ID: 1027515446

View in Genome Browser
Species Human (GRCh38)
Location 7:79136918-79136940
Sequence TGGGACCAATGGGAGGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515446_1027515453 -7 Left 1027515446 7:79136918-79136940 CCTGATGCCTCCCATTGGTCCCA 0: 1
1: 0
2: 0
3: 28
4: 180
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515446 Original CRISPR TGGGACCAATGGGAGGCATC AGG (reversed) Intronic
900497508 1:2982736-2982758 TGGGTGCCATGGGAGGCACCTGG + Intergenic
903238076 1:21963688-21963710 GGGCAGCAGTGGGAGGCATCTGG + Intergenic
903594605 1:24484515-24484537 TGGGCCCAATGGAATGCAACAGG - Intergenic
903928983 1:26851359-26851381 TGAGATGACTGGGAGGCATCTGG - Intronic
905649537 1:39647063-39647085 TGTGACCAATGGCAGGAACCAGG - Intergenic
908261752 1:62344424-62344446 TAGGAGCAATGGGAAGCACCTGG + Intergenic
911091408 1:94020287-94020309 TCGGACAAATAGAAGGCATCTGG + Intronic
912706543 1:111919299-111919321 TGGGACCAAAGGGAGGCTGATGG + Intronic
919694914 1:200564394-200564416 TGGGACCAATGGGAGGAGCCTGG + Intronic
922712126 1:227842110-227842132 TGGGCCTAATGGGAGGCATTTGG - Intronic
924926551 1:248689388-248689410 TGGGTCCAGTAGGAGGCCTCTGG - Intergenic
1064408973 10:15088850-15088872 CGCGACCAATGGGAGGCGGCCGG - Intergenic
1065294008 10:24257851-24257873 TGGGGCCTAGGGGAAGCATCAGG - Intronic
1067142214 10:43667458-43667480 TGGGGCCAAGGGGAGCCATGTGG + Intergenic
1067859638 10:49832218-49832240 TGGCACAGATAGGAGGCATCTGG - Intronic
1071201207 10:83222043-83222065 GGGGTCCAAAGGGAGGCAACAGG - Intergenic
1072465413 10:95657789-95657811 GGGGCCTAATGGGAGGCATTTGG + Intergenic
1073321777 10:102620128-102620150 TGGGACCAATGGGAGAGTTCCGG - Intronic
1076064742 10:127440297-127440319 TGCGGCCAGTGGGAGGCATCTGG - Intronic
1076514123 10:131033612-131033634 TGGGACCAAGGCGAGGCCTCAGG + Intergenic
1077496060 11:2886931-2886953 TGGGCCAAAAGGGAGGCAGCAGG - Intergenic
1083059248 11:59852377-59852399 TGGGACCCAAGGGAGACATCTGG + Intergenic
1084783282 11:71425516-71425538 TGGGACCAATGGCAAGCATGAGG + Intergenic
1087699331 11:101417870-101417892 GGGGCCTAATGGGAGGCATTTGG - Intergenic
1087862937 11:103185691-103185713 TGGTAACAATGAGAAGCATCTGG - Intronic
1089085508 11:115813753-115813775 TGGGACCAGGTGGAGGCAACTGG - Intergenic
1089982128 11:122781048-122781070 TGGGACCTATGAGTGGGATCGGG + Intronic
1090466255 11:126937237-126937259 TGAGATAAATGGGAGGCATTTGG - Intronic
1090494606 11:127198231-127198253 AGGGAAAAATTGGAGGCATCAGG - Intergenic
1091979040 12:4850834-4850856 TGGCACCGCTGGCAGGCATCTGG + Intronic
1092023264 12:5220282-5220304 AGGGATCAAGTGGAGGCATCTGG + Intergenic
1094411932 12:30176018-30176040 AGGAAACAATGGGAGGCAGCAGG + Intergenic
1099599236 12:84711314-84711336 TGGGACCTTTGGGAGGCGTGGGG - Intergenic
1100334490 12:93616713-93616735 GGGGACAAGTGGGAGGCATGAGG + Intergenic
1100997381 12:100316958-100316980 TGGGACCACAGGCAGGCACCTGG - Intronic
1101146357 12:101844475-101844497 TTCAACCAATGGGAGGCACCAGG - Intergenic
1103739941 12:123084319-123084341 TGGTTCCAAGGGGAGGCAACTGG - Intronic
