ID: 1027515443

View in Genome Browser
Species Human (GRCh38)
Location 7:79136907-79136929
Sequence GGAGGCATCAGGGAGCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515443_1027515448 -9 Left 1027515443 7:79136907-79136929 CCTGATAGCTCCCTGATGCCTCC 0: 1
1: 0
2: 3
3: 39
4: 240
Right 1027515448 7:79136921-79136943 GATGCCTCCCATTGGTCCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 100
1027515443_1027515447 -10 Left 1027515443 7:79136907-79136929 CCTGATAGCTCCCTGATGCCTCC 0: 1
1: 0
2: 3
3: 39
4: 240
Right 1027515447 7:79136920-79136942 TGATGCCTCCCATTGGTCCCAGG No data
1027515443_1027515453 4 Left 1027515443 7:79136907-79136929 CCTGATAGCTCCCTGATGCCTCC 0: 1
1: 0
2: 3
3: 39
4: 240
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515443_1027515449 -8 Left 1027515443 7:79136907-79136929 CCTGATAGCTCCCTGATGCCTCC 0: 1
1: 0
2: 3
3: 39
4: 240
Right 1027515449 7:79136922-79136944 ATGCCTCCCATTGGTCCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515443 Original CRISPR GGAGGCATCAGGGAGCTATC AGG (reversed) Intronic
900344139 1:2203144-2203166 CGAGGCCCCAGGAAGCTATCTGG + Intronic
900758351 1:4453775-4453797 GAAGGGATAAGGGAGCTCTCTGG - Intergenic
901159192 1:7162157-7162179 GGAGAAAGCAGGGAGCTGTCAGG + Intronic
901941221 1:12663426-12663448 GGAGGCATTAGAGAGCTCTCTGG - Intronic
904136840 1:28319341-28319363 GGAGACATAAGGGACCTTTCTGG - Intergenic
904196877 1:28792359-28792381 GGAGGCATGAGGGAATTTTCTGG - Intergenic
904196932 1:28792716-28792738 GGAGGCTGCAGTGAGCTATGAGG + Intergenic
904957773 1:34300235-34300257 GGGGTCATCAGAGATCTATCAGG - Intergenic
906584228 1:46962180-46962202 GGAGGCTGCAGTGAGCTATCAGG - Intergenic
906820208 1:48921235-48921257 TGAGGAAGCAGGGAGCTATGTGG + Intronic
906882773 1:49610625-49610647 GGAGGCTTGACGGAGCTATTTGG + Intronic
907190643 1:52645062-52645084 GGAGGCATCGGGGAGGTAGAAGG + Intronic
909922998 1:81404487-81404509 GGAGGCATAAGGATGCTATTGGG + Intronic
911997151 1:104780680-104780702 GGGGGCAGCAAAGAGCTATCTGG + Intergenic
912516754 1:110221116-110221138 GCAGTCATCAGGGAGCTAACTGG + Intronic
916288840 1:163141124-163141146 GGAGGCATTGGGAAGCCATCTGG + Intronic
917141449 1:171840088-171840110 GGAGGCATGAGGAAACTTTCTGG - Intergenic
920043712 1:203120373-203120395 GGAGGAATAAGGGAGCGATTAGG + Intronic
920366752 1:205452010-205452032 GGAGGCAGCAGGGAGAGATGAGG + Intronic
920397341 1:205657071-205657093 GGAGGCATCGGGGAGATGGCAGG + Intergenic
921125332 1:212172721-212172743 AGAGGCTTCAGAGAGCTACCTGG - Intergenic
922091430 1:222399132-222399154 GGTGGGATCAAGGAGCTATGTGG - Intergenic
