTCTCAGGCCAGG - Intergenic
1064965826 10:21014264-21014286 CAGGAGTGAGCCATCAGGCCTGG + Intronic
1066227208 10:33394865-33394887 CATATGGGAGCTATCATACCTGG + Intergenic
1069504337 10:68984045-68984067 AATCAGGCAGTTATCTGGCCAGG - Exonic
1069650527 10:70043846-70043868 CCTCAGGGAGCTTTCACTCCTGG - Intergenic
1069749780 10:70737659-70737681 CATCAAGGACCTGCCAGGCCAGG - Intronic
1070006809 10:72432571-72432593 CTTCAGGGAGCTAACAGACATGG + Intronic
1070072678 10:73104979-73105001 CATCAAAGAGATATCTGGCCAGG + Intergenic
1070322642 10:75365908-75365930 CATAAGGGAGGAATCAGGGCAGG + Intergenic
1070934112 10:80280377-80280399 CACCAGGGAGATTTCAGGCTTGG - Intronic
1071423042 10:85520748-85520770 CATCAGGAAGAGAGCAGGCCAGG - Intergenic
1071518802 10:86316331-86316353 CATGAAGGAGCTGTCAGTCCTGG - Intronic
1073094621 10:100972053-100972075 CCAGAGGGAGCTCTCAGGCCAGG + Intronic
1076476509 10:130757493-130757515 CATCAGTCAGCTCTCAGGTCTGG + Intergenic
1076994481 11:291441-291463 CTCCAGGGACCTATCAGGACGGG + Intronic
1078450666 11:11438226-11438248 CATCTGGGAGCTGACAGGCCTGG - Intronic
1079578926 11:22037707-22037729 CACCAGGTTGCTAACAGGCCAGG + Intergenic
1083616274 11:64028202-64028224 CAGCAGGGAACTAGAAGGCCTGG - Intronic
1084150572 11:67286173-67286195 CATCAGCGAGACCTCAGGCCAGG - Exonic
1084468184 11:69339490-69339512 CTTCTGGGAGCTATGAGGCAGGG - Intronic
1084531467 11:69730345-69730367 CATCAGGGAGCTTGCCTGCCTGG + Intergenic
1084937493 11:72594915-72594937 CTTCAGGGAGCTCTCAGTCTGGG - Intronic
1085250857 11:75142871-75142893 CATCAGGGAGGCCTGAGGCCTGG + Intronic
1085662028 11:78377054-78377076 CCTCAGGGAGCTTTCAGTCATGG - Intronic
1086092851 11:83021341-83021363 GATCAGGGAGCTCCCAGGTCTGG - Intronic
1087147378 11:94825553-94825575 TGTCAGGGAGCTCTTAGGCCAGG - Intronic
1090048402 11:123356783-123356805 ATTCAGGGAGCTAGGAGGCCTGG + Intergenic
1090833356 11:130435837-130435859 CATGAGGGAGCAATCTGGCTGGG + Intergenic
1093310733 12:17579822-17579844 CAGCAGGGAACTGTCAGGCACGG - Intergenic
1094450897 12:30582278-30582300 CCTCAGGGAGCTCACAGTCCAGG + Intergenic
1095375652 12:41525173-41525195 ACTCAGGGAGATACCAGGCCTGG + Intronic
1095884365 12:47173545-47173567 AATTAAGGAGCTAACAGGCCGGG - Intronic
1095928138 12:47599912-47599934 CCTCAGGGAGCTTTCAATCCTGG + Intergenic
1096104796 12:48990828-48990850 CTTCAGGGAGCTCTCAAGCTAGG - Intergenic
1097140712 12:56900544-56900566 GCTCAGGGAGCTCTCAGGTCTGG - Intergenic
1097767988 12:63547523-63547545 CTACAGAGAGCTATCAGGACTGG + Intergenic
1097784348 12:63742589-63742611 CTACAGAGAGCTATCAGGACTGG + Intergenic