1105209158 13:18247699-18247721 TGGGCCCAATGGGAGGCAGGGGG + Intergenic
1108784132 13:53873677-53873699 TGTGGCCAATTGGAGGCCTCGGG - Intergenic
1110884690 13:80618317-80618339 GGGGACTAATGGGAGGTATTTGG + Intergenic
1114707618 14:24743366-24743388 TGGGGCTAAGGGGAGGGATCTGG - Intergenic
1119689035 14:76656184-76656206 TGGGTCCCATGGCAGCCATCTGG - Intergenic
1121215436 14:92244149-92244171 GGGGACTAATGGGAGGCGTTTGG - Intergenic
1121319172 14:92981162-92981184 GGGGAACATTGGCAGGCATCAGG - Intronic
1121813984 14:96915017-96915039 AGGGACCAGTGGGAGGCGACTGG + Intronic
1122414439 14:101542114-101542136 GGGGAGCCATGGGAGGCATTAGG - Intergenic
1122776627 14:104119749-104119771 GAGGACCAATGGAAGGCCTCAGG + Intergenic
1125249728 15:37686431-37686453 GGGGACAAAGGGGAGGCATTAGG - Intergenic
1127031062 15:54863467-54863489 TGGCACCACAGGGATGCATCAGG + Intergenic
1128066910 15:64770850-64770872 TGGGACCACTGGGTGGCTTGAGG - Intronic
1128735740 15:70053088-70053110 TGGGACCAACCTGAGCCATCTGG - Intronic
1128809566 15:70561078-70561100 TAGGCCCAGCGGGAGGCATCTGG - Intergenic
1130101319 15:80896304-80896326 TGGGAAGAATGGGAGTCATATGG - Exonic
1130931495 15:88431578-88431600 TGGAGCCGATGGGAGGCAGCAGG - Intergenic
1132330232 15:101007626-101007648 TGGGACAAAGGGAAGGCCTCCGG + Intronic
1132976896 16:2715557-2715579 TTGGACCTAAGGGAAGCATCTGG + Intronic
1134616601 16:15656372-15656394 ACGGGCCAATGGGAGGGATCTGG - Intronic
1134624269 16:15712812-15712834 TGTCACCCATGGGAGGCTTCTGG + Intronic
1137350785 16:47712595-47712617 AGGGTCCCATGGGATGCATCTGG - Intergenic
1140273282 16:73485212-73485234 TGGGACCAATGGGTGACTTCAGG + Intergenic
1142257188 16:89019738-89019760 TGGCACCAAGGGGTGGCAGCAGG - Intergenic
1143427814 17:6854016-6854038 TGGCACCACTGGGATTCATCAGG + Intergenic
1144783216 17:17818049-17818071 TAGGGCCAAAGGGAGGCACCAGG + Intronic
1145276096 17:21431719-21431741 GGGGCCTAATGGGAGGTATCTGG + Intergenic
1145313940 17:21717633-21717655 GGGGCCTAATGGGAGGCATCTGG + Intergenic
1150622355 17:66817560-66817582 TGGGGCCTATGGGAGGTATGTGG + Intergenic
1151685829 17:75646159-75646181 AGGCACCAATGGGAAGCCTCAGG + Intronic
1153082861 18:1248509-1248531 GGGGCCCAATGGGAGGTATTTGG - Intergenic
1157908385 18:51591146-51591168 GGGGTCTAATGGGAGGCATTTGG - Intergenic
1159909682 18:74133907-74133929 GGGGCCTAATGGGAGTCATCTGG - Intronic
1159953575 18:74503764-74503786 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953584 18:74503818-74503840 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953594 18:74503872-74503894 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953604 18:74503926-74503948 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953613 18:74503980-74504002 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953629 18:74504088-74504110 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953639 18:74504142-74504164 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953648 18:74504196-74504218 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953666 18:74504304-74504326 TGGGACAAATGAGGGGCGTCAGG + Intronic
