ID: 1027515442

View in Genome Browser
Species Human (GRCh38)
Location 7:79136903-79136925
Sequence GCATCAGGGAGCTATCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515442_1027515448 -5 Left 1027515442 7:79136903-79136925 CCGGCCTGATAGCTCCCTGATGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1027515448 7:79136921-79136943 GATGCCTCCCATTGGTCCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 100
1027515442_1027515453 8 Left 1027515442 7:79136903-79136925 CCGGCCTGATAGCTCCCTGATGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515442_1027515447 -6 Left 1027515442 7:79136903-79136925 CCGGCCTGATAGCTCCCTGATGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1027515447 7:79136920-79136942 TGATGCCTCCCATTGGTCCCAGG No data
1027515442_1027515449 -4 Left 1027515442 7:79136903-79136925 CCGGCCTGATAGCTCCCTGATGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1027515449 7:79136922-79136944 ATGCCTCCCATTGGTCCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515442 Original CRISPR GCATCAGGGAGCTATCAGGC CGG (reversed) Intronic
900664777 1:3807858-3807880 GCATCAGGGAGCTTTTACTCAGG + Intergenic
901148937 1:7087486-7087508 GGAGCAGGGAGCTGTCAGCCTGG + Intronic
903321589 1:22546694-22546716 GCATCAGGCAGTTTGCAGGCAGG - Intergenic
903836136 1:26204342-26204364 GCATCAGTGAGCTTACAGTCAGG + Intergenic
906658042 1:47562946-47562968 CCCTCAGGGAGCTCCCAGGCTGG - Intergenic
908386855 1:63651203-63651225 GCCTCAGGCAGGTCTCAGGCTGG + Intronic
912718570 1:112000794-112000816 GCCCCATGGAGCTATCAGGAAGG - Intergenic
913133355 1:115863333-115863355 ACGTCAGGGAGCAGTCAGGCTGG + Intergenic
913954705 1:143278233-143278255 GCCTCAAGGAGCTTGCAGGCAGG + Intergenic
917141180 1:171837657-171837679 ACATCAGAGAGCTCTCATGCTGG - Intergenic
919811295 1:201410455-201410477 ACATCAGGGACTTACCAGGCTGG + Intronic
1066009497 10:31181410-31181432 GCCTCAGGGAGCTCTGAAGCTGG + Intergenic
1070256615 10:74818558-74818580 GTATCAGAGAGGTATCAAGCTGG + Intergenic
1070935927 10:80295209-80295231 CCTTCAGGGAGCTACCAGACAGG - Intergenic
1073141622 10:101252292-101252314 GCAGCAAGGAGACATCAGGCTGG - Intergenic
1073323999 10:102632096-102632118 GCAGCAGGGAGCCCTCAGGCAGG - Exonic
1074524411 10:114251691-114251713 TCCTCAGGGAGCTTCCAGGCAGG + Intronic
1074704389 10:116118326-116118348 GCATCAGAGAGCTCCCAGGTGGG - Intronic
1074833885 10:117270514-117270536 CCATGAGGAAGCTATCAGGAAGG - Intronic
1074991470 10:118712371-118712393 GGCTCAGGGAGCTCCCAGGCTGG + Intronic
1075847140 10:125554156-125554178 GCATGAGGGAGCCATATGGCTGG + Intergenic
1076994480 11:291440-291462 GCTCCAGGGACCTATCAGGACGG + Intronic
1080872798 11:36251794-36251816 GCAACAGAGAGATATCAGGGAGG - Intergenic
1082664570 11:55959331-55959353 TCATTAGTGAGCTATCAGACAGG + Intergenic
1084468185 11:69339491-69339513 GCTTCTGGGAGCTATGAGGCAGG - Intronic
1084937494 11:72594916-72594938 CCTTCAGGGAGCTCTCAGTCTGG - Intronic
1090833355 11:130435836-130435858 GCATGAGGGAGCAATCTGGCTGG + Intergenic
1094242966 12:28250064-28250086 GAATCAGAGGGCTATCAGCCTGG + Intronic
