ID: 1027515445

View in Genome Browser
Species Human (GRCh38)
Location 7:79136917-79136939
Sequence GGGACCAATGGGAGGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515445_1027515453 -6 Left 1027515445 7:79136917-79136939 CCCTGATGCCTCCCATTGGTCCC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515445 Original CRISPR GGGACCAATGGGAGGCATCA GGG (reversed) Intronic
903238077 1:21963689-21963711 GGCAGCAGTGGGAGGCATCTGGG + Intergenic
903333464 1:22609340-22609362 GTGACCAATGGGTGGGACCAGGG + Intergenic
904282107 1:29427777-29427799 GGGAGCCATGGGAGGCTGCAGGG - Intergenic
906321901 1:44822474-44822496 GGGACCAAGGGGGCTCATCAGGG + Exonic
911043090 1:93607455-93607477 AGGACAGATGGGAGGCTTCAGGG + Intronic
916514443 1:165502578-165502600 GGGATCACTGGGAGGCACCTTGG - Intergenic
916521422 1:165566990-165567012 GAGACCAGAGGGAGGCATGACGG + Intergenic
919775443 1:201191337-201191359 GGGACCAACTGGAGGTAGCAGGG + Intronic
920498948 1:206474295-206474317 GGGAGCAGTGGGAGACAGCATGG - Intronic
921232141 1:213083731-213083753 GGGACCACTGGGGGCCATCTTGG - Intronic
922712125 1:227842109-227842131 GGGCCTAATGGGAGGCATTTGGG - Intronic
923050445 1:230387969-230387991 GAGAGCAATGGGTGCCATCAAGG + Intronic
1064408972 10:15088849-15088871 GCGACCAATGGGAGGCGGCCGGG - Intergenic
1065845493 10:29739464-29739486 GAGGCCTCTGGGAGGCATCAGGG - Intergenic
1067963229 10:50880181-50880203 TGGAACACTGGGAAGCATCAAGG - Intronic
1072465414 10:95657790-95657812 GGGCCTAATGGGAGGCATTTGGG + Intergenic
1075119962 10:119657576-119657598 GGAACCAATGGAAGGCTTCCCGG - Intronic
1075417730 10:122277767-122277789 GGGCCTAATGGGAGGCATTTTGG - Intronic
1075588671 10:123676008-123676030 AGGACAAATGGGAGGAAACAGGG - Intronic
1075664805 10:124222598-124222620 GGGCCCAAAGGGAAGCCTCATGG + Intergenic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1077102928 11:830155-830177 GGGGCCAATGGAGGGCCTCAGGG + Intronic
1078000949 11:7495207-7495229 GGGAGAAATGGGAGGCAGGAAGG - Intronic
1083324420 11:61866173-61866195 TGGACCAATGGCAGCCGTCAGGG - Exonic
1083949447 11:65945961-65945983 GGGACCACAGGGAGGCCTAAGGG + Intronic
1085718483 11:78893261-78893283 TGGCCCAATGGGAGGCATACAGG + Intronic
1087699330 11:101417869-101417891 GGGCCTAATGGGAGGCATTTGGG - Intergenic
1091666354 12:2421432-2421454 GGGACAAATGGGATTCACCATGG + Intronic
1091884846 12:4009085-4009107 GGCTCCAATGTGAGGCATTAAGG - Intergenic
1092024863 12:5232013-5232035 GGGAACAATGGGAGATATGATGG - Intergenic
1095365223 12:41395334-41395356 GGGAGAAATGGGAGACATAAAGG + Intronic
1096259497 12:50081912-50081934 GGGAGCTAGGGGAGGCAGCATGG - Exonic
1099017905 12:77367101-77367123 AGGTCAAATGGGAAGCATCAAGG - Intergenic
1102571208 12:113828122-113828144 GTGACCAATGGGATGGAGCAGGG + Intronic