922777594 1:228223402-228223424 GGAGGCAGCTGGGAGCTGTGTGG + Intronic
922885716 1:229019025-229019047 GAAGGGATGAGGGAGCTCTCTGG + Intergenic
924499462 1:244623570-244623592 AGAGGCATCAGACAGCCATCTGG - Intronic
1062945425 10:1457674-1457696 GAGGCCATCAGGGAGCTATGTGG - Intronic
1065432572 10:25674313-25674335 TGAGGCTACAGTGAGCTATCAGG - Intergenic
1065832501 10:29627666-29627688 AGAGGCATCAGAGAGCTTTCAGG - Intronic
1065845494 10:29739465-29739487 GGAGGCCTCTGGGAGGCATCAGG - Intergenic
1067144828 10:43687528-43687550 GAAGGCATCAGGGAGCAAGCGGG + Intergenic
1067208890 10:44242270-44242292 GGAGGCCTGTGGGAGTTATCAGG + Intergenic
1069127302 10:64652312-64652334 GGAGGAAGCAGGCAGCTTTCAGG + Intergenic
1069482487 10:68796342-68796364 GGAGGCTGCAGTGAGCTGTCAGG + Intergenic
1069785874 10:70987636-70987658 GGAGGTATCATGGAAGTATCTGG + Intergenic
1070687743 10:78502257-78502279 GGAGACATCAGAGAGAAATCTGG - Intergenic
1075647200 10:124104427-124104449 GCGGGCAGCAGGGAGCTGTCTGG + Intergenic
1075681876 10:124339153-124339175 GGGAGCGTCAGGGAGCTCTCTGG - Intergenic
1076747438 10:132521503-132521525 TGGGGCACCAGGGAGCTCTCCGG - Intergenic
1077861338 11:6183569-6183591 GAAGGGATAAGGGAGCTCTCTGG + Intergenic
1077903840 11:6513343-6513365 AGAGGCACCAGGGAGCTTGCTGG - Intronic
1078727329 11:13943253-13943275 AGAGGCAACAGGGAGAAATCTGG + Intergenic
1080487132 11:32720829-32720851 AGAGGCATGAGGGAGCTTTCTGG + Intronic
1080940412 11:36911506-36911528 GGAGGCATCAGGGAGCTTCTGGG + Intergenic
1083742312 11:64717409-64717431 GGAGGCACTAGGGAGCTGACTGG - Intronic
1084010592 11:66346424-66346446 GGTGGGATCAGGGAGTTATGAGG - Intronic
1085049451 11:73372624-73372646 GCAGGCATCAGGGATAAATCGGG + Intergenic
1089235618 11:117022206-117022228 AGAGGCACAAGGGAACTATCTGG + Intronic
1090442442 11:126735599-126735621 GGAGGTAACAGGCAGCTGTCAGG + Intronic
1091203122 11:133797789-133797811 GGAGGGAGGAGGGAGCTGTCAGG + Intergenic
1091727933 12:2858508-2858530 TCAGGCAGCAGGGAGCTATGAGG + Exonic
1091748909 12:3010614-3010636 GGAGGCTCCAGGGAGCTGCCCGG - Intronic
1095089084 12:38087434-38087456 GGAGGCAGTCAGGAGCTATCTGG - Intergenic
1095343144 12:41116532-41116554 GAAGGAACCAGGGAGCTCTCAGG - Intergenic
1095636022 12:44434710-44434732 GGAGGCATGAGGGAGCAAGAAGG - Intergenic
1096000139 12:48122520-48122542 GGAGGGATCAGGGAGGAATTAGG + Intronic
1096462820 12:51831904-51831926 GGAGGCTGCAGTGAGCTATGGGG - Intergenic
1097292428 12:57929323-57929345 AGAGGCTTCAGGGAGCTGCCTGG + Intergenic
1099011654 12:77298280-77298302 GCAGGCATGAGGGAGCTTTTTGG + Intergenic
1099155802 12:79174427-79174449 GAAGGCATCAGGGAGAAATCGGG + Intronic