1159953675 18:74504358-74504380 TGGGACAAATGAGGGGCGTCAGG + Intronic
1162476719 19:10904850-10904872 GGGCACCAAGGGGAGGCAGCAGG + Intronic
1164267366 19:23632496-23632518 TGGCACCAAAGGGATCCATCAGG + Intronic
1167007238 19:46784073-46784095 TGAGAGCAGTGGGAGGCAGCGGG - Intronic
1167573381 19:50304974-50304996 TGGGACCCAGGAGAGGGATCAGG + Intronic
1168450980 19:56466444-56466466 TGGCCCCAATGGGAGGCAGCTGG + Intronic
925038179 2:708491-708513 TAGGAACAATGGGAGTCCTCCGG + Intergenic
927463285 2:23318044-23318066 TGGGACCTTTGGGAGGTATTAGG + Intergenic
927719103 2:25371956-25371978 TGGGGTCACTGGGAGGCCTCTGG - Intergenic
930574318 2:53127441-53127463 TGGGGCCACTGTGAGGGATCGGG + Intergenic
932090491 2:68801604-68801626 TGGGAGGAATGGGAGGCAGCAGG + Intronic
934019920 2:87937659-87937681 GGGGACTAATGGGAGGAATTTGG - Intergenic
934543274 2:95193815-95193837 TGGTACCAAATGGAGGCATAAGG - Intergenic
935637109 2:105257784-105257806 TGGACCCAATGGGAGGGATTAGG - Intergenic
945811949 2:214559477-214559499 AGGGGCCAGTGAGAGGCATCAGG - Intronic
945936170 2:215904726-215904748 TGAGCCCACTGGGAGGCACCGGG - Intergenic
947812996 2:233015973-233015995 TGGGACCATGGGGATGCAGCAGG + Intergenic
948378057 2:237535136-237535158 TAGGACCAAGGGGTGGCATCTGG + Intronic
948794879 2:240397408-240397430 TGGGCCCCATGGCAGGCCTCTGG + Intergenic
1170395241 20:15918966-15918988 TGGAACCAATGAGAGGGATGAGG + Intronic
1171290331 20:23979412-23979434 TGGGCCCAATGGGAGGCAGGGGG + Intergenic
1172595371 20:36147751-36147773 TGGGAGCAGTGAGAGGCAACAGG - Intronic
1173085061 20:39908099-39908121 GGGGTACAAAGGGAGGCATCTGG - Intergenic
1174124786 20:48296317-48296339 TGGGGCCAATGAGATGCAACAGG - Intergenic
1174159255 20:48539184-48539206 GGGGACCAAAGGGAGGAATTTGG - Intergenic
1174176503 20:48648761-48648783 TGGCACCTTGGGGAGGCATCCGG - Intronic
1175218080 20:57401889-57401911 TGGGTACAGTGGGAGGCAGCTGG + Intronic
1175909865 20:62400084-62400106 TGGCGCCAATGTGAGGCACCAGG - Intronic
1176070580 20:63224257-63224279 TGGGACCACAGGGAGGACTCTGG - Intergenic
1178110503 21:29365331-29365353 TGGGACCAAGGAGAGGCCACTGG + Intronic
1180767097 22:18351598-18351620 TGGGCCCAATGGGAGGCAGGGGG - Intergenic
1180779214 22:18510781-18510803 TGGGCCCAATGGGAGGCAGGGGG + Intergenic
1180811933 22:18768101-18768123 TGGGCCCAATGGGAGGCAGGGGG + Intergenic
1180986413 22:19906749-19906771 TGGGTCCAATGGAAGGCAGCAGG + Intronic
1181198088 22:21202345-21202367 TGGGCCCAATGGGAGGCAGGGGG + Intergenic
1181401657 22:22653459-22653481 TGGGCCCAATGGGAGGCAGGGGG - Intergenic
1181703615 22:24634556-24634578 TGGGCCCAATGGGAGGCAGGGGG - Intergenic
1181981260 22:26768488-26768510 GGGGACCGATGGGAGGCAGGTGG + Intergenic
1182439944 22:30357238-30357260 AGAGACCAATGGGAGGGAGCTGG - Intronic
1182774500 22:32820703-32820725 TGGGACCAAGGGGAGGTTTGGGG + Intronic
1183050215 22:35254909-35254931 TGGGACCAATAGGACTCATAAGG + Intergenic
1183922087 22:41177582-41177604 TGGGGGCCATGGGAGTCATCGGG - Exonic
1203228719 22_KI270731v1_random:92492-92514 TGGGCCCAATGGGAGGCAGGGGG - Intergenic
