ID: 1027520379

View in Genome Browser
Species Human (GRCh38)
Location 7:79199251-79199273
Sequence GGCTGCATTTGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027520374_1027520379 6 Left 1027520374 7:79199222-79199244 CCAACAAGAGTAATAATATTAAT 0: 1
1: 2
2: 3
3: 66
4: 741
Right 1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG 0: 1
1: 0
2: 5
3: 32
4: 344
1027520373_1027520379 25 Left 1027520373 7:79199203-79199225 CCAAGTATGCATAATGATTCCAA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG 0: 1
1: 0
2: 5
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027520379 Original CRISPR GGCTGCATTTGGAGGGCAGA AGG Intronic
900200220 1:1401360-1401382 AGCTGCCTTTGGAGGGGAGACGG + Intronic
900384101 1:2401445-2401467 GGCTCCTTTTGGCTGGCAGAGGG + Intronic
900897562 1:5494285-5494307 GGCTGCTTTTGGAGCACAGGTGG + Intergenic
901635397 1:10668017-10668039 GGCAGCATCTGGAAGGCAGGTGG - Intronic
901840255 1:11949814-11949836 GTCGGCAGGTGGAGGGCAGAAGG + Exonic
902193280 1:14778873-14778895 GACTGCATTTGGACAGCAGCTGG + Intronic
903351192 1:22717458-22717480 GGCTGCAGCAGGGGGGCAGATGG - Intronic
904605947 1:31697769-31697791 GGCTGCATTTGGAGGGCAACAGG + Intronic
905016560 1:34782156-34782178 AGCTGGCTTTGGAGGGCAGCTGG + Intronic
905117024 1:35650994-35651016 TGCTGCATAATGAGGGCAGAAGG + Intergenic
905237944 1:36563115-36563137 GGCTGGATTTGGTGGGAAGGGGG - Intergenic
906004328 1:42456090-42456112 GCCAGCATTTCAAGGGCAGAGGG + Exonic
906078591 1:43069218-43069240 AGCTGCAGGGGGAGGGCAGAGGG - Intergenic
906305851 1:44718638-44718660 GGCTGCAGAGGGTGGGCAGATGG + Intronic
906568366 1:46816249-46816271 GTCTGAATGTTGAGGGCAGAGGG + Intronic
906812577 1:48844057-48844079 GGCTGGTGTTGGGGGGCAGAAGG - Intronic
908172645 1:61522583-61522605 GCCTGCATATGGAGGACAGAAGG + Intergenic
911114531 1:94233047-94233069 GGGTGGCTTTGGCGGGCAGATGG - Intronic
911329206 1:96507568-96507590 GGCTGCATTGGGAGGTCATGAGG - Intergenic
913958770 1:143323765-143323787 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
914053087 1:144149145-144149167 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
914126110 1:144817396-144817418 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
915507053 1:156364485-156364507 GGATGTATTTGGAAGGTAGATGG - Intronic
915536766 1:156541061-156541083 GCTTGCACTTGGAGGGCAGTGGG + Intronic
915622288 1:157092999-157093021 AGGTCCAGTTGGAGGGCAGAGGG + Exonic
916721855 1:167490165-167490187 GGGTGCATTTGGAAGGCACGGGG + Intronic
917717681 1:177754509-177754531 TTCTGCATATTGAGGGCAGAGGG - Intergenic
918187812 1:182143423-182143445 GGATGGATTTGAAGGGCTGAGGG + Intergenic
919805131 1:201376924-201376946 AGCTGCACTTGGGGGGCAGATGG - Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
922745093 1:228038908-228038930 GGGTGCACTTGGGGGACAGAGGG + Intronic
923573575 1:235138657-235138679 GGTTGCCTTTGGAGGGAAGGAGG - Intronic
924028987 1:239867833-239867855 GGCTGCCTTTGGAGGGGAGATGG - Intronic
924435549 1:244037450-244037472 GGCTGGCTGTGGAGGGTAGAGGG + Intergenic
1062934282 10:1374612-1374634 CGCTGCATACGGCGGGCAGAGGG - Intronic
1064007421 10:11709527-11709549 GGCTGCATATGGAAGGGAGATGG + Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064374304 10:14782086-14782108 GGCTGGATTTTTAAGGCAGAGGG - Intergenic
1065361660 10:24894843-24894865 GGCTGCATTTGGGGCTCAAAAGG - Intronic