1101248224 12:102905306-102905328 GGGTGAATCAGGGAGCTATTTGG - Intronic
1101550101 12:105753489-105753511 GCAGGCACCAGGGAGCTTTGTGG + Intergenic
1102017282 12:109656279-109656301 GGAGGCATGAATGAGATATCAGG + Intergenic
1102256921 12:111421007-111421029 GGAGGCATGAAGGAGCCCTCTGG - Intronic
1102306504 12:111808768-111808790 GGAGGGATGAGGGAGCTGTCAGG + Intronic
1104120016 12:125790014-125790036 GAAGGGATGAGGGAGCTCTCTGG - Intergenic
1105470472 13:20689320-20689342 GGGTGCCTGAGGGAGCTATCAGG + Intronic
1106113512 13:26797604-26797626 GCAGCCATCAGGGAGCTAGCAGG + Intergenic
1106403956 13:29457278-29457300 AGAGGCATGAGGGAACTTTCTGG - Intronic
1106558260 13:30828458-30828480 GGAAGCACCAGGAAGCTCTCAGG - Intergenic
1107633332 13:42364981-42365003 GAAGGCATCTAGGAGCTAACTGG + Intergenic
1110261252 13:73487494-73487516 TGAGGCCTCAGGGAGCTTCCAGG - Intergenic
1113396274 13:109950517-109950539 GGAGTGATCAGCCAGCTATCTGG + Intergenic
1114077634 14:19169819-19169841 GGAGTCACCAGGGAGCCATCAGG + Intergenic
1116111282 14:40587436-40587458 AGAGGCATAAAGGAACTATCTGG + Intergenic
1116422701 14:44751661-44751683 GGAGGATTGAGGGAGCTCTCTGG + Intergenic
1117870727 14:60197938-60197960 GGAGGCATCAGGACTCTTTCTGG - Intergenic
1118731641 14:68670975-68670997 GCTGGCATCAGGGTGCAATCTGG - Intronic
1120158868 14:81124477-81124499 TGAGGCATGAGGGAACTTTCTGG - Intronic
1120674243 14:87402087-87402109 GGAGGCATCATGGAGCGGACTGG + Intergenic
1121152810 14:91652717-91652739 AGAGGCAAGAGGGAGCTTTCTGG + Intronic
1121862252 14:97329464-97329486 GGAGGGATCAGGGGTCTCTCTGG + Intergenic
1123223654 14:106879671-106879693 GGTGGCAACAGTGAGTTATCAGG - Intergenic
1124500315 15:30222903-30222925 GGAGGCTTCAGGCAGATGTCTGG + Intergenic
1124743260 15:32315763-32315785 GGAGGCTTCAGGCAGATGTCTGG - Intergenic
1125248594 15:37672674-37672696 GGAGGATTCAGGGAGCTTTCAGG - Intergenic
1125688469 15:41578049-41578071 GGAGGCAGCCTGGAGCTACCTGG + Exonic
1127622265 15:60745380-60745402 TGAGGCAGCAGGTAGCTACCCGG - Intronic
1127932470 15:63605948-63605970 GGAGGCAGCAGGCTGCTAGCAGG + Intergenic
1128126440 15:65196806-65196828 GGAGGCAGCAGCGAGCGAGCAGG - Exonic
1128152206 15:65370120-65370142 GGAGTCACCAGGGACCTTTCCGG + Intronic
1128789165 15:70420271-70420293 GGAGGCATTAGGGAGCCTTCTGG - Intergenic
1129518843 15:76172998-76173020 TCAGGCATCACGGAGCTACCGGG + Intronic
1130385715 15:83409939-83409961 GGAGGCATGAGGGAACTTTATGG - Intergenic
1130654546 15:85783022-85783044 GCAGGCACCAGGGAACTCTCAGG - Intronic
1130710533 15:86276625-86276647 GGAGTGATAAGGGGGCTATCAGG + Intronic
1130886500 15:88096854-88096876 GGATGCATTAGGGAGCAAGCGGG - Intronic