1105768822 13:23587952-23587974 CGGACAAATAGGAGGCATCTAGG - Intronic
1107169984 13:37329637-37329659 GGGTACAATGGGAGGAAGCAGGG - Intergenic
1107567756 13:41623474-41623496 GGGATGAATGAGAGGCAGCAGGG + Intronic
1107806077 13:44155243-44155265 GGGAACCATGGGGGGCAACATGG + Intronic
1108433356 13:50377104-50377126 GAGGCCACTGGGAGGCAGCAGGG + Intronic
1110884691 13:80618318-80618340 GGGACTAATGGGAGGTATTTGGG + Intergenic
1111836552 13:93395588-93395610 GGGACCAAAGGGAGCTATTAAGG - Intronic
1115738254 14:36358685-36358707 GGGATCAATGGGTGGGGTCAGGG - Intergenic
1119203857 14:72779446-72779468 GGCACCATTGGGAGCCATCTTGG - Intronic
1121215435 14:92244148-92244170 GGGACTAATGGGAGGCGTTTGGG - Intergenic
1121319171 14:92981161-92981183 GGGAACATTGGCAGGCATCAGGG - Intronic
1121906791 14:97753366-97753388 GGGTCCATTGAGAGTCATCAAGG - Intronic
1122588368 14:102826891-102826913 GTGACCACGGGGAGGCACCAGGG - Intronic
1124440412 15:29681743-29681765 GGGACCAGTTGGAGCCAACATGG - Intergenic
1128707626 15:69849139-69849161 AGGACTAATGGGAGGAGTCATGG - Intergenic
1130703866 15:86213249-86213271 GGAACTACTGGGAGGCATCCTGG + Intronic
1133192856 16:4147178-4147200 GGGGCCAATCAGAGGCATCCTGG - Intergenic
1134870797 16:17650729-17650751 GGGACTAAGGGAAGGCATAATGG + Intergenic
1137496293 16:48971723-48971745 GAGACTAAAGGGAGGCATCAAGG + Intergenic
1137719077 16:50617170-50617192 GGGCCCAATGGGAGGCTCCTTGG - Intronic
1137724736 16:50649591-50649613 GGGACTGATGGGAGACAGCATGG - Intergenic
1143097823 17:4487918-4487940 GGGACCAACGGGAGGCTTGCAGG - Exonic
1144330110 17:14215195-14215217 GGGAACAAGGGGAGGAAACAGGG + Intergenic
1144643607 17:16953466-16953488 GGGACCCCAGGGAGGCTTCAGGG - Intronic
1145143192 17:20460899-20460921 GGGAACAAAGGGACCCATCAAGG + Intronic
1145276097 17:21431720-21431742 GGGCCTAATGGGAGGTATCTGGG + Intergenic
1145313941 17:21717634-21717656 GGGCCTAATGGGAGGCATCTGGG + Intergenic
1145792686 17:27637784-27637806 GGGACCAAAGGGACCCATCAAGG - Intronic
1147616473 17:41831530-41831552 GGGCCTAATGGGAGGTGTCATGG + Intronic
1148737990 17:49875627-49875649 GGGACCCATGTTAGGCATGAAGG + Intergenic
1149510413 17:57236771-57236793 ATGACCACTGGGAGGCATGAGGG - Intergenic
1151325018 17:73374425-73374447 GGGAGAAAAGGGAGGCAACAAGG - Intronic
1151685830 17:75646160-75646182 GGCACCAATGGGAAGCCTCAGGG + Intronic
1151717518 17:75838747-75838769 GGGCCCAATGGCAGCCATGATGG + Intronic
1152252381 17:79218767-79218789 GGGACTAGTGGGACACATCAGGG + Intronic
1153082860 18:1248508-1248530 GGGCCCAATGGGAGGTATTTGGG - Intergenic
1159909681 18:74133906-74133928 GGGCCTAATGGGAGTCATCTGGG - Intronic
1164809231 19:31142990-31143012 GGATCCAATGGGAGCCATCATGG + Intergenic