1095884366 12:47173546-47173568 GAATTAAGGAGCTAACAGGCCGG - Intronic
1096135148 12:49193982-49194004 GTATCAGGAAGTCATCAGGCTGG - Intronic
1100774819 12:97962552-97962574 GGATCAGGGTGCAATCAGGAAGG - Intergenic
1104852411 12:131883558-131883580 GCATGAGGGAGCCACCAGGCAGG + Intergenic
1105600778 13:21885153-21885175 GCTTCAGGGAGCTGACAGCCTGG + Intergenic
1109363986 13:61331532-61331554 GCATCAGTGAGCAGGCAGGCAGG - Intergenic
1110046497 13:70839833-70839855 ATATCAGGGAGCTATAAGTCTGG + Intergenic
1112751869 13:102591670-102591692 GGATCAGAGAGCTAACAGGGTGG - Intergenic
1114325960 14:21589066-21589088 GCATCAGTGACCTTTAAGGCAGG + Intergenic
1119520465 14:75280885-75280907 TCATCAGGGATCTTGCAGGCAGG - Exonic
1120754995 14:88234583-88234605 GCTTCAGAGAGCAATAAGGCAGG + Intronic
1122968645 14:105143596-105143618 GGATCAGGCTGCTGTCAGGCAGG + Exonic
1124841680 15:33247949-33247971 GCATCCAGGAGCTATAAGGTAGG + Intergenic
1126814911 15:52445323-52445345 GCCTCAGGGAGCTTTCACGGTGG - Intronic
1127716422 15:61653339-61653361 GCAACTGGGAGCCATCTGGCAGG + Intergenic
1129236393 15:74226119-74226141 CCTTCAGGGAGCTGCCAGGCTGG + Intergenic
1129567329 15:76636548-76636570 CCTTCAGGGAGCCATCAGACAGG + Intronic
1129798928 15:78398762-78398784 GCACCAGGAAGCCATCAGGGAGG - Intergenic
1130060103 15:80563565-80563587 GCAACAGGGAGCAACAAGGCGGG - Intronic
1130654544 15:85783018-85783040 GCACCAGGGAACTCTCAGGTGGG - Intronic
1130977352 15:88787674-88787696 GCATCAGGGAACTTTCTGGTGGG + Intergenic
1130996605 15:88907748-88907770 GCATCTGGCAGCAATCAGTCTGG + Intronic
1133111485 16:3550526-3550548 GCCTCTGGGAGCTGCCAGGCAGG + Intronic
1134065495 16:11225641-11225663 GCAACGGGGAGGTCTCAGGCTGG - Intergenic
1137093577 16:36224544-36224566 GCCTCAAGAAGCTTTCAGGCAGG - Intergenic
1137687585 16:50397331-50397353 GATTCAGGGAGCATTCAGGCAGG + Intergenic
1137956234 16:52832968-52832990 TCATCAGTGACCTAGCAGGCTGG + Intergenic
1142226716 16:88881214-88881236 ACACCTGGGAGCTGTCAGGCAGG - Intronic
1143876504 17:9995103-9995125 GCCCTAGGGAGCTAACAGGCTGG + Intronic
1144074081 17:11701319-11701341 GCAGCTGGTAGATATCAGGCTGG + Intronic
1144293444 17:13849825-13849847 TCATCATGGAGCTATTAGGAAGG - Intergenic
1145108570 17:20141267-20141289 GCAACAGAGAGTTATTAGGCAGG - Intronic
1149328368 17:55556059-55556081 GCACCAGGAAGCTCTCAGCCAGG - Intergenic
1151664166 17:75535941-75535963 CCCACAGGGAGCTCTCAGGCTGG + Intronic
1152556920 17:81057987-81058009 GCATCAGGCGACTACCAGGCGGG - Intronic
1155597501 18:27504195-27504217 GAATCAGTGAGCTAGAAGGCAGG + Intergenic
1160446798 18:78934349-78934371 GCCTCAGGGTGCTATCTGTCTGG + Intergenic
1161067454 19:2245715-2245737 GTGTCTGGGAGCTGTCAGGCTGG + Intronic
1161895971 19:7080557-7080579 CCATCAGGGAGCCAGCAGACAGG + Intronic
1162485528 19:10958211-10958233 GGATCAGAGAGCTAGCAGGTGGG + Intergenic
1165240397 19:34462201-34462223 GTAGCAGGGAGCTATTAGGGAGG + Intronic
1165330368 19:35138618-35138640 GCAGCAGGCAGCCAGCAGGCAGG - Intronic
1165937430 19:39397840-39397862 CCAACAGGGAGCTCGCAGGCCGG + Exonic