950284533 3:11734192-11734214 TGGGAGGAATGCGAGGCACCCGG + Intergenic
950812116 3:15658968-15658990 TGTGATCAGTGGGAGGCAGCAGG - Intergenic
952122897 3:30265839-30265861 AGGGCCTAATGGGAGGCATTTGG + Intergenic
952234452 3:31464350-31464372 TGGGTCCACTGCCAGGCATCTGG + Intergenic
952816699 3:37452787-37452809 TGGGACCCCAGGGAGGCACCCGG - Intronic
952959391 3:38580097-38580119 TGGGACCACAGGGAGGCAGGAGG + Intronic
954343543 3:49975499-49975521 AGGCACCAACGGGAGGCTTCTGG - Intronic
954400735 3:50318211-50318233 TGGGACCATAGGCAGGCAGCTGG - Exonic
954446029 3:50547370-50547392 TGGGCACGATGGGAGGCAGCAGG + Intergenic
956720800 3:72115756-72115778 TGGGGCCTCTGGGAGGCAACTGG - Intergenic
959598027 3:108148846-108148868 TGGGACAAATGTGAGACAGCAGG - Intergenic
962003576 3:131326307-131326329 TGGGTGCAATGGGAAGCCTCTGG - Intronic
962056114 3:131873511-131873533 TGAGACCACTCTGAGGCATCTGG + Intronic
962712460 3:138099603-138099625 GGGGCCCAGTGGGAGGTATCTGG + Intronic
964869424 3:161297006-161297028 TGGGGCCTGTGGGAGCCATCTGG - Intergenic
966042447 3:175508214-175508236 TGGGCCTGATGGGAGGCATTTGG - Intronic
967089019 3:186119299-186119321 TGGGAAGATTGGGAGGCTTCAGG + Intronic
968850189 4:3073658-3073680 TGGGACCGATGGGGGGCGCCAGG + Intergenic
969576365 4:8038373-8038395 TGAGACCACTGGGATGCATCTGG - Intronic
970601428 4:17643555-17643577 TGGTACCAATGGGAGGGGACGGG - Intronic
970809252 4:20072210-20072232 GGGGCCAAATGGGAGGTATCTGG - Intergenic
973664595 4:53145141-53145163 TGGCACCAAGGGCAGCCATCAGG - Intronic
973906425 4:55536392-55536414 TGGGCCCAGTAGGAGGCAACTGG + Intronic
977022405 4:91774074-91774096 TGGGAACAATGGGATGTATTGGG + Intergenic
978326571 4:107564167-107564189 TGAGATCAATGGGAAGCAACGGG + Intergenic
978824560 4:113005749-113005771 TGGGCCTAGTGGGAGGCATTTGG + Intronic
978949237 4:114537604-114537626 TGGGACCTATGTGAGTCATGGGG - Intergenic
980760723 4:137230279-137230301 GGGGCCCAATGGGAGGTATTTGG - Intergenic
985251250 4:188026690-188026712 TGGCACCACTGGCTGGCATCAGG + Intergenic
985533577 5:448408-448430 GGGGACCAAGGGGAGGGATGAGG - Intronic
986402272 5:7394212-7394234 TGGGACCTACAGGAGGCTTCAGG + Intergenic
987315799 5:16722155-16722177 TGGCACCTGTGGGATGCATCGGG - Intronic
987430318 5:17824976-17824998 TGGGACCAGGTGGAGGCAACTGG - Intergenic
989106950 5:37871925-37871947 TGGGAACAATGGGAGGAAGGGGG - Intergenic
995237923 5:109851395-109851417 TGGGACCTTTGGGAGGCTTTTGG + Intronic
997515534 5:134486609-134486631 TGGGCCTAGTGGTAGGCATCGGG + Intergenic
997923960 5:138010552-138010574 TGTCACTAATGGGAAGCATCTGG - Intronic
998404448 5:141866234-141866256 AGGCACCAATGCGAGGAATCCGG + Intronic
998661406 5:144242869-144242891 TGGGCCCAATGGGAGGTCTTAGG - Intronic
1000173740 5:158729385-158729407 TGGGAACAATGGGAAGAATCTGG + Intronic
1002432813 5:179212987-179213009 TGAGTCCCATGGGAGGCAGCGGG - Intronic
1002689510 5:181040638-181040660 TGGGGGCAATGGGATGTATCAGG - Intronic
1003002765 6:2351499-2351521 TGGAATCAAAGGGAAGCATCAGG - Intergenic
1004321166 6:14632791-14632813 TGGAGACACTGGGAGGCATCTGG - Intergenic
