ID: 1027515453

View in Genome Browser
Species Human (GRCh38)
Location 7:79136934-79136956
Sequence GGTCCCAGGGGTCCACCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027515445_1027515453 -6 Left 1027515445 7:79136917-79136939 CCCTGATGCCTCCCATTGGTCCC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515442_1027515453 8 Left 1027515442 7:79136903-79136925 CCGGCCTGATAGCTCCCTGATGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515443_1027515453 4 Left 1027515443 7:79136907-79136929 CCTGATAGCTCCCTGATGCCTCC 0: 1
1: 0
2: 3
3: 39
4: 240
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515446_1027515453 -7 Left 1027515446 7:79136918-79136940 CCTGATGCCTCCCATTGGTCCCA 0: 1
1: 0
2: 0
3: 28
4: 180
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data
1027515441_1027515453 9 Left 1027515441 7:79136902-79136924 CCCGGCCTGATAGCTCCCTGATG 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027515453 Original CRISPR GGTCCCAGGGGTCCACCAGT AGG Intronic
No off target data available for this crispr