1099095122 12:78365775-78365797 CCTCAGGGAGCTTTCAGTCATGG - Intergenic
1101609026 12:106273716-106273738 CATGAGGGAGCCATCATGTCCGG - Intronic
1101898212 12:108771291-108771313 CCTCAGGGAGCTCACAGTCCTGG + Intergenic
1104852412 12:131883559-131883581 CATGAGGGAGCCACCAGGCAGGG + Intergenic
1106025091 13:25948789-25948811 GATCAGGGAGCCAGCATGCCTGG - Intronic
1107447165 13:40479717-40479739 CGTGAGGGAGCTGGCAGGCCAGG + Intergenic
1108274072 13:48790318-48790340 CGTCAGGGAGCTCTCAGTCATGG + Intergenic
1109622130 13:64924855-64924877 TATCAGGGAGCTCCCAGGTCTGG + Intergenic
1110046498 13:70839834-70839856 TATCAGGGAGCTATAAGTCTGGG + Intergenic
1110261250 13:73487489-73487511 CCTCAGGGAGCTTCCAGGCATGG - Intergenic
1112028262 13:95432542-95432564 CAGCTGGGAGCCATCATGCCAGG + Intergenic
1112552549 13:100435206-100435228 CCTCAGGGAGCTTTCAGTCATGG + Intronic
1113785632 13:113000830-113000852 CAGCAGGGACATAGCAGGCCGGG + Intronic
1114843334 14:26291417-26291439 GATCAGGGTGCTATCATGTCTGG + Intergenic
1116797949 14:49411880-49411902 CCACAGGGAGCCATCAGACCTGG + Intergenic
1117505544 14:56398826-56398848 CATCAATGATCTTTCAGGCCTGG + Intergenic
1121596623 14:95168271-95168293 CCTCAGGGAGCTTTCAGTCATGG - Intergenic
1121644356 14:95507705-95507727 CACCAGGCAGCGAGCAGGCCTGG - Intergenic
1125851935 15:42912427-42912449 CATGTGTGAGCCATCAGGCCTGG - Intronic
1126063811 15:44809726-44809748 CATCAGGGAGTCATTCGGCCTGG + Intergenic
1127294678 15:57598828-57598850 CAGCAGACAGCTATCAGGCAAGG - Intronic
1127604614 15:60573877-60573899 CTTCAAGGAGCTCACAGGCCAGG - Intronic
1129236394 15:74226120-74226142 CTTCAGGGAGCTGCCAGGCTGGG + Intergenic
1129567330 15:76636549-76636571 CTTCAGGGAGCCATCAGACAGGG + Intronic
1129661990 15:77558068-77558090 CTTCTGGGAGCTTGCAGGCCAGG + Intergenic
1129741123 15:77990112-77990134 CGGCCGGGAGCTCTCAGGCCAGG - Intronic
1129844595 15:78762440-78762462 CGGCCGGGAGCTCTCAGGCCAGG + Exonic
1130710535 15:86276630-86276652 GATAAGGGGGCTATCAGGGCAGG + Intronic
1130756999 15:86774576-86774598 CAACAGGTAGCTCTCAGGGCAGG + Intronic
1130861446 15:87894490-87894512 CATCAGGGAATGATCAGGGCAGG - Intronic
1130877328 15:88025974-88025996 AATAACTGAGCTATCAGGCCAGG + Intronic
1130904046 15:88227591-88227613 CATCAAGGAGCCAGCAGGACTGG - Intronic
1130956547 15:88630913-88630935 TAGCAGGGAGCTGACAGGCCAGG - Exonic
1132672317 16:1106874-1106896 CATCGGGAGGCTGTCAGGCCGGG - Intergenic
1132681708 16:1145111-1145133 CAGCAGGGTGCTGCCAGGCCAGG - Intergenic
1133211122 16:4263957-4263979 CATCTGGAAGCCATCAGGCCAGG - Intronic
1133296590 16:4756118-4756140 CAGGCGTGAGCTATCAGGCCTGG - Intronic