1066055166 10:31674018-31674040 GGCTGCAGTAAGTGGGCAGAAGG - Intergenic
1066211282 10:33241287-33241309 GACTGCATTTGGATAGCAAAGGG - Intronic
1066452607 10:35544953-35544975 GCCTCCTTTTAGAGGGCAGAGGG + Intronic
1067979846 10:51073484-51073506 TGCTGAATTTGGCGGGGAGAGGG - Intronic
1069783782 10:70975085-70975107 GGCTGCATGGGCAGGTCAGATGG + Intergenic
1069783811 10:70975233-70975255 GGCTGCAGTAAGAGGGAAGAAGG + Intergenic
1070764057 10:79046350-79046372 GCCTGAATCTGGAAGGCAGAGGG + Intergenic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1072041462 10:91611060-91611082 GGCTACTCTGGGAGGGCAGAGGG - Intergenic
1073064527 10:100750275-100750297 AGCAGCATTTGGGAGGCAGAAGG + Intronic
1073794181 10:106970306-106970328 GGTTACATTTGGAGGGAAGAAGG - Intronic
1073951868 10:108818856-108818878 GCCTGCATTAGGAAGGCAGATGG - Intergenic
1074618119 10:115091381-115091403 GGCTGACTTTGGCTGGCAGATGG + Intergenic
1076386190 10:130057659-130057681 GTCAGCATGTGGATGGCAGAGGG + Intergenic
1076398194 10:130157161-130157183 TCCAGCATGTGGAGGGCAGATGG - Intronic
1076464524 10:130669418-130669440 GGCAGCTTTTGGAGAGAAGAAGG + Intergenic
1076668137 10:132104483-132104505 GGCACCATATGGCGGGCAGATGG + Intergenic
1077026533 11:442326-442348 GGATGCTTTTGGAGGGAACATGG - Intergenic
1077343607 11:2036712-2036734 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1079156323 11:17951460-17951482 GGCTGGAGTTGGAGGTCTGATGG - Intronic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG + Intergenic
1081665554 11:44915182-44915204 GGCTCCAGTGAGAGGGCAGAGGG + Intronic
1081712861 11:45228696-45228718 GTCTGCATTTGGGAGGCAGGGGG + Intronic
1083001851 11:59299507-59299529 GGCTTAGCTTGGAGGGCAGATGG - Intergenic
1083728025 11:64638393-64638415 GGCTGCCTCCGGAGCGCAGAAGG + Intronic
1084167671 11:67383573-67383595 GGCTGGAGGTGGAGGGGAGATGG - Intronic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1084590053 11:70085283-70085305 GGCTGGCTTTTGAGGGCAGTGGG - Intronic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1085012499 11:73151003-73151025 GGCTAAATTTGGAGGGCAGTGGG - Intergenic
1085119314 11:73957155-73957177 GGCTCCATGTGGAAGGCTGAGGG - Intronic
1086508111 11:87527328-87527350 GGCTGCATTTGCAGGACATTAGG + Intergenic
1087138251 11:94741084-94741106 GGCTGGGGTTGGAGGGCGGAGGG + Intronic
1087430816 11:98052141-98052163 GGCTGGATTTGGCCCGCAGACGG - Intergenic
1088142392 11:106633175-106633197 GGCAGCATTTGGAGGCCAGAAGG + Intergenic
1089768950 11:120788870-120788892 GGCAGCATTTAGATGGCAGCAGG - Intronic
1090783508 11:130028248-130028270 GTCTGCACTTGGGGGACAGATGG - Intergenic
1202826593 11_KI270721v1_random:91901-91923 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1091644846 12:2265599-2265621 CCCTGCATTTGCAGGGAAGATGG - Intronic
1092784373 12:12014272-12014294 GGCTGCATTAGGAGATCAAATGG + Intergenic
1092994090 12:13931789-13931811 GGTTGCATATGGAGGGATGAAGG - Intronic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1095705841 12:45236005-45236027 GGCTACATATGAAGGGGAGAAGG + Intronic
1096183995 12:49566508-49566530 GGCTGCATTTTGATGGCAGAGGG - Intronic
1096607027 12:52774232-52774254 CACTGCATTTAGAGGGAAGAGGG - Intronic
1096798054 12:54090811-54090833 GGCGGCTTTTGGGGGGCAGGGGG + Intergenic
1101944951 12:109129702-109129724 AACTGCTTTTGGGGGGCAGAGGG - Intronic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102109511 12:110354223-110354245 TGCTGCATATAGATGGCAGATGG + Intergenic