1131896435 15:97035866-97035888 GAAGGCATGAGGAAGCTATCTGG - Intergenic
1133318356 16:4897867-4897889 GGAGGCATCTGGCATCTGTCTGG + Intronic
1133655911 16:7863529-7863551 ATAGGCATCAGGGAACTATTTGG + Intergenic
1134822347 16:17257012-17257034 GGAGGCAACAGAGAGCTCTGGGG - Intronic
1136145356 16:28313227-28313249 GGAGGCTTCAGTGAGCCATGGGG + Intronic
1136692071 16:32039562-32039584 GGAGACACCAGGGAGCCCTCAGG + Intergenic
1136792614 16:32983000-32983022 GGAGACACCAGGGAGCCCTCAGG + Intergenic
1136877242 16:33871054-33871076 GGAGACACCAGGGAGCCCTCAGG - Intergenic
1138846044 16:60567751-60567773 GGAGGGAACAGGGAGGTATATGG - Intergenic
1140853905 16:78960649-78960671 GGAGGGAACAGAGAGCCATCAGG + Intronic
1203094829 16_KI270728v1_random:1244479-1244501 GGAGACACCAGGGAGCCCTCAGG + Intergenic
1142703180 17:1676889-1676911 GGAATCATTAGGGGGCTATCTGG - Intronic
1144050556 17:11494208-11494230 GCAGGGATGAGGGGGCTATCAGG - Intronic
1144174862 17:12695300-12695322 GGAGGCTTCAGAGAGCTGTCTGG - Intronic
1144279530 17:13711135-13711157 AGAGGCATGAGGGACCTCTCTGG - Intergenic
1144629992 17:16866397-16866419 GGAGGCACCAGGGAGCTTTCTGG + Intergenic
1144651386 17:17009410-17009432 GGAGGCACCAGGGAGCTTTCTGG - Intergenic
1146054381 17:29573890-29573912 GGAGGGATCAGGGAGGCAGCTGG + Exonic
1146309578 17:31756911-31756933 GAAGGAGTCAGGGAGCTCTCTGG - Intergenic
1146818591 17:35965425-35965447 AGAGGCTTCAAGGAGATATCTGG + Intergenic
1148339857 17:46866950-46866972 GGAGGCAAGAGGAAGCTCTCAGG - Intronic
1148910831 17:50941788-50941810 GGAGGCATCAGGAAGGTGTGAGG - Intergenic
1149568812 17:57657777-57657799 GGAGGGATCCTGGAGCTATTTGG + Intronic
1149778205 17:59375000-59375022 GGAGGAATCAGGAAGCTCTAAGG + Intronic
1150197370 17:63314411-63314433 AGAGGCTTCAAGGAGATATCTGG - Exonic
1151009542 17:70477868-70477890 AGAGGCATAAGGGAGCTATTTGG + Intergenic
1151350798 17:73530926-73530948 GGAGGCTTGAGGGATCTCTCTGG + Intronic
1151530035 17:74698295-74698317 TGTGGCATCTGGGAGCTATCTGG - Intronic
1155079771 18:22397423-22397445 GAAGACATGAGGGAGCTCTCTGG + Intergenic
1157382313 18:47230030-47230052 TCAAGCATCAGGAAGCTATCAGG + Intronic
1158656850 18:59344939-59344961 GGAGGCATGAGGGAACTTTCTGG + Intronic
1158962584 18:62598602-62598624 GGAGGCACGAGGGAGCTTTCAGG - Intergenic
1159299169 18:66540616-66540638 AGAGGCTTGAGAGAGCTATCTGG + Intronic
1161239363 19:3213433-3213455 GGAGGAAGCAGGGAGGTTTCAGG + Intergenic
1162111497 19:8402296-8402318 GCAGGCATCAGAGAGGTGTCTGG + Intronic
1162835803 19:13317067-13317089 GGAGGGATCAGGGAGTTGGCAGG + Intronic
1165779857 19:38426023-38426045 GGAGGCCTCAGGGTGCTGCCGGG + Intronic