1134566769 16:15258370-15258392 CCTCCGGGAGCTGTCAAGCCTGG - Intergenic
1134735724 16:16498329-16498351 CCTCCGGGAGCTGTCAAGCCTGG + Intergenic
1134931802 16:18213893-18213915 CCTCCGGGAGCTGTCAAGCCTGG - Intergenic
1138437719 16:57014794-57014816 AATCAGGGAGCCAGCAGGCCTGG + Intronic
1138515333 16:57532974-57532996 CCTCTGGGAGCTGCCAGGCCTGG + Intronic
1142311029 16:89313839-89313861 GAGTAGGGAGCTCTCAGGCCTGG - Intronic
1143440111 17:6964801-6964823 CATGAGTGTGCCATCAGGCCTGG - Intronic
1143913668 17:10273038-10273060 CAGGTGGGAGCTATCATGCCTGG + Intergenic
1144029037 17:11303665-11303687 GACAAGGGAGCCATCAGGCCTGG + Intronic
1144639731 17:16930807-16930829 CACTAGGCAGCTCTCAGGCCAGG - Intronic
1145052271 17:19671995-19672017 CATCTGGCAGCCATCAGGCCAGG - Intronic
1147252019 17:39158333-39158355 CATGAGTGAGCTACCACGCCTGG - Intronic
1149555297 17:57569244-57569266 CATCAGGGAACTATCAGGCAAGG - Intronic
1150463436 17:65371909-65371931 CATCAGGGAGCTGGGAGGTCTGG - Intergenic
1151426969 17:74037345-74037367 CATCAGGCAGCTCTGAGCCCAGG + Intergenic
1152117721 17:78398965-78398987 CATGAGGGAGCACGCAGGCCTGG - Intronic
1152407241 17:80104755-80104777 CAGCAGGGAGCCAGCAGACCAGG + Intergenic
1153362232 18:4210186-4210208 CTTCAGGGAGCTAACAGGCCAGG - Intronic
1153964422 18:10166985-10167007 CAACAAGGTGCCATCAGGCCCGG + Intergenic
1155095150 18:22548313-22548335 GAACAGGGAGCCAGCAGGCCTGG + Intergenic
1155175472 18:23297916-23297938 CAACAGGGAGCTATGAGACCAGG + Exonic
1156444208 18:37222895-37222917 CATCAGGGAGTGATTAGTCCTGG + Exonic
1157190198 18:45575184-45575206 AATCAGGGAGCTCTCTTGCCTGG + Intronic
1165937431 19:39397841-39397863 CAACAGGGAGCTCGCAGGCCGGG + Exonic
1167314887 19:48757426-48757448 CATCAGTGCTCTCTCAGGCCAGG - Intronic
1168719326 19:58546158-58546180 TATCAGGGAGTTGTCAGACCTGG + Intronic
927105244 2:19818488-19818510 GATCAGGGATCCATGAGGCCAGG + Intergenic
927127927 2:20030316-20030338 CATCAGGGAGCTTTCAGTCGTGG + Intergenic
927604933 2:24478284-24478306 CATCATGTATCTAACAGGCCAGG - Intergenic
929651226 2:43681705-43681727 CATCAGGGAGCTCCCTTGCCTGG - Intronic
932440717 2:71732950-71732972 CAGCAGGCAGCTACGAGGCCAGG - Intergenic
933075003 2:77913030-77913052 GATTTGGGAGCTATCAGGCACGG + Intergenic
933178882 2:79207767-79207789 CATCAGGGAGCCATCAGAGTGGG - Intronic
940168520 2:150801596-150801618 TATCAGTTAGCTAACAGGCCAGG + Intergenic
941963397 2:171276007-171276029 GATCAAGGAGTTATCAGGGCTGG + Intergenic
945999238 2:216467066-216467088 CTTCAGGGAGCTACCAGGGGAGG + Intronic
946144352 2:217717783-217717805 CATCAGAGGGCTAACTGGCCTGG + Intronic
946371678 2:219285167-219285189 CACCAGGGACCTATCAGCCCTGG - Exonic