1102490877 12:113288876-113288898 GCCTGCATTTCCCGGGCAGAGGG + Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1104115358 12:125744519-125744541 GGCTGAACCTGGAGGGCAGCGGG + Intergenic
1104370166 12:128217321-128217343 GGCTGTATGTGAAGGGGAGAGGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104894887 12:132159247-132159269 GGAGGCATTGGGAGGGCAGCGGG - Intergenic
1105585901 13:21742525-21742547 GGCTGGAGGTGGAGGGCACATGG - Intergenic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1108004616 13:45934376-45934398 GGCTGCATGTAGATGGCTGAAGG + Intergenic
1110915901 13:81020875-81020897 GTCTGGATTGTGAGGGCAGAGGG - Intergenic
1113400323 13:109986465-109986487 GGCTGCATCTGCACTGCAGAGGG - Intergenic
1113978665 13:114252404-114252426 GTATGAATTTGGGGGGCAGAGGG + Intronic
1114449331 14:22814631-22814653 AGCTGAAATTGGAGGGAAGACGG - Intronic
1117331967 14:54721601-54721623 GGCTGCATTTGGAAGGTAAGGGG + Intronic
1117432729 14:55685510-55685532 GGCAGAATAGGGAGGGCAGAAGG - Intronic
1118057395 14:62094373-62094395 GGCTGCATTTAGGGGGAAGAGGG - Intronic
1118384281 14:65242779-65242801 GTCTGCACTTAGAGGGCAGGAGG + Intergenic
1119233062 14:72996123-72996145 GGCTGCATTCAGTGGGCAGGGGG + Intronic
1119641185 14:76316095-76316117 GGCTGCTTTTATAGGGCAGCTGG + Intronic
1121499782 14:94425640-94425662 GGGTGAATTTGGAGGTGAGAGGG - Intergenic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1122504710 14:102225018-102225040 GGGTGTATTTGGAAGGCAGAAGG + Intronic
1123061545 14:105596949-105596971 GGCTGCAGGTGGATGGCAGGAGG + Intergenic
1123069142 14:105633025-105633047 GGCTGCATTTTCAGAGCAGCTGG - Intergenic
1123074242 14:105659215-105659237 GGCTGCATTTTCAGAGCAGCTGG - Intergenic
1123088239 14:105728798-105728820 GGCTGCATTTTCAGAGCAGCTGG - Intergenic
1123442348 15:20301551-20301573 GGCCGCACTAGGAGGGCAGGTGG + Intergenic
1125206017 15:37154323-37154345 TGTTGCATTTCTAGGGCAGAGGG - Intergenic
1126354723 15:47783090-47783112 GGATGGATTAGGAGGGAAGATGG + Intergenic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127667315 15:61161035-61161057 GGGTGCATTTGGGAGGCGGAGGG + Intronic
1128380315 15:67107473-67107495 GACTGCATCAGGAGGGCAGGAGG - Intronic
1129775557 15:78234110-78234132 GGCTGCAGTTGGAGACCAGTTGG - Intronic
1129879708 15:78998637-78998659 AGCTGCTTTTGGAAGGCAGCTGG + Intronic
1130330017 15:82914879-82914901 GCGTGCATTTAGAGGACAGATGG + Intronic
1131065614 15:89433401-89433423 GGGTGCATTTGGAGGGAGGGAGG - Intergenic
1131681202 15:94725581-94725603 GGCCGTATCTGGAGGGTAGATGG + Intergenic
1131842866 15:96456332-96456354 GGATGCATGTGGAAGGCAGAAGG - Intergenic
1132815595 16:1824927-1824949 GGCTGCAGGTGGGGTGCAGAAGG + Intronic
1133100360 16:3475739-3475761 GGCTGGATTTGCAGGGGAAATGG - Intronic
1135783136 16:25323919-25323941 GGCAGGATTTGGCAGGCAGAGGG + Intergenic
1136544153 16:30946643-30946665 GGAAGCAGGTGGAGGGCAGATGG + Intronic
1136786794 16:32939694-32939716 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1136882978 16:33914096-33914118 TGCTACAGGTGGAGGGCAGAAGG - Intergenic
1136894551 16:33988967-33988989 GGCCGCATTTGGAAGCCAGGCGG - Intergenic
1137447206 16:48539247-48539269 TGCAGCATCTGGACGGCAGAGGG + Exonic
1138152200 16:54669258-54669280 GGCTGATTTTAGAGGGCACAAGG - Intergenic