1167524218 19:49973498-49973520 GGAGGCATCTGGAAGCAGTCTGG - Intergenic
1167667821 19:50832919-50832941 GGAGGCCTCAGGAAGCTTTGAGG + Intronic
924999559 2:394092-394114 GGAGGCAACAGGGAGGAAACCGG - Intergenic
925372739 2:3359009-3359031 GGAGGCATCAAAGAGGTATGAGG + Intronic
925612893 2:5718082-5718104 GGACTTATCAGGGGGCTATCGGG - Intergenic
925996641 2:9298815-9298837 TGAGGCACCAGGAAGCTAACAGG - Intronic
927931743 2:27050008-27050030 GGAGGCTGCAGGGACCTACCCGG + Intronic
929933129 2:46274000-46274022 GGAGGTATCAAGGAGCTACCAGG - Intergenic
932945845 2:76229490-76229512 GGATTCAGCAGTGAGCTATCAGG - Intergenic
932946255 2:76235352-76235374 GGATTCAGCAGTGAGCTATCAGG + Intergenic
935272584 2:101448024-101448046 AGAGGCTTCAGAGAGCTAGCTGG - Intronic
937921069 2:127131285-127131307 GAAGGCAGAAGGGAGCTCTCTGG - Intergenic
940770521 2:157834873-157834895 GAAGGGATAAGGTAGCTATCTGG - Intronic
944919497 2:204396721-204396743 GAAGGAATGAGGGAGCTTTCTGG + Intergenic
946191929 2:218011943-218011965 GGGGGCATCAGGGAGGTAGGAGG + Intergenic
946217322 2:218194694-218194716 GGGGGCATCAGGGACATAGCTGG - Intergenic
946944584 2:224807489-224807511 GGAGGCTAAAGGGACCTATCTGG + Intronic
948740212 2:240041582-240041604 GGAGCCAGCAGGGAACTGTCTGG + Intergenic
1169864262 20:10183347-10183369 GAAGGCAACAGGGAGCATTCTGG + Intergenic
1169934337 20:10866630-10866652 GGAAGCATCAGGGAGAGTTCTGG + Intergenic
1172310496 20:33914305-33914327 AGAGACATGAGGGAGCTTTCTGG - Intergenic
1175883242 20:62272474-62272496 GGCGGCAGCAGGGAGCTCTTGGG - Intronic
1178674164 21:34616565-34616587 GGAGGCAGGAGGGAGCTTCCAGG - Intergenic
1178712824 21:34934561-34934583 GGAGGCACCAAGGAGCTAAGAGG + Intronic
1179382275 21:40910817-40910839 GGAGTCATCAAGAAGGTATCAGG - Intergenic
1180954351 22:19734996-19735018 GGAGGGTTCAGGGAGCTTTTGGG - Intergenic
1182965182 22:34514834-34514856 CGAGGCAATAGGGAGCTATCTGG - Intergenic
1183600380 22:38836612-38836634 GGGGGCACCAGGGAGCCTTCTGG + Intronic
1184645927 22:45895545-45895567 GGAGGCAGGAAGGAGCTATCAGG - Intergenic
1184827559 22:46963398-46963420 GGAGCCTTCAGAGAGCTCTCAGG + Intronic
1203220272 22_KI270731v1_random:37521-37543 GGAGGCACAAGGGAACTTTCTGG - Intergenic
950799894 3:15541924-15541946 GGGGGCATGAGGGAGCCTTCTGG + Intergenic
951366270 3:21787153-21787175 GGAGGCTTCAAGTAACTATCTGG + Intronic
951703334 3:25518897-25518919 GGAAGCATGGGGGAGCTTTCTGG + Intronic
952002856 3:28807244-28807266 GGAGGTTTGAGGGAGCTCTCAGG - Intergenic
952214218 3:31260208-31260230 GGAGACATGAGGGAACTTTCTGG + Intergenic
953414894 3:42709953-42709975 GGAGGCATCAGGGAGGGCTTCGG - Intronic