946404610 2:219485534-219485556 CATCAGGGAGCAGTCATGGCTGG + Intronic
948835185 2:240622939-240622961 CAGCAGGGAGAGAACAGGCCTGG + Intronic
1171498766 20:25577177-25577199 AAGCAGGGAGCTAACTGGCCGGG + Intronic
1172527717 20:35610467-35610489 CAGCAGTGAGCCATCATGCCCGG - Intergenic
1174402446 20:50283255-50283277 CAGCAGGAAGCTATCAGGGCTGG - Intergenic
1175312332 20:58020422-58020444 CATCCTGGAGCTCTCAAGCCCGG + Intergenic
1177043282 21:16139382-16139404 CCTCAGGGAGCTTTCAAGCATGG + Intergenic
1182827697 22:33279881-33279903 CACAATGGAGCCATCAGGCCAGG + Intronic
1183516793 22:38271679-38271701 CATCAAGGAGCTCTCAAGCATGG - Intronic
1184298595 22:43541814-43541836 CTGCAGGGAGCTTCCAGGCCAGG - Intronic
949267428 3:2174786-2174808 CCTCAGGGAGCTTTCAGTCATGG + Intronic
950156368 3:10724412-10724434 AAACAGGGACCTATCAGGGCTGG - Intergenic
950940580 3:16886313-16886335 AATCAAGGAGTTATCAGGACAGG + Intronic
952523545 3:34186191-34186213 CATCAGGGAGTCATTTGGCCTGG - Intergenic
953155042 3:40362046-40362068 CATCATGGAGTTATAAGGACTGG + Intergenic
954905050 3:54054400-54054422 CCTCAGTGAGCTTCCAGGCCAGG - Intergenic
959438642 3:106349380-106349402 GATAAGGGAGCTATCAGCCTGGG - Intergenic
961976369 3:131028879-131028901 CCTCAGGGAGCTATGAGACGTGG - Intronic
962958064 3:140284882-140284904 GTTCAGGGAGCTATCAGGAAGGG - Intronic
964047007 3:152340751-152340773 CTTCAGTGAGTTAGCAGGCCTGG - Exonic
969184297 4:5464031-5464053 CATCAGGGAGCTTCCAGTCAGGG + Intronic
971938710 4:33188079-33188101 GATCAGGGAGCTCCCAGGTCTGG + Intergenic
977340136 4:95747541-95747563 CATCAGGGAACTATTAGACAAGG + Intergenic
982693608 4:158574665-158574687 TATCAGGGAGATTTCAGCCCAGG - Intronic
984325282 4:178242677-178242699 GCTCAGGGAGCTCTCAGGTCTGG - Intergenic
986107321 5:4672287-4672309 CTTCAGGGAGCTTTCTGGCTGGG + Intergenic
987327618 5:16826638-16826660 CATCAGAGAGCTTACAGGCAAGG - Intronic
993718485 5:91298428-91298450 CTGCAGTGAGCTATCAGCCCTGG + Intergenic
996089543 5:119337483-119337505 CCTCAGGGAGCTATCTGAGCTGG + Intronic
998168364 5:139857343-139857365 CTTCAGGGAGCAGTCAGGGCAGG - Intronic
998502371 5:142644730-142644752 CCTCAGGGAGCTAACAGTCTGGG - Intronic
1000731741 5:164843181-164843203 CATCAAGGAACTCTCAGTCCAGG - Intergenic
1002294960 5:178225192-178225214 CCTCTGGGAGGTCTCAGGCCTGG + Intronic
1002945776 6:1759757-1759779 TATCAGGGAACTATCAGGTATGG + Intronic
1003843112 6:10143171-10143193 AATAAAGGAGCTATCAAGCCAGG + Intronic
1003864315 6:10349374-10349396 GATCGGGGAGTTATCAGCCCTGG + Intergenic
1005427092 6:25714108-25714130 CACCAGGGGGCTGGCAGGCCTGG + Intergenic