1166668935 19:44698305-44698327 GGGAGTAGGGGGAGGCATCAGGG + Intergenic
1167573382 19:50304975-50304997 GGGACCCAGGAGAGGGATCAGGG + Intronic
926370932 2:12177986-12178008 GGCCCAAATGGGAGGCAGCAGGG + Intergenic
929118171 2:38462324-38462346 GGGCCCGTTAGGAGGCATCATGG + Intergenic
929592144 2:43154274-43154296 GGGGCCAATGGGAGGCCAAAAGG + Intergenic
930304800 2:49665109-49665131 GGGACCCATGGGAGGCAGACTGG + Intergenic
933846336 2:86329950-86329972 GGGACCTAGGAGAGGCTTCATGG + Intronic
934019919 2:87937658-87937680 GGGACTAATGGGAGGAATTTGGG - Intergenic
935637108 2:105257783-105257805 GGACCCAATGGGAGGGATTAGGG - Intergenic
937037240 2:118792386-118792408 GGGAACTAGGGGAGGTATCAAGG + Intergenic
937569065 2:123334178-123334200 GGGACCCATGGGAGGCACACTGG - Intergenic
938373841 2:130791305-130791327 GGAACCAGTGTGAGGCACCAGGG - Intergenic
939501763 2:142995649-142995671 GGGACCAGTTGCTGGCATCAAGG + Intronic
940539562 2:154994543-154994565 GGGACCAATAGGAGCCAGAAAGG - Intergenic
942007037 2:171713854-171713876 GGAAGCAATGGGAGGCAGGAGGG - Intronic
946059526 2:216929846-216929868 GGGGCAAAGAGGAGGCATCAAGG - Intergenic
946220772 2:218224422-218224444 ATGACCAATGGGAGGAAGCATGG - Intronic
947810441 2:233000783-233000805 GGGACCTCTGGGAGGCATTTAGG - Intronic
947812997 2:233015974-233015996 GGGACCATGGGGATGCAGCAGGG + Intergenic
948652295 2:239455923-239455945 AGGGTCACTGGGAGGCATCACGG - Intergenic
1169245273 20:4019931-4019953 AGGGCCATTGGGAGGGATCAAGG - Intergenic
1170733201 20:18991496-18991518 GTGAACAAAGGGAAGCATCAAGG - Intergenic
1173085060 20:39908098-39908120 GGGTACAAAGGGAGGCATCTGGG - Intergenic
1175375215 20:58519436-58519458 GGGACTAGTGGGAGGCACCCAGG - Intergenic
1175764583 20:61583480-61583502 GGGTCCCATGGAAGGCATCCAGG + Intronic
1179171258 21:38974742-38974764 GTTACCACTGGGAGGCATCTTGG + Intergenic
1181443037 22:22948044-22948066 GGGGCCATTGGGAGGCAACTAGG - Intergenic
1182299623 22:29330328-29330350 GGGACGAAGGGGAGGCTCCAAGG + Intronic
1182439943 22:30357237-30357259 GAGACCAATGGGAGGGAGCTGGG - Intronic
1182467101 22:30524228-30524250 GGGTCCCCAGGGAGGCATCAGGG - Exonic
1183171472 22:36191474-36191496 CTGACCAATTGGAGGCATTAAGG - Exonic
1184764333 22:46563830-46563852 GGGACCCAAGGGACGGATCAAGG - Intergenic
950812115 3:15658967-15658989 GTGATCAGTGGGAGGCAGCAGGG - Intergenic
950874024 3:16253954-16253976 GGGAGCTAGTGGAGGCATCAAGG - Intergenic
952122898 3:30265840-30265862 GGGCCTAATGGGAGGCATTTGGG + Intergenic
952884850 3:38006111-38006133 GGCACCAATGGGACACATGAGGG - Intronic
955653837 3:61222785-61222807 GGAAACAATGGGGGGAATCAAGG + Intronic
956747286 3:72320009-72320031 GGGACCAGGGGGTGGCTTCATGG - Intergenic
958841909 3:99216010-99216032 TGGGCCAATGGGAAGCATCATGG - Intergenic