1167751464 19:51382843-51382865 TCTTCAAGGAGCAATCAGGCTGG - Intronic
1168185291 19:54696526-54696548 GCTTTAGGGAGCTCCCAGGCAGG + Intronic
925925360 2:8666276-8666298 GCCTCAGGGAGCTATGAGCCTGG - Intergenic
928162610 2:28941888-28941910 GAAACAGGGAGCTCTCAGCCAGG - Intronic
929085644 2:38164873-38164895 GTCTCAGGGAGCTCTGAGGCAGG - Intergenic
932603180 2:73144310-73144332 GCAGAAGGGAGCACTCAGGCAGG + Intronic
933178883 2:79207768-79207790 TCATCAGGGAGCCATCAGAGTGG - Intronic
935625203 2:105166693-105166715 GCATCTGGGAGCTTCCAGTCTGG - Intergenic
936046871 2:109195259-109195281 GGAACAGGGAGCTAACAGGAGGG + Intronic
936102200 2:109592074-109592096 GCATCAGGGAGGCAGCTGGCAGG + Intronic
936373914 2:111924929-111924951 GTATCATGGAGCTTTCAGTCCGG + Intronic
942537091 2:176976501-176976523 GCAGCAGTGAGGCATCAGGCTGG - Intergenic
942918644 2:181344080-181344102 GCATCTGGGTGCTATAGGGCAGG - Intergenic
944279655 2:197881068-197881090 CCCTCAGGGAGCTCACAGGCTGG - Intronic
946683108 2:222238777-222238799 GCTTCATGGAGCTCTCAGGAAGG - Intronic
1168874892 20:1164622-1164644 GCTCCAGGGAGAAATCAGGCAGG - Intronic
1170155541 20:13265872-13265894 GTATTATGGAGCTATCACGCTGG - Intronic
1171498765 20:25577176-25577198 GAAGCAGGGAGCTAACTGGCCGG + Intronic
1173993645 20:47321524-47321546 ACTTCAGTGAGCTACCAGGCAGG + Intronic
1175916130 20:62426919-62426941 GCCTCAGGGAGCCAGCCGGCAGG - Intronic
1176002028 20:62836500-62836522 GCATCAGGGAGCTGTGTGGGGGG + Exonic
1178822957 21:35991944-35991966 GCATCAGGGAAACATCAGTCTGG - Intronic
1179382274 21:40910813-40910835 TCATCAAGAAGGTATCAGGCAGG - Intergenic
1179630634 21:42676109-42676131 GCCTCAGGGAGCTTTCACTCAGG - Intronic
1180904230 22:19397252-19397274 TTATCAGGGAGCTACCAGGGAGG - Intronic
1184066833 22:42126063-42126085 GCGTCAGGGAGCTATATGCCAGG - Intergenic
1184645926 22:45895541-45895563 GCAGGAAGGAGCTATCAGGAAGG - Intergenic
952834229 3:37590401-37590423 GCATGAGGGAGCCAACAGGAAGG + Intronic
954675495 3:52313285-52313307 GCATCAGGGAGCTGGCAGGCAGG - Intergenic
959438643 3:106349381-106349403 AGATAAGGGAGCTATCAGCCTGG - Intergenic
959595866 3:108127755-108127777 CCTGCAGGGAGCTAACAGGCTGG - Intergenic
962958065 3:140284883-140284905 AGTTCAGGGAGCTATCAGGAAGG - Intronic
964052326 3:152410588-152410610 GCCTAAGGGATCTATTAGGCTGG + Intronic
969184296 4:5464030-5464052 GCATCAGGGAGCTTCCAGTCAGG + Intronic
969462025 4:7334023-7334045 GCCTCAGGAAGCTGTGAGGCTGG - Intronic
970367153 4:15371501-15371523 GCTTCAGGGAGCTTACAGACTGG + Intronic
972072469 4:35038569-35038591 GCTCCAGGGAGCAAACAGGCAGG + Intergenic
976439139 4:85054106-85054128 GCATCAGGGAATTATGAGGCAGG - Intergenic
981364642 4:143888150-143888172 GCAGCAGAGAGCTAGGAGGCTGG - Intronic
981385757 4:144128624-144128646 GCAGCAGAGAGCTAGGAGGCTGG - Intronic
982391478 4:154869012-154869034 GCATCAGGGAGCTGCCTAGCAGG - Intergenic
985880487 5:2635558-2635580 GCAGCGGGGAGCGATCTGGCAGG - Intergenic
986107320 5:4672286-4672308 TCTTCAGGGAGCTTTCTGGCTGG + Intergenic
986789260 5:11144340-11144362 GCATCAAGGAGGCATCAGGGAGG + Intronic
992878548 5:81082166-81082188 ACATCAGGGGGCTGTCAGGTAGG - Intronic