1138195316 16:55047701-55047723 GGCTGCTATTGGGAGGCAGATGG - Intergenic
1138239570 16:55416305-55416327 GACTGAATTTGGAGGGGACAAGG - Intronic
1138648014 16:58439202-58439224 GGCTCCATTTTGTGGCCAGATGG - Intergenic
1138950438 16:61906380-61906402 GGCTGCAGTGGGTGGCCAGAGGG - Intronic
1140868930 16:79089128-79089150 GGCCGCATATGGTGGGCACAGGG + Intronic
1141268848 16:82521093-82521115 GGCTATTTTTGGGGGGCAGAAGG - Intergenic
1141443725 16:84045205-84045227 GGCTGGATTTGGGGGGAAGCGGG - Intergenic
1141952276 16:87346718-87346740 GGCTCCAGTAGGAGGGCACAGGG + Intronic
1142255948 16:89014046-89014068 GGCTGCATTTGGGGAGGAAAAGG + Intergenic
1203089030 16_KI270728v1_random:1201364-1201386 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1144669681 17:17125931-17125953 GGATGCTTTGGGAGAGCAGATGG - Intronic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146818243 17:35962390-35962412 GGCTGCCTTTGGGGAGAAGATGG + Intergenic
1147669926 17:42171049-42171071 GACTTCATTTGGAGGGCAGTGGG + Intronic
1148125886 17:45236555-45236577 CGATTCATTTGGAGGGCTGATGG + Intronic
1149304655 17:55335901-55335923 GGGTGCATTTGGATGGGAGGTGG + Intergenic
1149891332 17:60392392-60392414 GGCTGCGATTGGCGGGAAGATGG - Intronic
1150197877 17:63319860-63319882 GGCTGCCTGTGGAGAGAAGATGG - Intronic
1151289860 17:73141783-73141805 GGGTGCACTTGGAGGAAAGAGGG + Intergenic
1151376295 17:73691207-73691229 GGCTGTAATTGGAGGGGTGATGG + Intergenic
1151549259 17:74812548-74812570 GGCTGCTCTTGGTGGGCACAAGG - Intronic
1151980420 17:77505201-77505223 GGCTGCAGTTGGAGGCCTGGTGG + Intergenic
1152280919 17:79384494-79384516 AGGGGCATTTTGAGGGCAGACGG - Intronic
1152744438 17:82032320-82032342 GGCTGCCCTTGCTGGGCAGAGGG + Intronic
1152820932 17:82437297-82437319 GGCTGCAGGTGGCGGGCAGCGGG + Exonic
1153242871 18:3046442-3046464 GTCTGCAGGAGGAGGGCAGAGGG + Intergenic
1156368578 18:36451994-36452016 TGCTGCTTGTGGAGGGCAAAGGG - Intronic
1156761711 18:40599865-40599887 GATTGCATTTGGAGCTCAGACGG - Intergenic
1158801626 18:60917468-60917490 GGCTGCCCTGGGGGGGCAGAGGG - Intergenic
1159527964 18:69618140-69618162 GGCTTCTTCTGGAGGGCTGAGGG - Intronic
1160862772 19:1244722-1244744 GGCTGGCTCTGCAGGGCAGAGGG - Exonic
1161276907 19:3423558-3423580 GGCTGAAGTTGGGGGGCAGGTGG - Intronic
1161402707 19:4075362-4075384 GGCTGCAGTTGGGAGCCAGAGGG + Intergenic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1164676252 19:30103771-30103793 GGCAGCATTTGGAAGGGAGCTGG - Intergenic
1164676623 19:30105492-30105514 GGAAGCATGTGGAGTGCAGACGG + Intergenic
1165433316 19:35784367-35784389 GGCTGCAGGGGGAGGGCAGGTGG + Intronic
1165834495 19:38745837-38745859 GGGTCCACTTGGAGGGAAGAAGG - Intronic
1166999820 19:46739170-46739192 GGCTGCCTTTGGGGGGAAGTCGG + Intronic
1167210884 19:48133441-48133463 GACAACCTTTGGAGGGCAGAGGG + Intronic
1167521674 19:49959313-49959335 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1167523709 19:49971409-49971431 GAGTCCATTGGGAGGGCAGAGGG + Intergenic
1167756358 19:51415851-51415873 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1202692482 1_KI270712v1_random:101568-101590 GGCTGCGCTAGGAGGGCAGGCGG - Intergenic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925724782 2:6862383-6862405 GGATGCAAATGCAGGGCAGACGG + Intronic
926629903 2:15126693-15126715 GGCAGCATTTGGAAGGCAGTTGG + Intergenic
927121701 2:19970470-19970492 GATTGAATTGGGAGGGCAGAGGG - Intronic