954466536 3:50658445-50658467 GGAGGCAACAGGGAGCCATTAGG + Intergenic
954483000 3:50819096-50819118 GATGGCTTCAGGGAGCTATACGG - Intronic
954675496 3:52313289-52313311 TGGGGCATCAGGGAGCTGGCAGG - Intergenic
954694655 3:52415519-52415541 GGAGGCAGGAGGGAACTTTCTGG - Intronic
956066564 3:65402810-65402832 GGAGGCATGAGGGCACTCTCTGG + Intronic
956766753 3:72490805-72490827 AGAGGCACCAGGGAGCCCTCTGG + Intergenic
961092939 3:124130965-124130987 GGGGGCATGAGGGAGCCTTCTGG + Intronic
963975124 3:151471987-151472009 GGAAGCACCAGGCAGCTATCTGG - Intergenic
965480315 3:169210736-169210758 GGAGGCATGAAGGAGCTCTCTGG - Intronic
965634286 3:170765885-170765907 ACAGGCAGCAGGGAGCTATTCGG - Intronic
967289100 3:187902044-187902066 GGAGTCTTCAGAGAGCTGTCAGG - Intergenic
967892420 3:194372669-194372691 GGAGGCAGTAGGGAGCCACCAGG + Intergenic
968271524 3:197407075-197407097 GGAGGCGTGAGGGAGCAATGGGG - Intergenic
968396836 4:246896-246918 GGAGGTTGCAGTGAGCTATCGGG + Intergenic
969304371 4:6317419-6317441 GGAGGCACCAGGGACCTCTGAGG - Intergenic
970407233 4:15775425-15775447 GGAGGCATCAAGGAGCCACTTGG - Intergenic
970675193 4:18440956-18440978 GGAGACAGCAGGTAGCTAGCTGG - Intergenic
971546777 4:27896475-27896497 GGAGGCATTTCGGAGCTCTCTGG + Intergenic
971660512 4:29408208-29408230 GAAGGCAACAGGGAGCCAGCAGG + Intergenic
972425316 4:38927415-38927437 AGAGGCCCCAGGGAGCTAGCTGG - Intronic
975975957 4:80097131-80097153 GGAGGAGTGAGGGAGCTCTCTGG + Intronic
976871525 4:89799822-89799844 GGAGGCATCAGTGATTTATATGG + Intronic
977059124 4:92234647-92234669 GGAGGCATTGTAGAGCTATCTGG - Intergenic
978392848 4:108245440-108245462 GGGGGCATAAGGAAGCTTTCTGG + Intergenic
983921177 4:173346783-173346805 GGAAGCAACAGGTATCTATCAGG + Intergenic
986107319 5:4672282-4672304 GAAGTCTTCAGGGAGCTTTCTGG + Intergenic
986502563 5:8415825-8415847 GAAGGCATCAGGGAACTTCCCGG + Intergenic
986575925 5:9213067-9213089 GGAGGAATGAGGGAGCTCTCCGG + Intronic
986789258 5:11144336-11144358 GGAGGCATCAAGGAGGCATCAGG + Intronic
989606420 5:43248435-43248457 GCAGGAGACAGGGAGCTATCAGG + Intronic
991169963 5:63613204-63613226 GAAAGCATCAGGGATCTTTCTGG - Intergenic
992033997 5:72753134-72753156 AGAGTCATTAGGGAGCCATCTGG - Intergenic
992109755 5:73481891-73481913 GGAGTGATCAGCCAGCTATCTGG - Intergenic
992280858 5:75175546-75175568 AGAGGCATGAGGGAACTTTCTGG + Intronic
992498215 5:77314416-77314438 GGGGGCTTCGGGGAGCTAGCTGG + Intronic
993879617 5:93347328-93347350 GGATGCATCAGGCAGCTGCCTGG + Intergenic
994647842 5:102491945-102491967 GGAGGCCTCAGGGAGGCCTCAGG + Intronic
995597068 5:113759098-113759120 GGAGGCATGAGGGAACTTTCTGG + Intergenic