995048507 5:107674578-107674600 GTAACAGGGAGCTAGCAAGCTGG + Intergenic
995606258 5:113859106-113859128 GAATCAGTGAGCTATAAGACAGG - Intergenic
996626204 5:125573062-125573084 GAATCAGGCAGCAATCTGGCTGG + Intergenic
997378904 5:133421211-133421233 GCACCATGGTGCTATCAGCCTGG - Intronic
997605547 5:135173421-135173443 GCATCAAGGTGGTACCAGGCAGG + Intronic
997670101 5:135663877-135663899 GCCTCAGGCACCTGTCAGGCTGG + Intergenic
998502373 5:142644731-142644753 TCCTCAGGGAGCTAACAGTCTGG - Intronic
1000330057 5:160199063-160199085 GCTCCAGGGAGCTCACAGGCAGG + Exonic
1006516547 6:34548789-34548811 GCAGGAGGGAGCTATTAGGGAGG - Intronic
1007481567 6:42153755-42153777 GCCTGAAGGAGCTATCAGGAGGG - Intergenic
1008328409 6:50215588-50215610 GCATCAGGCAGTTAACAGGCCGG - Intergenic
1014497210 6:122140271-122140293 GCACCAGGGAGCAATGAGACAGG - Intergenic
1015134540 6:129852754-129852776 GCACCAGGGAGCTAAAAGGAAGG - Intronic
1017773080 6:157658229-157658251 TCATCAGGGAACTAACTGGCAGG - Intronic
1022523925 7:31025309-31025331 GCAGCTGGGAGGAATCAGGCTGG - Intergenic
1024095743 7:45981102-45981124 GCATGAGGAAGCCATCAGGGTGG - Intergenic
1027515442 7:79136903-79136925 GCATCAGGGAGCTATCAGGCCGG - Intronic
1027723363 7:81771554-81771576 ACCTCAGGGACTTATCAGGCAGG - Intergenic
1028221440 7:88201605-88201627 GCAACAGGGATGCATCAGGCAGG - Intronic
1030550748 7:110956390-110956412 GCTCCAGGGAGGAATCAGGCAGG - Intronic
1038537133 8:28361189-28361211 GAATCAGGAAGCTTTCAGGAGGG + Intronic
1040472214 8:47743563-47743585 CCATCAGGGAGCTGTCAGCCCGG - Intergenic
1043779630 8:84314662-84314684 GCTACAGTGAGCTATGAGGCTGG + Intronic
1044269909 8:90230012-90230034 GCAAGAGGGAGCCATGAGGCAGG - Intergenic
1044382333 8:91549180-91549202 ACATCTGTGAGCAATCAGGCAGG - Intergenic
1045636546 8:104198290-104198312 GCATCAGGCAGCTAGCTAGCTGG - Intronic
1052664936 9:31483924-31483946 GCACCAGGAAGCAATCAGGTAGG + Intergenic
1059876805 9:118644335-118644357 GCATTATGGATCTGTCAGGCTGG - Intergenic
1060323398 9:122587936-122587958 GCATGAGGGAGCTTTCGGGATGG + Intergenic
1061812969 9:133173478-133173500 GCATCAGGAAGCTATGGTGCTGG + Intergenic
1062071392 9:134556880-134556902 GCAGCAGGAAGCGAGCAGGCTGG + Intergenic
1186432402 X:9516170-9516192 GCAACACGGAGATAACAGGCAGG - Intronic
1189212601 X:39296606-39296628 GCCTCAGGGCACTAACAGGCTGG - Intergenic
1191729745 X:64320450-64320472 ACCTTAGGGAGCTACCAGGCAGG - Intronic
1194386610 X:93263274-93263296 GAATCAGGGTGCTATCATCCAGG - Intergenic
1195079618 X:101358549-101358571 GCATCAAGGAGCTATTAGGAGGG + Intronic
1195672926 X:107484305-107484327 GCAGCAGGGAGGTAACAGGGAGG + Intergenic
1199612516 X:149630762-149630784 GCTTCAGGGAGCTCACAGCCTGG + Intronic
1200245731 X:154523839-154523861 GCCTCAGGGAGCTTTCTGGCAGG - Intergenic
1202273135 Y:23089425-23089447 AAAGCAGGGGGCTATCAGGCGGG - Intergenic
1202292891 Y:23331257-23331279 AAAGCAGGGGGCTATCAGGCGGG + Intergenic
1202426132 Y:24723169-24723191 AAAGCAGGGGGCTATCAGGCGGG - Intergenic
1202444657 Y:24946917-24946939 AAAGCAGGGGGCTATCAGGCGGG + Intergenic