927760835 2:25752202-25752224 GGCTGCCATTGGTGTGCAGAAGG + Intronic
929402478 2:41601160-41601182 GCATGCATTTTGAGGTCAGACGG + Intergenic
929424001 2:41825623-41825645 GGTGGCATTTGGTGAGCAGAAGG - Intergenic
929579268 2:43071351-43071373 AGCTGCCCTTGGAGGGCAGGAGG + Intergenic
930746882 2:54893688-54893710 GGCTTCAACTGGAGGTCAGAGGG - Intronic
931112809 2:59131242-59131264 GGCTGGATATGGAGTGCAGTTGG + Intergenic
931475968 2:62587879-62587901 GGCTGCATCTGCAAGGAAGATGG - Intergenic
931660153 2:64553229-64553251 GGCTGCTTTTGGAGACCAGCAGG + Exonic
931810988 2:65854906-65854928 GGGTACATTTGGAGAGGAGAAGG - Intergenic
931890675 2:66667930-66667952 GGATGTTTTTGGAGGGCAAAGGG + Intergenic
933536642 2:83583850-83583872 GGCTGCATTTGCATCTCAGAGGG - Intergenic
933953918 2:87352403-87352425 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
934238118 2:90248646-90248668 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
934251567 2:90359993-90360015 GGCTGCAATGGGAGAGAAGAAGG - Intergenic
934257992 2:91443405-91443427 GGCTGCAATGGGAGAGAAGAAGG + Intergenic
934275080 2:91568087-91568109 GGCTGCACTAGGAGGGCAGGCGG - Intergenic
934780857 2:96968744-96968766 GGCTGCATTTGGAGAAGGGATGG - Intronic
934992793 2:98933207-98933229 GGCTCCATGTGGAGGGGAAAGGG + Intronic
935139346 2:100338931-100338953 GGAGGCATTTGGAGAGGAGATGG - Intergenic
935282027 2:101526615-101526637 GGGTGAATTTGGAGGGGAAATGG + Intergenic
938083839 2:128385285-128385307 GGCCGCCAATGGAGGGCAGATGG + Intergenic
938115447 2:128600150-128600172 GAATGCATTTTAAGGGCAGAAGG + Intergenic
938289250 2:130140797-130140819 GCCTGCCTTTGGAGGGCACTAGG - Intronic
938467276 2:131532141-131532163 GCCTGCCTTTGGAGGGCACTAGG + Intronic
939675687 2:145069534-145069556 TCCTGCACCTGGAGGGCAGAGGG + Intergenic
942433050 2:175936053-175936075 GGCTGCAATGGCAAGGCAGATGG + Intronic
944096345 2:195973078-195973100 GGCTGCATGTGGAGAGAACATGG + Intronic
946814578 2:223563701-223563723 GGCTGTCTCTGGAAGGCAGATGG - Intergenic
947185427 2:227451076-227451098 GGCAGGATTTGGAGTGCACATGG - Intergenic
947615536 2:231554722-231554744 GCCTGCAGAGGGAGGGCAGAGGG - Intergenic
947819057 2:233058355-233058377 TCCTGAATGTGGAGGGCAGAAGG + Intergenic
948261344 2:236606499-236606521 GGGTGAATCTGGAGGGCACAGGG - Intergenic
948345519 2:237294105-237294127 GGCTGAATTTGCAGGGAGGAGGG + Intergenic
948994484 2:241571514-241571536 GGCTGAATTGGGGGTGCAGAGGG + Intronic
1170396571 20:15932117-15932139 AGCTGCATTTGGTTGGCAGCTGG + Intronic
1170742884 20:19073292-19073314 GGCTACTTTTGGAAAGCAGAAGG + Intergenic
1172181790 20:33008103-33008125 GGCTGAATTTGGTGGACAGCTGG + Intronic
1172698340 20:36837230-36837252 GGCTGAGTTCTGAGGGCAGAGGG + Intronic
1173088381 20:39946885-39946907 GCCTTCATTTGTAGGGCAGAAGG - Intergenic
1173973802 20:47172545-47172567 GTGTGCATTTGGGGGGCAGCAGG - Intronic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174552764 20:51373670-51373692 AGCTGCACTTGGAGGCCAGAGGG - Intergenic
1174624073 20:51899849-51899871 GGCTGAATTGGGTGGGTAGATGG + Intergenic
1175416328 20:58803858-58803880 GGCTGCGGTCGGAGGGGAGAAGG - Intergenic
1175478546 20:59294723-59294745 GGCTGCATTTGGTGGACACAGGG + Intergenic
1175812195 20:61864386-61864408 GGCTGCATGGGGAGGGAAGTGGG - Intronic
1176591659 21:8655024-8655046 GGCTGCGCTAGGAGGGCAGGCGG + Intergenic