1006462508 6:34170474-34170496 CCTCATGGAGCCACCAGGCCTGG + Intergenic
1008328408 6:50215587-50215609 CATCAGGCAGTTAACAGGCCGGG - Intergenic
1008354354 6:50533780-50533802 CAGGTGGGAGCCATCAGGCCCGG - Intergenic
1008519253 6:52347300-52347322 CATCTGTGTGCTATCAGACCAGG + Intergenic
1010329650 6:74608275-74608297 CATCAGGGAGCTATTATACAAGG + Intergenic
1011258535 6:85449320-85449342 AATCCGGCAGCTATCAGGACGGG - Intergenic
1013094253 6:106929932-106929954 CATATGGAAGCTATCAAGCCAGG - Intergenic
1015530053 6:134212578-134212600 CCTCAGGGAGCTCCCAGGCCAGG + Intronic
1018996302 6:168712842-168712864 CATCAGTGAGCTATCAGAAAAGG - Intergenic
1019974737 7:4572174-4572196 CCTCAGGGAGCTTTCAGTCATGG + Intergenic
1025096721 7:56101501-56101523 CCTCAGGGAGCTGTCAGATCTGG + Intergenic
1027515441 7:79136902-79136924 CATCAGGGAGCTATCAGGCCGGG - Intronic
1032642407 7:133784537-133784559 CATCAGGGAGCTGACAGTCCAGG + Intronic
1034284894 7:149878304-149878326 CACCAGGGAGCGAACAGGGCAGG - Intronic
1034291652 7:149937239-149937261 TGTCAGGGAGCCATCAGGCACGG - Intergenic
1034814437 7:154159659-154159681 TGTCAGGGAGCCATCAGGCACGG + Intronic
1035945525 8:3957157-3957179 CATCAGGGATCTAGCAGAGCTGG - Intronic
1037737439 8:21578883-21578905 CATCAGGGAGCTGACACCCCAGG - Intergenic
1039379973 8:37076032-37076054 CATCAGAGAGCCAACAGGTCAGG - Intergenic
1040579101 8:48681342-48681364 CATCAGGGAGCCAAGATGCCAGG - Intergenic
1044382332 8:91549179-91549201 CATCTGTGAGCAATCAGGCAGGG - Intergenic
1046945273 8:119968595-119968617 AAGAAGGGAGCTCTCAGGCCAGG - Intronic
1049647115 8:143740427-143740449 CCTCAGGGCGGTATCGGGCCCGG - Intergenic
1051801778 9:20942759-20942781 CCTTATGGAGCTTTCAGGCCAGG + Intronic
1054178327 9:61891667-61891689 CGTCAGGGATCTAGCGGGCCAGG - Intergenic
1055776007 9:79767839-79767861 CATCAGGGAGCTTTCAGTCAAGG - Intergenic
1056109186 9:83377680-83377702 CATCAGGGAGCTTACAGTCATGG - Intronic
1056205204 9:84313141-84313163 CATCAGGGAACTCTGAGGACAGG + Intronic
1057369674 9:94459155-94459177 CAACAGGGAGCTGTCATCCCAGG + Exonic
1059868541 9:118545241-118545263 CCTCAGAGAACTATCAGACCTGG + Intergenic
1061397117 9:130349274-130349296 CCTCACAGAGCTATCAGGCTTGG + Intronic
1189561892 X:42199567-42199589 ATTCAGGGAGCTATCAGGAGAGG + Intergenic
1192173163 X:68869292-68869314 CTTCATGGAGCTTACAGGCCAGG - Intergenic
1192558872 X:72111851-72111873 CCTCAGGGAGCTTACAGTCCAGG + Intergenic
1198440071 X:136654519-136654541 CATCAGGGAACTTTTAGCCCTGG + Intronic
1199455352 X:148021607-148021629 CATCAGGGAACTCTGAGGCTAGG - Intronic
1199934393 X:152557808-152557830 CATCAGGGAACTAACAAGGCAGG - Intergenic