959196246 3:103186882-103186904 GGGCCTAATGGGAGGTGTCAGGG + Intergenic
960602447 3:119471283-119471305 GGAAAGAATGGGAGTCATCAAGG - Intronic
961328692 3:126126522-126126544 AGGACCCGTGTGAGGCATCAGGG + Intronic
962360509 3:134738617-134738639 GGGACAAATGGGAGGGGGCAAGG + Intronic
962712461 3:138099604-138099626 GGGCCCAGTGGGAGGTATCTGGG + Intronic
964103866 3:153019081-153019103 GGAGGAAATGGGAGGCATCAAGG - Intergenic
964498400 3:157320316-157320338 GGGAACAAGGGGAGGCTTCATGG + Intronic
964881787 3:161431389-161431411 GGGACCATTGGGAGGTAACTAGG - Intergenic
965273346 3:166648125-166648147 GGGAACAAAGGGAGACTTCAGGG - Intergenic
966729806 3:183141199-183141221 GGGGCCAGTGGGAGGGATTATGG + Intronic
967089020 3:186119300-186119322 GGGAAGATTGGGAGGCTTCAGGG + Intronic
968069978 3:195778748-195778770 GGGCCCACTGGGAGACATAAAGG + Intronic
969232833 4:5843404-5843426 GGGATCAATGAGAGGAAGCAGGG + Intronic
969576364 4:8038372-8038394 GAGACCACTGGGATGCATCTGGG - Intronic
970809251 4:20072209-20072231 GGGCCAAATGGGAGGTATCTGGG - Intergenic
973664594 4:53145140-53145162 GGCACCAAGGGCAGCCATCAGGG - Intronic
983404245 4:167305577-167305599 GGGACAAATGAGAGGAATGATGG - Intergenic
984716244 4:182928237-182928259 GGCACCAGAGGGAGGCCTCAAGG + Intergenic
985251251 4:188026691-188026713 GGCACCACTGGCTGGCATCAGGG + Intergenic
986402273 5:7394213-7394235 GGGACCTACAGGAGGCTTCAGGG + Intergenic
987098886 5:14574994-14575016 AGGACCAATGGGAGCCAGCCAGG + Intergenic
989669032 5:43892134-43892156 GGGACCAATGGGAAGAATCTTGG + Intergenic
992154899 5:73945436-73945458 GGGAGCTATGGGTAGCATCAGGG - Intergenic
992458095 5:76934692-76934714 GGCAGCAATGGGAACCATCATGG + Intergenic
992838152 5:80660384-80660406 GGACCCAGTGGGAGGAATCATGG - Intronic
996835476 5:127787230-127787252 GTGACCAGGTGGAGGCATCAGGG - Intergenic
999701588 5:154233525-154233547 GAGACCAAGGTGAGGCACCAAGG + Intronic
1006796448 6:36735370-36735392 GGGAGCAATACGAGGCTTCAGGG - Intergenic
1008288631 6:49685082-49685104 GGCAGCCATGGGAGGCATCCGGG - Intergenic
1012612760 6:101235972-101235994 GGGACCATTGGGAGGTATTTAGG + Intergenic
1013045595 6:106481843-106481865 AGGACTAATGGCAGGCATGAAGG - Intergenic
1015202713 6:130600920-130600942 GGGATCATTGGGAGTCATCTTGG + Intergenic
1022518526 7:30990513-30990535 GGCAGCCATGGGAGGCATTAGGG - Intronic
1023186619 7:37539450-37539472 GGGAACAGTGGGAGGCACCATGG + Intergenic
1023827927 7:44021946-44021968 GGGACCACAGGCAGGCACCATGG + Intergenic
1024131122 7:46354184-46354206 TGGACCAAAGGGAGGCAGTAGGG + Intergenic
1024477466 7:49829042-49829064 GGGACCACTGGGAAGCGGCAGGG - Intronic
1027515445 7:79136917-79136939 GGGACCAATGGGAGGCATCAGGG - Intronic
1028004678 7:85549601-85549623 GGGAATAATGGGAGGAATGAAGG - Intergenic