1006367656 6:33624945-33624967 TGGGAAGGATGGGAGGGATCTGG + Intronic
1008288632 6:49685083-49685105 TGGCAGCCATGGGAGGCATCCGG - Intergenic
1017901307 6:158720666-158720688 TGAGAACAATGCCAGGCATCTGG - Intronic
1019080220 6:169425190-169425212 TGGGACCATGGGGAGGTACCTGG + Intergenic
1022251315 7:28611166-28611188 TGGGACAAAAGTGAGGCAACAGG + Intronic
1027515446 7:79136918-79136940 TGGGACCAATGGGAGGCATCAGG - Intronic
1029194740 7:98797355-98797377 TGGGGCCCTTGGGAGGCATGGGG + Intergenic
1029587662 7:101485761-101485783 TGGGAGCAGTGGGAGGCAGAGGG + Intronic
1035331409 7:158099202-158099224 GGGGAGGAAGGGGAGGCATCCGG - Intronic
1035331422 7:158099232-158099254 TGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331624 7:158099727-158099749 TGGGAGGAAGGGGAGGCAGCCGG - Intronic
1036149419 8:6283842-6283864 TGGAACCAATTCCAGGCATCAGG + Intergenic
1038282919 8:26182066-26182088 TGGGTCCAATGTGGGGCATTGGG - Intergenic
1041027988 8:53706659-53706681 TGGGCCCAAGGGGAGGCACACGG + Intergenic
1042166598 8:65951620-65951642 TGGGAGCTGTGGGAGGCAGCAGG - Intergenic
1046573513 8:115996454-115996476 TGGGAACAAAGGGAGGAGTCAGG - Intergenic
1048337748 8:133515379-133515401 GGGGCCCTGTGGGAGGCATCTGG + Intronic
1048404263 8:134103863-134103885 TGGGGCAAATGGGAGGTGTCTGG - Intergenic
1048753452 8:137705315-137705337 GGGGCCCAATGGAAGGCATTTGG - Intergenic
1048990918 8:139759736-139759758 TGGGAGCACTGGGTGGCAGCTGG - Intronic
1049470521 8:142773267-142773289 TGGGAGCTCTGGGAGGCACCTGG + Intronic
1050013690 9:1210938-1210960 TTTGACCAATGGGAGGAACCAGG - Intergenic
1051687207 9:19670139-19670161 TGGCACCAATGGAAGCCATCAGG + Intronic
1057076305 9:92139997-92140019 TGGCACCAACGGGAGGCCTAGGG + Intergenic
1057091988 9:92266595-92266617 GGAGCCCGATGGGAGGCATCTGG + Intronic
1058277587 9:103064431-103064453 TGGGACAAATGGGAGGCAGAAGG - Intergenic
1058341612 9:103904414-103904436 GGGGCCCAATGGGAGGCTTTTGG + Intergenic
1060072832 9:120565307-120565329 TGGGCCCAAAGGGAGGAATGTGG - Intronic
1060101468 9:120844005-120844027 GGGAACCAATGGGAAACATCTGG + Intergenic
1061251897 9:129431328-129431350 TGGGAGCAATTGGAGGCAGAGGG - Intergenic
1061265393 9:129501867-129501889 TGGGACCTCTGGGAGCCAACAGG + Intergenic
1061365501 9:130170924-130170946 TGGGCCCAGTTGGAGGGATCTGG - Intergenic
1062523368 9:136968768-136968790 TGGGCCCAGTGGGAGGTGTCTGG + Intergenic
1191903659 X:66064795-66064817 TGGGACCACAGGGATCCATCGGG - Intergenic
1195708917 X:107758768-107758790 TGGGATCACTGGGAGACATGTGG + Intronic
1196178721 X:112667824-112667846 TGGGACCCATGGGCCCCATCAGG + Intronic
1196552082 X:117040812-117040834 GAGGACCAATGAGAGGCATTTGG + Intergenic
1198122386 X:133607107-133607129 TGGGACCCCTGTGAGGCAGCAGG + Intronic
1198300887 X:135333329-135333351 TGGGGCCAATGAGAGGCAGCAGG - Intronic
1198852174 X:140976364-140976386 TGTGACCAATAGGTAGCATCTGG + Intergenic
1199124606 X:144101471-144101493 GGGGACTAATGGGAGGAATTTGG + Intergenic
1199532299 X:148863788-148863810 TGGGAACAATGCTAGGAATCCGG + Intronic
1199894430 X:152117394-152117416 TGGGAGTAAAGGGAGGCCTCAGG - Intergenic