1177115683 21:17083212-17083234 GCCTGCATCTGGAAGGAAGAGGG - Intergenic
1177724678 21:24951504-24951526 CTCTGCATTTTGAGGGGAGAGGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1179082228 21:38181869-38181891 GGCAGCAGATGGAGGACAGAGGG + Intronic
1179461091 21:41535900-41535922 GGCTGGATTTGGAGAGGAGAGGG + Intergenic
1179470973 21:41610174-41610196 TGCTGCACTTGGTGGGCGGAAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181355711 22:22294770-22294792 GGCCGCACTAGGAGGGCAGGTGG - Intergenic
1182762713 22:32735553-32735575 GGCTGGATTTGCAGGGAAGCTGG - Intronic
1183074414 22:35417729-35417751 GCCAGCATCTGGAGAGCAGAGGG - Exonic
1183085693 22:35485562-35485584 TGATGCCTTTGGAAGGCAGATGG - Intergenic
1183585072 22:38748686-38748708 GCCTGCATGGGGAGAGCAGAGGG - Intronic
1183688415 22:39375032-39375054 GGCTGCTTCTGAAGGGCAAAGGG - Intronic
1183700743 22:39449608-39449630 GGCTGCCTGGGGAAGGCAGAGGG + Intergenic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184258252 22:43299399-43299421 GGCTTCACTTGGAGACCAGAAGG - Intronic
1184340118 22:43881412-43881434 GGCTGCATGAGTAGGCCAGAGGG + Intronic
1185052205 22:48559762-48559784 GCCTGCCTTTGGGGAGCAGAGGG + Intronic
949681798 3:6522351-6522373 GACTTAATTTAGAGGGCAGAAGG + Intergenic
950235736 3:11318758-11318780 TGCGGCATTTGGAGGGCACAGGG - Intronic
953927639 3:46990505-46990527 GAATGCAGTTGGAGGGGAGAAGG - Intronic
956256648 3:67290402-67290424 GGTTGCATTTGTAGGTAAGATGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959667569 3:108938900-108938922 GGCTGCATTCTGGGGGCAGATGG - Intronic
960031186 3:113056496-113056518 GGCTGCCTTTGGAAGGAATAAGG + Intergenic
967546110 3:190730654-190730676 TGATGCATTTGAAGGGCAGTGGG - Intergenic
967844747 3:194034773-194034795 GACTGGATTTGGAGGGAAGTAGG + Intergenic
968999212 4:3966499-3966521 GGCAGCATTGGTTGGGCAGAGGG + Intergenic
969399951 4:6947938-6947960 CCCTGCATTTGTAGGGCAGGCGG - Intronic
969592788 4:8131511-8131533 TTCTGCATGCGGAGGGCAGATGG + Intronic
969961875 4:10952694-10952716 TGCTGCATTTGGAAAGCAGCAGG + Intergenic
970439393 4:16067194-16067216 GCCTACGTTTGGAGGGCACAGGG + Intronic
971178450 4:24304604-24304626 GGTTGAATTTGGAGGTCTGATGG - Intergenic
971367843 4:25991908-25991930 GGGTGCATCTGGGAGGCAGAGGG - Intergenic
973740884 4:53918456-53918478 GGCTGCATAATGAGTGCAGATGG + Intronic
974344153 4:60657164-60657186 GGAGCCTTTTGGAGGGCAGAAGG - Intergenic
975333558 4:73148939-73148961 GGCTGCATGTGGTGGGCATGTGG - Exonic
977676873 4:99757745-99757767 GGCTGGATTTGGTGTGCAGGAGG - Intergenic
979782481 4:124670498-124670520 TGCTGCATTAGAAGGGCACAGGG - Exonic
984328252 4:178280990-178281012 GGCTGCAAATGGAGGGGAGGTGG + Intergenic
985528942 5:422498-422520 GGCACCACTTGGCGGGCAGACGG + Intronic
985558080 5:567953-567975 GGCGGCAGCTGGAGGGCAGGTGG - Intergenic
985560245 5:582117-582139 GGCTGCATCTGCTGGGCAGAGGG - Intergenic
985670750 5:1205402-1205424 GGCTGCATTTGGGGTGGAGTGGG + Intronic
986433583 5:7705594-7705616 GCCTGCAGATGCAGGGCAGAGGG + Intronic
988868393 5:35360807-35360829 GGCTCCATTTGGTGAGCAGCAGG + Intergenic
989128081 5:38076125-38076147 GGCTTCATTTGCAGGACAGTGGG + Intergenic
989213373 5:38879495-38879517 GGCTGCATTTAAGGGACAGAAGG + Intronic
990338913 5:54802902-54802924 GGACACATTTGGAGGGTAGATGG - Intergenic
991085825 5:62647657-62647679 GGCTGCCTTAGCAGGACAGAGGG - Intergenic