1029756230 7:102575391-102575413 GGGACCACAGGCAGGCACCACGG + Intronic
1029774170 7:102674464-102674486 GGGACCACAGGCAGGCACCACGG + Intergenic
1034071851 7:148193820-148193842 AGGAACAATGGGAGGCTCCATGG - Intronic
1034219968 7:149436517-149436539 GGGCCCTCTGGGAGGCCTCATGG + Intronic
1034411746 7:150945695-150945717 GCCACCAAGGGGAGGCACCAAGG + Intronic
1034891768 7:154845955-154845977 GGGACCAATGGGATGCGTCTTGG + Intronic
1034891786 7:154846047-154846069 GGGACCAATGGGATGAGTCTCGG + Intronic
1035331408 7:158099201-158099223 GGGAGGAAGGGGAGGCATCCGGG - Intronic
1035754555 8:2021980-2022002 GGGACCTAGGGAAGGCATCCTGG + Intergenic
1040565585 8:48564343-48564365 GGGACCAGTGGGAGCCCCCAGGG - Intergenic
1046573512 8:115996453-115996475 GGGAACAAAGGGAGGAGTCAGGG - Intergenic
1048337749 8:133515380-133515402 GGGCCCTGTGGGAGGCATCTGGG + Intronic
1048633881 8:136274576-136274598 GGGAACCATGGGAGTCAACAGGG - Intergenic
1048753451 8:137705314-137705336 GGGCCCAATGGAAGGCATTTGGG - Intergenic
1049619576 8:143592004-143592026 GGGGCCCATGGGAGGCCACAGGG + Intronic
1052913112 9:33902047-33902069 GGGACCACAGGCATGCATCACGG + Intronic
1052965676 9:34338862-34338884 AGGACCAATGGAAGGCATCCAGG - Intronic
1056057762 9:82845320-82845342 AGGTACAATGGGAGGCTTCAAGG + Intergenic
1056757127 9:89388815-89388837 GGGACCACCTGGCGGCATCAAGG + Intronic
1056810174 9:89757828-89757850 GGATCCCATGGGAGGCTTCAGGG + Intergenic
1057091989 9:92266596-92266618 GAGCCCGATGGGAGGCATCTGGG + Intronic
1058341613 9:103904415-103904437 GGGCCCAATGGGAGGCTTTTGGG + Intergenic
1059882038 9:118701960-118701982 GGGACACATTGGAGGCATGAAGG + Intergenic
1059926337 9:119213066-119213088 TAGACCAATGGGAGGCACAAAGG - Intronic
1060101469 9:120844006-120844028 GGAACCAATGGGAAACATCTGGG + Intergenic
1060127191 9:121059574-121059596 AGGACCACTGGGAGCCATCTTGG - Intergenic
1060577358 9:124708867-124708889 GGGACCCATGATAGCCATCAAGG - Intronic
1061368930 9:130187139-130187161 GGGAGCAATGTGAGGCCACAGGG + Intronic
1186195905 X:7110161-7110183 GGGGCTTATGGGAGGCATTAAGG + Intronic
1190240306 X:48653113-48653135 GGGCCACATGGGAGGCACCAGGG - Intergenic
1190740885 X:53288104-53288126 GAGCCAAATGGGAGGCATCATGG + Intronic
1196552083 X:117040813-117040835 AGGACCAATGAGAGGCATTTGGG + Intergenic
1198122387 X:133607108-133607130 GGGACCCCTGTGAGGCAGCAGGG + Intronic
1199124607 X:144101472-144101494 GGGACTAATGGGAGGAATTTGGG + Intergenic
1199894429 X:152117393-152117415 GGGAGTAAAGGGAGGCCTCAGGG - Intergenic
1200081390 X:153578505-153578527 GGGAGCAAAGAGAGGCAGCAAGG + Intronic
1200241210 X:154495060-154495082 GGGACCAGTGTAAGGCAACATGG - Intergenic
1201402961 Y:13622689-13622711 GGGACCTGTGGGAGTAATCATGG - Intergenic