995886310 5:116898222-116898244 GGAGGAATCAGGCAGCTAGTAGG - Intergenic
997381069 5:133438827-133438849 GGAGGAGTTAGGGAGGTATCTGG + Intronic
998163162 5:139824941-139824963 GGAGGCAGTAAGGGGCTATCGGG + Intronic
998250486 5:140548964-140548986 GGAGGCAGCAGGGGGGTGTCCGG - Exonic
1002922605 6:1583281-1583303 GGTGCCATCAGGCAGCCATCTGG + Intergenic
1002945773 6:1759741-1759763 AGAGGCTTCAGGTAGTTATCAGG + Intronic
1002945775 6:1759752-1759774 GTAGTTATCAGGGAACTATCAGG + Intronic
1004231812 6:13840784-13840806 GGAGGCAACAGTGAGATTTCTGG - Intergenic
1004632089 6:17431835-17431857 GAAAGCATGAGGGAGCTATTCGG + Intronic
1006210638 6:32391075-32391097 GGAGGGATCTAGGAGCTCTCTGG + Intergenic
1009027501 6:58017398-58017420 GGAGGCATCAGGAAACCCTCAGG + Intergenic
1009203034 6:60768874-60768896 GGAGGCATCAGGAAACCCTCAGG + Intergenic
1010203825 6:73306144-73306166 TGAGGATTCAGGGAGCTATATGG - Intronic
1014220530 6:118794642-118794664 GGAGGCTTCAGAGAGCTGCCTGG + Intergenic
1015684666 6:135846615-135846637 GATGGCAGCAGGGAGGTATCTGG + Intergenic
1016982694 6:149867516-149867538 GGAGGAGTTAGGGAGCTCTCTGG + Intergenic
1017776022 6:157681409-157681431 GGAGCCATCACGGTGCTTTCAGG - Intergenic
1017959204 6:159207133-159207155 GGAGGCAGGAAGGAGCTAGCTGG + Intronic
1019746323 7:2702175-2702197 AGAGGCAGCAGGGAGCTCCCAGG - Intronic
1021012216 7:15484422-15484444 GGAGCCATGACGGAGATATCAGG + Intronic
1022235236 7:28454524-28454546 GGTGGCACCAGGAAGCAATCTGG - Intronic
1022316074 7:29246812-29246834 GAAGGGATGAGGGAGCTCTCTGG + Intronic
1022318395 7:29265221-29265243 GGAGGCAACTTGGAGCTTTCTGG - Intronic
1022363810 7:29689137-29689159 GGGGGCATCAAGTGGCTATCTGG + Intergenic
1022580729 7:31550980-31551002 GGAGGAAACAAGAAGCTATCAGG - Intronic
1022622837 7:32002349-32002371 GGAGGCACCATGGAGCTGGCGGG + Intronic
1023771266 7:43558720-43558742 GGAGGCCTGAGGGTGCCATCAGG + Intronic
1024095745 7:45981106-45981128 AGAGGCATGAGGAAGCCATCAGG - Intergenic
1026739174 7:72967940-72967962 GGAGGCAGGAGGGAGCTTTCTGG - Intronic
1026790200 7:73326562-73326584 GGAGGCAGGAGGGAGCTTTCTGG - Intronic
1027104557 7:75397133-75397155 GGAGGCAGGAGGGAGCTTTCTGG + Intronic
1027491682 7:78834933-78834955 GGAGGCCTCAGGGAGCTTTCAGG - Intronic
1027515443 7:79136907-79136929 GGAGGCATCAGGGAGCTATCAGG - Intronic
1027663503 7:81016306-81016328 AGTGGCATCAGAGAGCTACCTGG - Intergenic
1027862275 7:83600280-83600302 GGAAGCATCTGGGAATTATCAGG + Intronic
1028308613 7:89300004-89300026 AGAGGCAACATGGAGCTAGCTGG - Intronic
1028368951 7:90069148-90069170 GGAGGCTGCAGGGAGCTTCCAGG + Intergenic
1030647244 7:112075339-112075361 GCAGGCAACAGAGAGCTATTGGG + Intronic