998513821 5:142735462-142735484 GGCTGCACTTCCAGGACAGAGGG - Intergenic
998884967 5:146684644-146684666 CGATGCATCTGGAGGGTAGATGG - Intronic
998985329 5:147750703-147750725 GGCTGTATTTGGAGATAAGAAGG + Intronic
999613598 5:153397918-153397940 ACTTGCATTTGGTGGGCAGAGGG - Intergenic
1000091213 5:157931192-157931214 GGCTTTATTTGGAGGGGAGCAGG + Intergenic
1000359780 5:160436268-160436290 AGCTGCAGTTTGAGGGTAGAGGG + Intergenic
1002082890 5:176748082-176748104 GGCTGCATCTGGGGTGCAGCAGG - Intergenic
1002175504 5:177399156-177399178 GGGTGAATTTAGAGGGCAGAGGG - Intergenic
1003130605 6:3392263-3392285 GGCTGGATTAGGACAGCAGAAGG + Intronic
1003182757 6:3806267-3806289 GGCTGGAGTTGGAAGACAGAGGG - Intergenic
1004056768 6:12146975-12146997 TGCTGCATTTGGAAGGCTGTTGG + Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1005302930 6:24488855-24488877 GGCAGGAGTTGGAGAGCAGAAGG - Intronic
1005652094 6:27893950-27893972 GCCTCCATTAGGAGGGAAGACGG + Intergenic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1007174762 6:39888125-39888147 GGGTGCATGTGGAGGGGATAGGG + Intronic
1011190382 6:84721172-84721194 GGTTGAATCTGGAAGGCAGAGGG - Intronic
1013606365 6:111752697-111752719 GACTGAATTTGGAGCTCAGAGGG + Intronic
1014431394 6:121374797-121374819 GGTTGCTTTTGGAGAGCAAAAGG - Intergenic
1015190387 6:130465491-130465513 GGCTGCATTTGGGGACTAGATGG + Intergenic
1015213377 6:130722225-130722247 GGCCCCCTTTGCAGGGCAGAGGG + Intergenic
1017013345 6:150080015-150080037 GTATGTACTTGGAGGGCAGATGG - Intergenic
1017561842 6:155636501-155636523 GGCTGCAGATGGAGGGCTGGGGG + Intergenic
1019643358 7:2116244-2116266 GGGTGCAGCTGGAGGGCAGGCGG + Intronic
1019733924 7:2641289-2641311 GGCTGCATTTTGGGGGCTGCGGG + Intronic
1024358663 7:48444917-48444939 GGCTACATATGGAGGGCAAGAGG - Intronic
1024575888 7:50763912-50763934 GGGTGCATTTGAAGTACAGAGGG - Intronic
1025004906 7:55345638-55345660 GACTGCATTTGGAGGCCAGTGGG - Intergenic
1026819233 7:73535695-73535717 GGCTGCATTTGGTGTACACAGGG + Intergenic
1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG + Intronic
1029465634 7:100722985-100723007 GGCCGCATCTGGAGGGGAGATGG - Exonic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032420583 7:131775980-131776002 GGCAGCATATGGTGGGCAAAAGG - Intergenic
1033140742 7:138824111-138824133 GGCTGCTTTTGAAGAGCAGCAGG - Intronic
1033432790 7:141304434-141304456 GTCTGCATATGCTGGGCAGAAGG - Intronic
1035474459 7:159132273-159132295 TGCTGCATTTGGTGGCCACAGGG + Intronic
1035478796 7:159164615-159164637 TGCTGCATTTGGTGGCCACAGGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039786946 8:40842207-40842229 AGGTGCACTTGGTGGGCAGAGGG - Intronic
1040850763 8:51898832-51898854 GGATGCGCTTGGAGGCCAGAGGG - Intronic
1041034170 8:53771082-53771104 GAAGGCATTTGCAGGGCAGACGG + Intronic
1041347341 8:56913238-56913260 GGCTACATTTGAAGGGAAGATGG - Intergenic
1041453313 8:58031116-58031138 AACTGCATTTGGAGGACAGAAGG + Intronic
1041638710 8:60173776-60173798 AAATGCATTTGGAGGGCAAAGGG - Intergenic
1042534234 8:69842641-69842663 TGCTTCATTTGTAGGACAGACGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1044623640 8:94215474-94215496 GCCTGCAGTTGGGGGGCAGAGGG + Intronic
1045989534 8:108289392-108289414 GGTTGCTTTTGGAGAGCAAAAGG + Intronic
1046813247 8:118555434-118555456 GGCTTCATTTGTAGGGGAAATGG - Intronic
1047215019 8:122869223-122869245 GGCTCCATGCGCAGGGCAGAAGG + Intronic