1034686815 7:152979151-152979173 AGAGGCTTCAGGGAGCTGTCTGG - Intergenic
1034887545 7:154809492-154809514 GGAGGTATCTGGGTCCTATCAGG + Intronic
1036022546 8:4862137-4862159 GGAGGCATCAGGGAGTGAACGGG + Intronic
1036632665 8:10526145-10526167 TGAGCCATCAGGGAGCTCTGGGG - Intronic
1038153367 8:24962578-24962600 GGAGGCACAAGGGAACTTTCCGG + Intergenic
1038537131 8:28361185-28361207 GGGGGAATCAGGAAGCTTTCAGG + Intronic
1041751098 8:61261659-61261681 GAAGGGACCAGGGAGCTATTTGG - Intronic
1043310667 8:78855499-78855521 AGAGGCATTAGGAAGCTATCTGG + Intergenic
1044672819 8:94700480-94700502 GGAGGCTCCAGGGAGCAGTCAGG - Intronic
1044701947 8:94973347-94973369 GAAGGCATGAGGGAGCTCTCTGG - Intronic
1044747256 8:95382841-95382863 GGAGCAATCAGGAAGCTATGTGG - Intergenic
1045793903 8:106020364-106020386 GGAGGCCTCAGTGAGCTGTGTGG + Intergenic
1047194344 8:122707938-122707960 GAAGGGATGAGGGAGCTCTCAGG + Intergenic
1048180989 8:132194007-132194029 AGGGGTATCTGGGAGCTATCTGG - Intronic
1049379760 8:142306089-142306111 GGAGGAAACAGTGAGCTATCTGG - Intronic
1049541906 8:143212463-143212485 GGTGGCCTCAGGGAGCGACCTGG + Intergenic
1052189672 9:25644983-25645005 GGAGGCATTAGAGAACTTTCTGG + Intergenic
1053242580 9:36508141-36508163 GGAGGCAGAAGGGAGCCTTCTGG + Intergenic
1053446263 9:38155478-38155500 GAAGGCATAAAGGAGCTCTCTGG + Intergenic
1055393979 9:75853673-75853695 GCAGGCATCAGCGAGCTTTTCGG - Intergenic
1055854839 9:80673679-80673701 GGAGTCTTAAGGGAGCTTTCAGG + Intergenic
1057038972 9:91833708-91833730 TGAGGCCCCAGGGAGCTCTCGGG - Intronic
1057066201 9:92054422-92054444 AGAGGCATCAGGAAGCTTTCTGG + Intronic
1057797273 9:98167650-98167672 AAAGGCATCAGGAAGCAATCAGG + Intronic
1059140776 9:111851294-111851316 GGGGGCATGAGGGAGCTTTCTGG + Intergenic
1060573868 9:124670324-124670346 GGAGGCTGCAGTGGGCTATCAGG + Intronic
1185769718 X:2756689-2756711 GGGGGCGTCAGGGAACTCTCAGG - Intronic
1186208415 X:7224544-7224566 GAAGGAATGAGGGAGCTCTCTGG - Intronic
1186695207 X:12023124-12023146 GAAGGGATGAGGGAGCTTTCTGG - Intergenic
1187030721 X:15485410-15485432 GGAGGCCTCTGGGAGGTATTAGG - Intronic
1187441028 X:19319960-19319982 AGAGGCATGAGGGAGCCTTCAGG + Intergenic
1187531582 X:20102066-20102088 GGAGGCATGAAGGAGCCTTCTGG + Intronic
1192531573 X:71892188-71892210 GGAGTGATCAGGCAGCTACCTGG - Intergenic
1193365341 X:80624816-80624838 GAAGGCATCAGAGAGCAATCAGG - Intergenic
1198083311 X:133260287-133260309 GGAGGCAGTAAGGAGCTAACAGG - Intergenic
1198318702 X:135496837-135496859 GAAGGCATGAGGGAACTTTCTGG + Intergenic
1200340340 X:155389662-155389684 GGGGTGATCAGCGAGCTATCTGG - Intergenic