1047344149 8:124010832-124010854 TGCTGCATTTGGAGGGCACGTGG + Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049222839 8:141435760-141435782 GGCAGCAAGTGGCGGGCAGAGGG - Intergenic
1049561014 8:143310296-143310318 GGCTGCACTGGGAGGGAAGGCGG - Intronic
1049607644 8:143537099-143537121 GGCTGCACCTGCTGGGCAGAGGG - Intronic
1050051061 9:1602105-1602127 GGCTGCATTTGGAAGTTGGAAGG - Intergenic
1050161538 9:2724689-2724711 GGCTGCAATTGGAGGAATGAAGG + Intronic
1052742212 9:32404189-32404211 GACTGCTTTTGGAGGGAAGATGG - Intronic
1053125072 9:35574553-35574575 GGAAGGATTTGGGGGGCAGATGG - Intergenic
1053140671 9:35680710-35680732 GGCTGCTTTGGGAAGGAAGAGGG - Intronic
1053787660 9:41663934-41663956 GGCGGCTTTTGGGGGGCAGGGGG + Intergenic
1054157464 9:61650833-61650855 GGCGGCTTTTGGGGGGCAGGGGG - Intergenic
1054175937 9:61875276-61875298 GGCGGCTTTTGGGGGGCAGGGGG + Intergenic
1054477238 9:65581838-65581860 GGCGGCTTTTGGGGGGCAGGGGG - Intergenic
1054661602 9:67705532-67705554 GGCGGCTTTTGGGGGGCAGGGGG - Intergenic
1056065462 9:82929170-82929192 CGCTGCTTTTGGAAGCCAGATGG - Intergenic
1056904455 9:90633133-90633155 GGCGGCTTGTAGAGGGCAGAGGG + Intronic
1057179145 9:93020467-93020489 GGCTACCTGTGGAGAGCAGAAGG + Intronic
1057825430 9:98369255-98369277 GGCTGCATTTAGAGTGGGGAAGG - Intronic
1058534421 9:105942500-105942522 GAATCCATTTGGATGGCAGAAGG - Intergenic
1058648323 9:107151638-107151660 GGCTGCCTCTGGAGGATAGATGG + Intergenic
1059595151 9:115712216-115712238 GGCTGCAAGCGGAGGCCAGAGGG - Intergenic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1059901093 9:118926899-118926921 GGCTGTATTTGGTTGTCAGATGG + Intergenic
1060784647 9:126441050-126441072 GGCTGCATCGGGAGAACAGAAGG - Intronic
1061127166 9:128684317-128684339 GGCTGGATGTGGAGGGGTGAAGG - Intronic
1061188281 9:129067849-129067871 GGCTGGAGCTGGAGGGCCGAGGG + Exonic
1061206247 9:129165249-129165271 AACTGGATTTGGGGGGCAGAAGG + Intergenic
1061804582 9:133130989-133131011 GGCTGCAAGTGGAGGGCACAGGG + Intronic
1062010876 9:134266039-134266061 GGCTGCATCTTGAGGACAGGTGG + Intergenic
1185549041 X:968863-968885 AGCTGCATATGGAGGGAACACGG - Intergenic
1185612823 X:1402550-1402572 GGCTGCATTTGGGGAGGAGGAGG - Intergenic
1185681144 X:1889204-1889226 GGCTGCATATTGAAGGGAGATGG - Intergenic
1189849793 X:45166839-45166861 AGCTACATTTGGAAGGCTGAGGG + Intronic
1190289215 X:48981273-48981295 AGCTGCATTTGGAGCGGAAACGG - Exonic
1192422429 X:71045599-71045621 GGCTGCACTTGCTGGGCAGTCGG - Intergenic
1192732899 X:73819017-73819039 GGCTGGATGTGTAGGACAGAGGG - Intergenic
1193600711 X:83506082-83506104 GGCTCAATTTAGAGGTCAGAGGG - Intergenic
1195065783 X:101236979-101237001 TGGTTCATTTGGAGGGCAGCGGG + Intronic
1195356901 X:104047767-104047789 GGCAGCATTTGGAGGGAATGGGG + Intergenic
1195528595 X:105924451-105924473 AGATGCATTTGGATGGCAGAGGG - Intronic
1195837438 X:109133201-109133223 TGCTAAATTTAGAGGGCAGAGGG - Intergenic
1197698709 X:129579529-129579551 TTCTGCATTTGGTGGGAAGATGG - Intronic
1198012239 X:132569123-132569145 GGCTGAATCTGGAAGGTAGAGGG + Intergenic
1198020919 X:132657076-132657098 GGAGGCATTTGCAGGGGAGAGGG + Intronic
1201012017 Y:9556828-9556850 GGCTGAATGAGGATGGCAGAGGG + Intergenic
1201614629 Y:15883535-15883557 GGCTGATTTTGGAGGGAAGTTGG + Intergenic
1201615739 Y:15896242-15896264 GGCTGATTTTGGAGGGAAGTTGG - Intergenic